ID: 903164386

View in Genome Browser
Species Human (GRCh38)
Location 1:21510142-21510164
Sequence GGCAGGCTCCTTCGGCTTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164386_903164394 2 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67
903164386_903164399 13 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164386_903164398 12 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164398 1:21510177-21510199 CTTTGCGAGGTGGGCCTCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 167
903164386_903164391 -1 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
903164386_903164396 3 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164396 1:21510168-21510190 CCCTTTAGGCTTTGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164386 Original CRISPR GGCAGGCTCCTTCGGCTTCG CGG (reversed) Intronic