ID: 903164387

View in Genome Browser
Species Human (GRCh38)
Location 1:21510150-21510172
Sequence AAGGGGGCGGCAGGCTCCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164387_903164396 -5 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164396 1:21510168-21510190 CCCTTTAGGCTTTGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 70
903164387_903164391 -9 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
903164387_903164403 27 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164403 1:21510200-21510222 GCTGCTTCCCTGCCCAGTCTTGG 0: 1
1: 0
2: 4
3: 36
4: 446
903164387_903164394 -6 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67
903164387_903164399 5 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164387_903164398 4 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164398 1:21510177-21510199 CTTTGCGAGGTGGGCCTCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164387 Original CRISPR AAGGGGGCGGCAGGCTCCTT CGG (reversed) Intronic