ID: 903164390

View in Genome Browser
Species Human (GRCh38)
Location 1:21510163-21510185
Sequence CTCGCAAAGCCTAAAGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164390_903164399 -8 Left 903164390 1:21510163-21510185 CCGCCCCCTTTAGGCTTTGCGAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164390_903164403 14 Left 903164390 1:21510163-21510185 CCGCCCCCTTTAGGCTTTGCGAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 903164403 1:21510200-21510222 GCTGCTTCCCTGCCCAGTCTTGG 0: 1
1: 0
2: 4
3: 36
4: 446
903164390_903164406 23 Left 903164390 1:21510163-21510185 CCGCCCCCTTTAGGCTTTGCGAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 903164406 1:21510209-21510231 CTGCCCAGTCTTGGTAAGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 128
903164390_903164398 -9 Left 903164390 1:21510163-21510185 CCGCCCCCTTTAGGCTTTGCGAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 903164398 1:21510177-21510199 CTTTGCGAGGTGGGCCTCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 167
903164390_903164407 24 Left 903164390 1:21510163-21510185 CCGCCCCCTTTAGGCTTTGCGAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 903164407 1:21510210-21510232 TGCCCAGTCTTGGTAAGAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164390 Original CRISPR CTCGCAAAGCCTAAAGGGGG CGG (reversed) Intronic