ID: 903164391

View in Genome Browser
Species Human (GRCh38)
Location 1:21510164-21510186
Sequence CGCCCCCTTTAGGCTTTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164387_903164391 -9 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
903164385_903164391 0 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
903164386_903164391 -1 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33
903164382_903164391 27 Left 903164382 1:21510114-21510136 CCGCAGCTGTGGGGCAAAGCTCT 0: 1
1: 0
2: 1
3: 17
4: 163
Right 903164391 1:21510164-21510186 CGCCCCCTTTAGGCTTTGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164391 Original CRISPR CGCCCCCTTTAGGCTTTGCG AGG Intronic