ID: 903164394

View in Genome Browser
Species Human (GRCh38)
Location 1:21510167-21510189
Sequence CCCCTTTAGGCTTTGCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164385_903164394 3 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67
903164387_903164394 -6 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67
903164382_903164394 30 Left 903164382 1:21510114-21510136 CCGCAGCTGTGGGGCAAAGCTCT 0: 1
1: 0
2: 1
3: 17
4: 163
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67
903164386_903164394 2 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164394 1:21510167-21510189 CCCCTTTAGGCTTTGCGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164394 Original CRISPR CCCCTTTAGGCTTTGCGAGG TGG Intronic