ID: 903164396

View in Genome Browser
Species Human (GRCh38)
Location 1:21510168-21510190
Sequence CCCTTTAGGCTTTGCGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164387_903164396 -5 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164396 1:21510168-21510190 CCCTTTAGGCTTTGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 70
903164386_903164396 3 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164396 1:21510168-21510190 CCCTTTAGGCTTTGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 70
903164385_903164396 4 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164396 1:21510168-21510190 CCCTTTAGGCTTTGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164396 Original CRISPR CCCTTTAGGCTTTGCGAGGT GGG Intronic