ID: 903164399

View in Genome Browser
Species Human (GRCh38)
Location 1:21510178-21510200
Sequence TTTGCGAGGTGGGCCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903164385_903164399 14 Left 903164385 1:21510141-21510163 CCCGCGAAGCCGAAGGAGCCTGC 0: 1
1: 0
2: 0
3: 4
4: 85
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164386_903164399 13 Left 903164386 1:21510142-21510164 CCGCGAAGCCGAAGGAGCCTGCC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164389_903164399 -4 Left 903164389 1:21510159-21510181 CCTGCCGCCCCCTTTAGGCTTTG 0: 1
1: 0
2: 0
3: 3
4: 95
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164387_903164399 5 Left 903164387 1:21510150-21510172 CCGAAGGAGCCTGCCGCCCCCTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79
903164390_903164399 -8 Left 903164390 1:21510163-21510185 CCGCCCCCTTTAGGCTTTGCGAG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 903164399 1:21510178-21510200 TTTGCGAGGTGGGCCTCCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903164399 Original CRISPR TTTGCGAGGTGGGCCTCCCA GGG Intronic