ID: 903165451

View in Genome Browser
Species Human (GRCh38)
Location 1:21517380-21517402
Sequence CCAATCTGATTGGGCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903165451_903165459 30 Left 903165451 1:21517380-21517402 CCAGGGTTGCCCAATCAGATTGG 0: 1
1: 0
2: 1
3: 5
4: 76
Right 903165459 1:21517433-21517455 AGAGCTCTCAGGGCACCTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 179
903165451_903165457 19 Left 903165451 1:21517380-21517402 CCAGGGTTGCCCAATCAGATTGG 0: 1
1: 0
2: 1
3: 5
4: 76
Right 903165457 1:21517422-21517444 ATGTTTGGAGAAGAGCTCTCAGG 0: 1
1: 0
2: 1
3: 18
4: 220
903165451_903165458 20 Left 903165451 1:21517380-21517402 CCAGGGTTGCCCAATCAGATTGG 0: 1
1: 0
2: 1
3: 5
4: 76
Right 903165458 1:21517423-21517445 TGTTTGGAGAAGAGCTCTCAGGG 0: 1
1: 0
2: 1
3: 17
4: 223
903165451_903165456 4 Left 903165451 1:21517380-21517402 CCAGGGTTGCCCAATCAGATTGG 0: 1
1: 0
2: 1
3: 5
4: 76
Right 903165456 1:21517407-21517429 TGGATTCAAATTTGCATGTTTGG 0: 1
1: 0
2: 1
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903165451 Original CRISPR CCAATCTGATTGGGCAACCC TGG (reversed) Intronic
900157880 1:1210847-1210869 CCAAGCTCCTTGGGCAACCCGGG + Intergenic
900164993 1:1240984-1241006 CCAAACTGACGGGCCAACCCTGG - Intergenic
900991008 1:6098361-6098383 CAGATGTGATGGGGCAACCCGGG + Intronic
903010039 1:20323318-20323340 ACACTCTGATTGGGCAATCAGGG - Intronic
903165451 1:21517380-21517402 CCAATCTGATTGGGCAACCCTGG - Intronic
904049173 1:27627965-27627987 CCACTGTGACTGGCCAACCCTGG - Intronic
904298402 1:29538733-29538755 CAAATCTGACTGGCCAAGCCTGG - Intergenic
905448541 1:38043166-38043188 CCAATTTGCTTGGGCAAAGCCGG - Intergenic
911815913 1:102350664-102350686 ACAAGTTGATTGGGCAACCAAGG - Intergenic
912428451 1:109614856-109614878 CCAATTTGATTGGGAAAACATGG - Exonic
914334140 1:146699890-146699912 CACATCTGATTCGGCAGCCCAGG - Intergenic
914380052 1:147107547-147107569 CAAATCTGGTTGGGGAAGCCTGG + Intergenic
917717545 1:177753546-177753568 CCTATCTGGCTGTGCAACCCTGG - Intergenic
919862247 1:201747857-201747879 GGAATCTGAGTTGGCAACCCAGG - Intronic
921729651 1:218563075-218563097 CCTTTCTGATTAGGCAAACCAGG - Intergenic
1066345765 10:34584715-34584737 GCATTATGATTGGGCAAACCAGG - Intronic
1070949770 10:80421587-80421609 CAAATAAGATTGGGAAACCCTGG - Intronic
1074886743 10:117699957-117699979 GCAATCTGTTATGGCAACCCTGG + Intergenic
1079054191 11:17191267-17191289 CCTTTCTGGTTGGCCAACCCTGG - Intronic
1084597524 11:70125901-70125923 CCAACCTGATGGGGCGGCCCAGG + Intronic
1085277121 11:75307390-75307412 CCAATCTGATGGGGGATCCATGG - Intronic
1105681943 13:22736973-22736995 CCTCTCTGCTTGGGAAACCCTGG - Intergenic
1112334360 13:98501840-98501862 CCAAACTGATAGGGCAACAGGGG - Intronic
1118355882 14:65013298-65013320 CAAAGATGATTTGGCAACCCTGG - Intronic
1118549839 14:66938130-66938152 ACAAACTGATTGTGCAACCAAGG - Intronic
1125738889 15:41947730-41947752 TCAATCTAATAGGGCAACCAGGG - Intronic
1137452244 16:48587676-48587698 ACAAACTGATTGTGCAACCCAGG + Intronic
1137772439 16:51027219-51027241 CCTTTCTGATTGGACCACCCTGG - Intergenic
1138168326 16:54824405-54824427 ATACTCTGATTGGGCAAGCCTGG - Intergenic
1139999481 16:71011354-71011376 CACATCTGATTCGGCAGCCCAGG + Intronic
1140557748 16:75940949-75940971 CCAGTCTTGTTGGGCAACTCAGG + Intergenic
1141790493 16:86231053-86231075 GGGATCTGATTGGGCATCCCTGG + Intergenic
1142871196 17:2822106-2822128 ACCATGGGATTGGGCAACCCTGG - Intronic
1144006417 17:11104165-11104187 CAAATCTAATTGGGAGACCCTGG + Intergenic
1144718174 17:17448941-17448963 CACATCTGATTGGCCAGCCCTGG - Intergenic
1152706594 17:81846744-81846766 CTGGTCTGGTTGGGCAACCCCGG - Intronic
1153497762 18:5717484-5717506 CCAATCAGGCTGGGCAGCCCTGG - Intergenic
1158155593 18:54422397-54422419 ACAGTCTGATTGGGCACCCCTGG + Intergenic
1159518628 18:69489590-69489612 CCAATGTGAATGGGGAAGCCAGG - Intronic
1163942070 19:20504538-20504560 CCAATCTAATTGGACAAGCTTGG - Intergenic
1164794807 19:31017268-31017290 CCAAGCTGACTGAGCAACCATGG + Intergenic
928777907 2:34789258-34789280 TCAATTTGACTGGGCCACCCAGG + Intergenic
931934637 2:67183107-67183129 CCAAACTGATTGGCCAATTCAGG + Intergenic
932641012 2:73446773-73446795 CCAATAACATTGGGCATCCCTGG + Intronic
936151332 2:110023911-110023933 GCACTCTGATGGGGCATCCCAGG + Intergenic
936193343 2:110347458-110347480 GCACTCTGATGGGGCATCCCAGG - Intergenic
940009998 2:149042359-149042381 GGAATCAGATTGGGCAACCAAGG + Intronic
944225475 2:197345049-197345071 CCAAGCTGATCGGGAACCCCTGG - Intergenic
948083587 2:235227480-235227502 CCAATCTGATTGGCCAAACCAGG + Intergenic
1179253655 21:39696775-39696797 GCACTCTGATTGGCCAGCCCTGG - Intergenic
1184256985 22:43292957-43292979 CCATTCTGACTGGGGAAGCCTGG + Intronic
954592873 3:51798759-51798781 CAAATTTGATTGGCCAATCCTGG - Intergenic
962164279 3:133032924-133032946 CCAATCAGAATGGGCACCCAGGG - Intergenic
968292068 3:197546722-197546744 CCAAACACACTGGGCAACCCTGG + Intronic
968684590 4:1948981-1949003 CCCATCTGATGGGGGAACCAAGG - Intronic
970677966 4:18474527-18474549 ACAATCTGATTCTGCAACCCAGG + Intergenic
972354620 4:38268827-38268849 CCAAGGTCATTTGGCAACCCTGG + Intergenic
982669913 4:158307918-158307940 TCATACTGATTGGGCAAACCTGG + Intergenic
993430395 5:87825694-87825716 GGAATCTGATTGGCCCACCCTGG + Intergenic
1001014507 5:168128103-168128125 TCCATCTGATTGGGCATCCGAGG + Intronic
1006238747 6:32658988-32659010 ACATTCTGATTGGCCAAGCCTGG - Intergenic
1007158812 6:39772243-39772265 CCAATCTGCCTGGCCAACCTAGG + Intergenic
1017519520 6:155189373-155189395 ACAATCTGATTGGGAAATACTGG + Intronic
1018915530 6:168130367-168130389 CCGATCTCATTGGTCAGCCCAGG - Intergenic
1023513275 7:40975987-40976009 CCAATCTAAATGGCCAAACCAGG + Intergenic
1026343961 7:69457946-69457968 CCACTCTGATTGTGCTGCCCTGG - Intergenic
1028863885 7:95685419-95685441 CAAATCTGATTGTGGAAACCTGG - Intergenic
1037569232 8:20144674-20144696 CCCATCTGTTTGGGCAAACAGGG - Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1046907432 8:119588674-119588696 GCAACCTGATTGAGCAAGCCAGG + Intronic
1047992157 8:130297530-130297552 CCAATCTGATTCCACAGCCCAGG + Intronic
1049204790 8:141358728-141358750 CCAGTCTCACTGGGCACCCCAGG + Intronic
1053326018 9:37152027-37152049 CTAATCTGATCTGGCAACCTGGG + Intronic
1055651760 9:78413435-78413457 ACTACCTGAATGGGCAACCCTGG - Intergenic
1056381889 9:86063300-86063322 CCAATCTCAATGGGCACCCCAGG + Intronic
1059576077 9:115490006-115490028 CCCATCTGATTGGGCACCAGGGG + Intergenic
1187010639 X:15275083-15275105 GCAAACAGATTGGGCAACGCAGG - Intergenic
1187607842 X:20905749-20905771 GCAATCTGTTTGGGCATCCAAGG + Intergenic
1189568330 X:42267886-42267908 CCAATCTGAGTAGAAAACCCAGG + Intergenic
1190179034 X:48175841-48175863 CCAACCTCCTTGGGCAACTCAGG + Intergenic
1190197884 X:48335247-48335269 CCAACCTCCTTGGGCAACTCAGG + Intergenic
1190664631 X:52685682-52685704 CCAACCTCCTTGGGCAACTCAGG + Intronic
1190674791 X:52772736-52772758 CCAACCTCCTTGGGCAACTCAGG - Intronic