ID: 903168694

View in Genome Browser
Species Human (GRCh38)
Location 1:21538718-21538740
Sequence AGGGTGCGCCCACCTGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903168675_903168694 26 Left 903168675 1:21538669-21538691 CCCTGTCTTGAGGATGAGTTGAA 0: 1
1: 0
2: 1
3: 5
4: 151
Right 903168694 1:21538718-21538740 AGGGTGCGCCCACCTGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 121
903168676_903168694 25 Left 903168676 1:21538670-21538692 CCTGTCTTGAGGATGAGTTGAAG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 903168694 1:21538718-21538740 AGGGTGCGCCCACCTGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903168694 Original CRISPR AGGGTGCGCCCACCTGGCCG GGG Intronic
900189841 1:1348709-1348731 GGCGCGCGCCCACCTGTCCGTGG - Intronic
900404342 1:2485902-2485924 GGGATGCCCCCACCTGGCCGGGG + Intronic
900436491 1:2633541-2633563 AGGGTGGGCAGCCCTGGCCGGGG + Intergenic
900645522 1:3707079-3707101 AGGGTGCGCACACCTGGGCTTGG - Intronic
900986423 1:6075600-6075622 AGGGGGGGCCCGCCTGGCTGCGG + Intronic
903125467 1:21244563-21244585 AGGTAGAGCCCACCTGGCCTGGG + Intronic
903168694 1:21538718-21538740 AGGGTGCGCCCACCTGGCCGGGG + Intronic
903301692 1:22383727-22383749 AGGCTGTGCACACCTGGGCGTGG + Intergenic
903331065 1:22597530-22597552 TGGGTGCCCCCACCTTGCCCTGG - Intronic
903476020 1:23619659-23619681 CGGGTGCGCCCGCGTGGGCGTGG + Intronic
904744524 1:32702785-32702807 CGGGCGCGCCCACTTGGCCGGGG + Exonic
905923516 1:41734125-41734147 AGGCTGCACCCACCAGGCCTGGG + Intronic
914196136 1:145448954-145448976 AGGCTGCGTCCTCCTGGGCGAGG - Intergenic
924414899 1:243849607-243849629 AGGGGGCGCCCGCCTGGACCGGG - Intronic
1069554279 10:69386992-69387014 AGGCTGTGCCCACCTGTCAGGGG - Intronic
1071499131 10:86191247-86191269 AGGGACAGCCCACCTGGCAGGGG + Intronic
1072628744 10:97131393-97131415 AGGCTGCGCCCACCCAGCCCTGG + Intronic
1075604941 10:123797963-123797985 AGGGTGAACTCACCTGGCAGTGG + Exonic
1075778631 10:125003325-125003347 AGGGTGGGCCCACCTTCTCGTGG + Exonic
1076622993 10:131804731-131804753 AGGCTGCGGCCACATGGCGGAGG - Intergenic
1076888505 10:133273243-133273265 AGGGTGCTCACCCCGGGCCGAGG + Exonic
1077268126 11:1662050-1662072 AGGGGTTGCCCACCTGGCTGTGG + Intergenic
1077326777 11:1967396-1967418 AGGGGGCGCCCGCCAGGCCCGGG + Intronic
1077444610 11:2585151-2585173 AGGCTGCACCCAGCTGGCAGTGG + Intronic
1083411019 11:62492417-62492439 AAGGAGAGCCCACCTGGCCATGG + Intronic
1084150651 11:67286428-67286450 AGGGTGCGCCAACCCAGCCCCGG - Exonic
1089194812 11:116688071-116688093 AGGCTCCACCCACCTGGCCTGGG + Intergenic
1202809758 11_KI270721v1_random:22576-22598 AGGGGGCGCCCGCCAGGCCCGGG + Intergenic
1093844362 12:23950637-23950659 AGGAAGCGCCCCCCTGGCTGTGG + Intronic
1094638735 12:32252694-32252716 AGCGTGAGGCCACCTGGCCTGGG - Intronic
1096309109 12:50504943-50504965 GCGGTGCGTCCTCCTGGCCGGGG + Intergenic
1103459067 12:121089490-121089512 AGTGTGGCCCCACCTGGCCAGGG - Intergenic
1104973120 12:132540420-132540442 AGAGTGCGCCCAGCTGGTCCCGG + Intronic
1104991228 12:132624892-132624914 AGGGAGAGCCCACCTGGGTGTGG + Exonic
1111518299 13:89363480-89363502 AGCCGGCGCCCACCTGCCCGCGG - Intergenic
1113747109 13:112752855-112752877 AGGATGCACCCACCTGGGAGTGG + Intronic
1113896541 13:113768312-113768334 AGGTGACGCCCACCTGGCAGAGG - Intronic
1113941273 13:114019705-114019727 AGGCTCCACCCACCTGGCGGGGG - Intronic
1113941337 13:114019945-114019967 AGGCTCCACCCACCTGGCGGGGG - Intronic
1113941349 13:114019984-114020006 AGGCTCCACCCACCTGGCGGGGG - Intronic
1113941403 13:114020183-114020205 AGGCTCCACCCACCTGGCGGGGG - Intronic
1113941425 13:114020266-114020288 AGGCTCCACCCACCTGACCGGGG - Intronic
1113976999 13:114235123-114235145 CGGGGCCGCCCACCTGGTCGAGG - Exonic
1117315198 14:54566301-54566323 AGGGAGCGCTCACCTCGGCGCGG - Intergenic
1117478140 14:56118217-56118239 AGGGGGCGCCCCGCGGGCCGGGG + Intronic
1122900789 14:104781581-104781603 AGGGAGAGGTCACCTGGCCGGGG - Intronic
1124905878 15:33867997-33868019 AGGGTGCCCCCACCAGGGCCTGG - Intronic
1125862004 15:43008378-43008400 AGTGTGCACACACCTGGCCGGGG - Intronic
1125999518 15:44195528-44195550 TGGGTGCTCACACCTGGCCCGGG - Intergenic
1128715440 15:69904447-69904469 AGGGTGGGGGCACCTGGCCAGGG + Intergenic
1132508172 16:322950-322972 AGGGAGCGGTCACCTGGCAGAGG + Intronic
1132685369 16:1159849-1159871 AGGGTGCCCGCAGCTGGCCCCGG - Intronic
1132843678 16:1990376-1990398 AGGGCGCGCCCACCTGCGGGCGG + Intronic
1136283647 16:29229085-29229107 AGGGCAGGCCCACCTGGCCTTGG + Intergenic
1136995929 16:35188029-35188051 AGAGTGCTCCCAGCTGGCCTGGG - Intergenic
1142088679 16:88198596-88198618 AGGGCAGGCCCACCTGGCCTTGG + Intergenic
1142179899 16:88663298-88663320 AGGGTGCGCTCGCCAGGCCTGGG + Intergenic
1142218775 16:88842653-88842675 GGGGTGAGCCCAACAGGCCGAGG - Intronic
1142338758 16:89507612-89507634 AGGGTCCGCCCTCCGGGCCCGGG - Intronic
1203145324 16_KI270728v1_random:1794895-1794917 AGGGTGGGCCCTGCAGGCCGTGG + Intergenic
1149487523 17:57054543-57054565 AGGGTGCTCCCAAGTGGCTGTGG + Intergenic
1152493535 17:80654162-80654184 AGGGTGCGACCCCCTGGCCTAGG - Intronic
1156461042 18:37321492-37321514 AGGGTGTGCCCACCTCGATGTGG - Intronic
1160498974 18:79393245-79393267 AGGGTGGGCGCACCTGCCCCTGG + Intergenic
1160726482 19:619933-619955 AGGGTGTGCCCTGCTGCCCGGGG - Intronic
1160993807 19:1872728-1872750 AGGGAGCGCGGGCCTGGCCGGGG + Intergenic
1161804086 19:6432233-6432255 AAGGTGCCCCAACCTGGCTGAGG - Intronic
1163789255 19:19296976-19296998 AGGGTCTGCCCACCTGACAGAGG + Exonic
1163790154 19:19301731-19301753 AGGGTACGACCGCATGGCCGGGG + Intronic
1164668960 19:30062391-30062413 AGGGTGCTCCCATCTGGAGGAGG + Intergenic
1164668989 19:30062492-30062514 AGGGTGCTCCCATCTGGAGGAGG + Intergenic
1164669015 19:30062592-30062614 AGGGTGCTCCCATCTGGAGGAGG + Intergenic
1164709155 19:30343075-30343097 AGGCTGTCCCCACCGGGCCGAGG - Intronic
1167250036 19:48394683-48394705 AGGTTGCGGCCACCTGGACTAGG - Intergenic
927149464 2:20187431-20187453 AGGCTGGGACCACCTGGCCCTGG + Intergenic
932812122 2:74834408-74834430 AGGGTGCGCCCGGCTGGCGGAGG - Exonic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
946396533 2:219446169-219446191 AGGGAGCCTCCCCCTGGCCGTGG - Intronic
947613891 2:231541892-231541914 AGGGTGTGCACACCAGGACGCGG - Intergenic
948517369 2:238512148-238512170 AGGGTGCGCCCTCCTGGGGAGGG - Intergenic
1173866132 20:46313676-46313698 AGGGCGGGCCCACCAGGCTGCGG - Intergenic
1174357761 20:50009894-50009916 AGGCTGCGCCTGCCGGGCCGAGG + Intergenic
1175981404 20:62740603-62740625 GGGGAGCCCCCACCTGGCCACGG + Intronic
1178640595 21:34342378-34342400 AGGGTGCTCCTTCCTGGCCTCGG + Intergenic
1179586340 21:42376152-42376174 AGGGAGGGTCCACCTGGCCAGGG + Intronic
1180157398 21:45984158-45984180 AGGCTGCCCCACCCTGGCCGTGG - Intronic
1181064456 22:20299037-20299059 AGGCCCCGCCCACCGGGCCGTGG - Intergenic
1182298292 22:29323443-29323465 AGGGTTCCCCCACGTGGCCCAGG - Intergenic
1182826021 22:33265528-33265550 AGGGTGCTCACTCCAGGCCGGGG - Intronic
1183217377 22:36489766-36489788 AGGCAGCTCCCACCTGGCAGAGG + Exonic
1184071608 22:42150670-42150692 AGACTGGGCCCACCTGGCAGTGG + Intergenic
953869449 3:46613750-46613772 AGGGTGCCCTGACCTGGCCGAGG - Intronic
954613500 3:51958225-51958247 AGGGTGTGCCCAGCAGGCCAGGG + Exonic
958936494 3:100261210-100261232 AGGGGGCACCCAGCTGGCAGAGG - Intronic
964720313 3:159763661-159763683 AGGACGCGCCCTCCTGGCGGTGG - Intronic
968626471 4:1628506-1628528 AGGGAGGGCGCACCTGGGCGGGG + Intronic
983728267 4:170958054-170958076 AGGATGAGCCCTCCTGGCCATGG + Intergenic
985068273 4:186144471-186144493 AGGGTGCGCACACCAGGCTGGGG - Intronic
985573806 5:664547-664569 AGAGTGAGGCCACCTGGCGGGGG - Exonic
986132251 5:4942412-4942434 AAGGGGCGCCCTCCTGGCCCAGG - Intergenic
986559508 5:9046517-9046539 AGTGAGTGCCCACCTGGCCTAGG + Intronic
995142353 5:108748702-108748724 AGCGTGCGCCCACCCAGCCTAGG + Intronic
998347574 5:141477824-141477846 ACCGAGCTCCCACCTGGCCGAGG - Exonic
1002568832 5:180128795-180128817 AGGGTGGGGCCACCTGGCAAGGG + Intronic
1005687296 6:28267204-28267226 AGGGTCCGCTCACCTGGTCAAGG - Exonic
1006665120 6:35688369-35688391 AGGGTCCGGCCGCCTGTCCGGGG + Intronic
1017717453 6:157222680-157222702 TGGTTGCCCCCACCTGGCCCTGG + Intergenic
1018774185 6:166998766-166998788 AGGGTGCGTTCGCCTGGCTGGGG + Intergenic
1023818966 7:43969832-43969854 CGGGTGGGCCCACCTGACGGAGG - Intergenic
1025650209 7:63459715-63459737 TGGGTGGGCCCTCCTGGCCTTGG - Intergenic
1026000765 7:66557897-66557919 AGGGGGTGCCCGCCTGGCAGGGG + Intergenic
1027230117 7:76267619-76267641 CCGTTGCGCCCACCTGGCCCTGG + Intronic
1029744018 7:102506795-102506817 CGGGTGGGCCCACCTGACAGAGG - Exonic
1029762007 7:102605958-102605980 CGGGTGGGCCCACCTGACGGAGG - Exonic
1032095856 7:128938261-128938283 AGGGTGCGCCCGGCCGGCCTGGG + Intronic
1032125472 7:129189521-129189543 AGGGTGCCCCCATCTTACCGCGG - Intronic
1034200888 7:149282253-149282275 AGTGTGGGCCCACCTGGCCTCGG - Exonic
1035687468 8:1536110-1536132 AGGGTGCCCCCACCTGCCCTAGG - Intronic
1038436468 8:27540081-27540103 AGGATGCAGCCACCTGGCCTGGG + Intronic
1038883796 8:31640759-31640781 GGGATGCGCCCTCCTCGCCGCGG - Intronic
1045699467 8:104849850-104849872 AGGGTGGGTCCTCCTGGCCTGGG - Intronic
1047416210 8:124666744-124666766 AGAGTGAGCCCAGCTGGCCGAGG + Intronic
1049095203 8:140544581-140544603 AGGGTGAGCCCTCCTGGGCCTGG - Intronic
1057468469 9:95337410-95337432 AGTGTGTGCACACCTGGCTGGGG - Intergenic
1057503006 9:95610751-95610773 AGGAAGGGCCCACCGGGCCGGGG - Intergenic
1060487893 9:124061109-124061131 AGGCTGCTCCCACCTCGCCCGGG - Intergenic
1062008226 9:134252429-134252451 AGGGTGAGCCCACCGGTCCCGGG + Intergenic
1062401676 9:136375502-136375524 AGGGACCCCCCACCTGGCTGGGG - Intergenic
1062698596 9:137887881-137887903 AGGCTGCGTCCTCCTGGGCGAGG + Intronic
1185461104 X:333116-333138 AGGGTGGGCCCTGCGGGCCGTGG + Intergenic
1185779055 X:2829570-2829592 AGGGAGGGGGCACCTGGCCGGGG + Intronic
1193360633 X:80574758-80574780 AGGGTGCGCCCGGCTGGCGGAGG + Intergenic
1198331983 X:135630519-135630541 AGGGTGCACCCAACTGCCCCTGG - Intergenic
1200497126 Y:3899899-3899921 AGGGTTGGCCCCCCTGGCCTTGG + Intergenic