ID: 903168712

View in Genome Browser
Species Human (GRCh38)
Location 1:21538794-21538816
Sequence AACTCACTTGGGGCTTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903168712_903168720 28 Left 903168712 1:21538794-21538816 CCACTGCAAGCCCCAAGTGAGTT 0: 1
1: 0
2: 1
3: 15
4: 129
Right 903168720 1:21538845-21538867 TGCAAAGATCAGAAGAGACTTGG 0: 1
1: 0
2: 4
3: 33
4: 621
903168712_903168718 -8 Left 903168712 1:21538794-21538816 CCACTGCAAGCCCCAAGTGAGTT 0: 1
1: 0
2: 1
3: 15
4: 129
Right 903168718 1:21538809-21538831 AGTGAGTTGCACTGCAGGGCTGG 0: 1
1: 0
2: 1
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903168712 Original CRISPR AACTCACTTGGGGCTTGCAG TGG (reversed) Intronic
902043433 1:13508910-13508932 ATCTGACCTGGGGCTTGCTGGGG - Intronic
902374087 1:16022151-16022173 ACCTCACTTTGGCTTTGCAGAGG + Intronic
903168712 1:21538794-21538816 AACTCACTTGGGGCTTGCAGTGG - Intronic
903627744 1:24743734-24743756 AACTTACTTTGGGCTGGCAGAGG + Intergenic
904435570 1:30492639-30492661 CACTCACCTGGGGCTGGCGGTGG + Intergenic
905279143 1:36837763-36837785 AGCCCACTTGGGGAGTGCAGAGG - Intronic
906025151 1:42667084-42667106 AACTAAATTGGGGCTTAAAGAGG - Intronic
908256690 1:62308961-62308983 ACCTCCCTTGGGGCTCCCAGGGG + Intronic
915756133 1:158261744-158261766 AACACAGCTGGGGCTGGCAGAGG - Intergenic
916718448 1:167464254-167464276 AAATCACCTTGGGATTGCAGTGG + Intronic
920176402 1:204104542-204104564 AGCTCTCTGGGGGCTTTCAGAGG + Intronic
922230828 1:223684166-223684188 ATCTCACCTGGGACTAGCAGAGG - Intergenic
922947560 1:229529955-229529977 AAGTCACTCTGGGCTTGAAGAGG + Intronic
923626615 1:235618941-235618963 AACTCACTGGCGGCGTGCAGTGG - Intronic
923826695 1:237508548-237508570 AACTTACTAGGAGTTTGCAGTGG - Intronic
1069996062 10:72342881-72342903 TATACACCTGGGGCTTGCAGTGG - Intronic
1070290075 10:75108325-75108347 ACCCCACTTGGAGCTTGCTGGGG - Intronic
1071927504 10:90427429-90427451 AGTTCAATTGGGGCCTGCAGTGG - Intergenic
1072060085 10:91801240-91801262 AACTCTCTTGGTGCTAGCAACGG - Intronic
1072728547 10:97829587-97829609 AACTCACGTGGGGATTGGTGAGG + Intergenic
1075298497 10:121299323-121299345 AACTCACGTGGGGGATGCAGAGG + Intergenic
1075807966 10:125203626-125203648 AACTCCCTTTGGGGATGCAGGGG + Intergenic
1076746672 10:132517996-132518018 CACTGACGTGGGGCCTGCAGGGG + Intergenic
1076782223 10:132730654-132730676 AATCCACTTGGGGCATGCAGAGG - Intronic
1077391224 11:2301484-2301506 CACTCACGTGGGGCCTCCAGGGG - Intronic
1079058256 11:17226183-17226205 AACTCACTTGTGGCTGGGTGTGG + Intronic
1081702480 11:45160873-45160895 AACTCTCTGAGGGCTAGCAGGGG - Intronic
1085448195 11:76615214-76615236 GACACAGTGGGGGCTTGCAGGGG - Intergenic
1086486639 11:87310458-87310480 AAGTCACTGGGGGCTTCTAGAGG + Intronic
1090061186 11:123465474-123465496 AACACACTTGGGGCGTGGTGTGG + Intergenic
1090535954 11:127641822-127641844 AATTCATTAAGGGCTTGCAGTGG + Intergenic
1090702133 11:129305990-129306012 AACTGACTTGGCGGTTGCAAAGG - Intergenic
1092671910 12:10872462-10872484 AACACACTGGGGCCTTTCAGAGG + Intronic
1093992728 12:25608663-25608685 CACTCTCTTGTGGCTTGTAGGGG + Intronic
1097229684 12:57502414-57502436 AACTCACTTGGGGCCAGGTGTGG + Intronic
1099680105 12:85816135-85816157 AACACACTGGGGCCTTTCAGAGG + Intronic
1103121545 12:118384297-118384319 ATCTCACTTGGGACTTTCAATGG + Intronic
1104138696 12:125965273-125965295 GACTCACTGGGGGCTATCAGGGG + Intergenic
1111091457 13:83452735-83452757 AGCTCAGTGTGGGCTTGCAGGGG + Intergenic
1112059542 13:95723940-95723962 AACTCAGGTGGGGCTTTCAGAGG + Intronic
1115024056 14:28719222-28719244 AGCTCACCTGGGGCTGCCAGAGG - Intergenic
1118558117 14:67049071-67049093 AACTCACTGGGGCCTTCAAGAGG + Intronic
1120523026 14:85546790-85546812 AACTCACTTGGGTTTTCCACTGG + Intronic
1122723302 14:103734383-103734405 AACTGAATTTGAGCTTGCAGGGG + Exonic
1123119309 14:105909486-105909508 CCCTCACTTGGGGCCTGCTGCGG - Intergenic
1127779520 15:62299042-62299064 AATCCACTTGGGGCTTGCAGGGG + Intergenic
1131649782 15:94386412-94386434 AACTCACTTGATGTTTACAGAGG + Intronic
1131921989 15:97338127-97338149 AAATAACTTGAGGCTTGCAATGG - Intergenic
1134340943 16:13345268-13345290 CACACACTTGGGCCTTTCAGAGG - Intergenic
1136537561 16:30909247-30909269 CACAAACTTCGGGCTTGCAGTGG + Intergenic
1138332824 16:56228710-56228732 AACTCACTTGCAGCATGCTGTGG + Intronic
1138589779 16:57993465-57993487 AGCTCACATGGAGCCTGCAGTGG - Intergenic
1140544447 16:75792772-75792794 AACTCACATCGGGCTTACACCGG - Intergenic
1141853316 16:86663171-86663193 TACTCACCTGAGGCTTACAGAGG + Intergenic
1145411949 17:22673790-22673812 AAGTCAATTGAGGCCTGCAGTGG - Intergenic
1147792754 17:43023633-43023655 AATTCACTGTGGTCTTGCAGTGG + Intronic
1148063485 17:44852315-44852337 ACCTCACTTAGGGCTTGGAGAGG + Intronic
1150571284 17:66389296-66389318 GACTCACTTGGGCCTCCCAGAGG + Intronic
1154105019 18:11515329-11515351 AACGCAATTAGGGCTTACAGTGG - Intergenic
1155570177 18:27184747-27184769 ACCCCTCTTGGGGCATGCAGAGG - Intronic
1156206699 18:34894236-34894258 AACTCCCTTGAGGCTTTTAGAGG - Intergenic
1160923438 19:1531532-1531554 AACTAATTTCTGGCTTGCAGAGG - Intronic
1162212917 19:9107307-9107329 AACTCACATGGATATTGCAGAGG + Intergenic
1164518276 19:28955256-28955278 CTCTCTCTTTGGGCTTGCAGTGG + Intergenic
1165532515 19:36416419-36416441 AATTCATTTGAGGCTTTCAGGGG - Intronic
926534770 2:14098063-14098085 AATTCTCTTGGGGAATGCAGGGG + Intergenic
927613302 2:24564009-24564031 AAATCAATTGGGGCTTGCCTTGG - Intronic
927883337 2:26704149-26704171 AACTCCCTGGGGGCTGACAGAGG - Intronic
932249848 2:70233476-70233498 AAGTCACTTGCGGCTGGCTGTGG + Intronic
940020640 2:149152905-149152927 AAGTCACCTGGGCATTGCAGTGG + Intronic
946371395 2:219283575-219283597 AACTCACTTAGGGCTTGGGAGGG + Intronic
948183908 2:236003982-236004004 AACTCACTTAGGGCTTTTACAGG + Intronic
1172458365 20:35095323-35095345 AACTCCCTTATGGCTTACAGGGG - Intergenic
1175299297 20:57931644-57931666 AGCTCATTTGGTGCTTGCTGTGG - Intergenic
1176140234 20:63541757-63541779 GTCTCACTTGGGGCTTCCCGTGG - Intronic
1177879124 21:26670851-26670873 AACACAGTTGGGGCCAGCAGCGG + Intergenic
1180036136 21:45251229-45251251 AACCCACTTGAGGATGGCAGTGG + Intergenic
1181887799 22:26035437-26035459 AATGCAATTGGGGCTGGCAGTGG + Intergenic
1182474921 22:30571925-30571947 ACATCACATGGGGCTAGCAGAGG - Intronic
1183023291 22:35044358-35044380 AACTGCCTTGGGGTTTTCAGTGG - Intergenic
1184893840 22:47395673-47395695 AACTCACTTGGGGCCTGGGCAGG - Intergenic
950457592 3:13101922-13101944 AACTGACTCTGGCCTTGCAGGGG + Intergenic
954803148 3:53199031-53199053 GGCTCACTGTGGGCTTGCAGTGG - Intergenic
955426080 3:58791380-58791402 AACTTAATTGGGGCTTGGAGAGG + Intronic
955673879 3:61429804-61429826 AGCTCACTGGGGGCTCGCTGGGG + Intergenic
957764704 3:84607984-84608006 AAATCACTTGGCCCTTGAAGGGG - Intergenic
957948863 3:87098178-87098200 ACCTCACCTGGGAATTGCAGGGG - Intergenic
970808573 4:20064440-20064462 GGATCACTAGGGGCTTGCAGAGG + Intergenic
970940982 4:21632891-21632913 AACTCTTTTGGGGCATCCAGAGG - Intronic
975087485 4:70359946-70359968 AAATCACTTAGGCCTTGAAGTGG + Intergenic
975107223 4:70581148-70581170 CACTCACTGGGGCCTTTCAGAGG + Intergenic
975928711 4:79492005-79492027 GACTCTCCTTGGGCTTGCAGTGG + Intergenic
980304611 4:131042309-131042331 AACTTTCTTGGGGCCTGCAGTGG + Intergenic
980649086 4:135686859-135686881 CACACACTGGGGGCTTTCAGTGG + Intergenic
981261966 4:142731141-142731163 TACACACTTGGGCCTTTCAGGGG - Intronic
982049742 4:151489082-151489104 AACTCACGTAGAGTTTGCAGCGG - Intronic
982674156 4:158356698-158356720 AGCACACTTGGGGCTGGGAGTGG - Intronic
983451729 4:167920356-167920378 AAATCACTTGGAACCTGCAGGGG - Intergenic
983840740 4:172454820-172454842 AAGTCACTTGGAGCTAGCAATGG - Intronic
987971282 5:24947802-24947824 AACTCACTTGGGGCTGTCTGTGG + Intergenic
991624835 5:68589806-68589828 AACTCAATTGGGGCTGGGCGTGG - Intergenic
993453937 5:88105944-88105966 ACCTCACATGGGGCCTGCTGCGG - Intergenic
995585876 5:113647647-113647669 CACTCTCTTCTGGCTTGCAGGGG - Intergenic
999143822 5:149379734-149379756 AACTCACCTGAGGCCGGCAGAGG - Intronic
1001522344 5:172403507-172403529 CACCCACTTGTGGCTTGGAGAGG - Intronic
1002457665 5:179354841-179354863 AGCTCATCTAGGGCTTGCAGTGG + Intergenic
1002591834 5:180295836-180295858 AACTCCATTTGGGCCTGCAGTGG - Intergenic
1002843992 6:929841-929863 AACTCACTTGGGGCCTGGCGCGG + Intergenic
1005342602 6:24857379-24857401 TGCGCACTGGGGGCTTGCAGGGG + Intronic
1006500580 6:34456459-34456481 AACTCACTTTGGGCTGGATGTGG - Intergenic
1006502393 6:34466853-34466875 AAGTGGCCTGGGGCTTGCAGGGG - Intronic
1006943666 6:37769801-37769823 TCCTCACTTGGGCCTTGCTGAGG - Intergenic
1011560436 6:88608520-88608542 AATTCAGTTGGGGCTTTAAGTGG - Intergenic
1019140406 6:169938890-169938912 TGCTCACATGGGGTTTGCAGTGG + Intergenic
1023173150 7:37409510-37409532 AACTCAACTGGGGCTTGCTGGGG + Intronic
1023174218 7:37420071-37420093 AAATCACTGGGGGCTTTCAGAGG + Intronic
1023863784 7:44229381-44229403 TACTTACATGGGGCTGGCAGGGG + Exonic
1026223094 7:68417425-68417447 AATACCCTTGGAGCTTGCAGAGG - Intergenic
1033332504 7:140428185-140428207 CACTCACCTGGGGCTTCCGGAGG + Intergenic
1035031951 7:155866497-155866519 ATTTCACTTGGGGCTGGCAGTGG - Intergenic
1036625119 8:10464257-10464279 AACTTACATGGGGCTTGGTGAGG - Intergenic
1038533801 8:28339476-28339498 AACTCACTCATGGGTTGCAGTGG - Exonic
1043097523 8:75994470-75994492 AACACAGTTGGGGCTGGCAGTGG + Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1050239367 9:3618492-3618514 CACTCACTGGGGCCTTTCAGGGG - Intergenic
1051010441 9:12406531-12406553 AACTAACAAGGGGCTTGCAAAGG - Intergenic
1051029807 9:12659374-12659396 GAGTCACCTTGGGCTTGCAGTGG - Intergenic
1055930201 9:81552293-81552315 AACGCAATTGGGGATTGCGGGGG + Intergenic
1056208083 9:84339538-84339560 ATCTCACATGTGGCTGGCAGTGG - Intronic
1058151464 9:101468233-101468255 AATTCTCTTGGGGCTTGGATAGG - Intergenic
1058764206 9:108165498-108165520 AACTCACTGGGGGCTTGATGTGG + Intergenic
1060664675 9:125425644-125425666 AAGGGACTGGGGGCTTGCAGAGG + Intergenic
1062008767 9:134256076-134256098 CACACACTGGGGGCTGGCAGGGG - Intergenic
1203374285 Un_KI270442v1:350277-350299 AACTGCCTTGGGGCCTACAGTGG + Intergenic
1185749344 X:2598245-2598267 AACTCTCTTGGGGTTTGAATTGG - Intergenic
1187355267 X:18563983-18564005 ATCTCACTTTGGATTTGCAGTGG + Intronic
1190516759 X:51231778-51231800 GAGACACTTGGGGCTTACAGTGG - Intergenic
1190803188 X:53812009-53812031 AACACACTGGGGGCTGTCAGAGG - Intergenic
1191131524 X:57017660-57017682 CACTCACTGGGGCCTTTCAGAGG - Intergenic
1191989945 X:67024327-67024349 CACTCACTGGGGACTTTCAGAGG - Intergenic
1192125865 X:68499987-68500009 TCCACACTTTGGGCTTGCAGTGG - Intronic
1195411913 X:104576900-104576922 ACCTCATTTGGGCCCTGCAGAGG + Intronic
1198027298 X:132719679-132719701 AACTCACTTGTAACTTGAAGGGG - Intronic
1202251365 Y:22877034-22877056 AAATCACTTGGATGTTGCAGAGG - Intergenic
1202404353 Y:24510783-24510805 AAATCACTTGGATGTTGCAGAGG - Intergenic
1202466426 Y:25159299-25159321 AAATCACTTGGATGTTGCAGAGG + Intergenic