ID: 903171492

View in Genome Browser
Species Human (GRCh38)
Location 1:21557244-21557266
Sequence CTCCCGCTTAGGGTCATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903171479_903171492 20 Left 903171479 1:21557201-21557223 CCCCACACTCCAGTGTCTCCATC 0: 1
1: 0
2: 1
3: 34
4: 326
Right 903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG 0: 1
1: 0
2: 0
3: 1
4: 43
903171487_903171492 -6 Left 903171487 1:21557227-21557249 CCAGTGGGGATGAGTTCCTCCCG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG 0: 1
1: 0
2: 0
3: 1
4: 43
903171478_903171492 24 Left 903171478 1:21557197-21557219 CCTTCCCCACACTCCAGTGTCTC 0: 1
1: 0
2: 4
3: 55
4: 581
Right 903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG 0: 1
1: 0
2: 0
3: 1
4: 43
903171480_903171492 19 Left 903171480 1:21557202-21557224 CCCACACTCCAGTGTCTCCATCT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG 0: 1
1: 0
2: 0
3: 1
4: 43
903171482_903171492 11 Left 903171482 1:21557210-21557232 CCAGTGTCTCCATCTGTCCAGTG 0: 1
1: 0
2: 1
3: 31
4: 323
Right 903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG 0: 1
1: 0
2: 0
3: 1
4: 43
903171486_903171492 2 Left 903171486 1:21557219-21557241 CCATCTGTCCAGTGGGGATGAGT 0: 1
1: 0
2: 4
3: 19
4: 211
Right 903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG 0: 1
1: 0
2: 0
3: 1
4: 43
903171481_903171492 18 Left 903171481 1:21557203-21557225 CCACACTCCAGTGTCTCCATCTG 0: 1
1: 0
2: 4
3: 46
4: 456
Right 903171492 1:21557244-21557266 CTCCCGCTTAGGGTCATCATGGG 0: 1
1: 0
2: 0
3: 1
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903171492 Original CRISPR CTCCCGCTTAGGGTCATCAT GGG Intronic