ID: 903172559

View in Genome Browser
Species Human (GRCh38)
Location 1:21563133-21563155
Sequence TGGCGGTGCCGGCACTGTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903172559_903172573 19 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172573 1:21563175-21563197 GAAGGCCAATGAGGGCACCGTGG 0: 1
1: 0
2: 1
3: 12
4: 137
903172559_903172576 22 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172576 1:21563178-21563200 GGCCAATGAGGGCACCGTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 160
903172559_903172568 1 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172568 1:21563157-21563179 CGCCTACCTGTGTGGGGTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 107
903172559_903172575 21 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172575 1:21563177-21563199 AGGCCAATGAGGGCACCGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 174
903172559_903172572 11 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172572 1:21563167-21563189 TGTGGGGTGAAGGCCAATGAGGG 0: 1
1: 0
2: 1
3: 20
4: 217
903172559_903172562 -7 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172562 1:21563149-21563171 ACCGCCACCGCCTACCTGTGTGG 0: 1
1: 1
2: 3
3: 8
4: 75
903172559_903172574 20 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172574 1:21563176-21563198 AAGGCCAATGAGGGCACCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 114
903172559_903172565 -5 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172565 1:21563151-21563173 CGCCACCGCCTACCTGTGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 70
903172559_903172571 10 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172571 1:21563166-21563188 GTGTGGGGTGAAGGCCAATGAGG 0: 1
1: 0
2: 0
3: 21
4: 236
903172559_903172564 -6 Left 903172559 1:21563133-21563155 CCCTGACAGTGCCGGCACCGCCA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 903172564 1:21563150-21563172 CCGCCACCGCCTACCTGTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903172559 Original CRISPR TGGCGGTGCCGGCACTGTCA GGG (reversed) Exonic
903172559 1:21563133-21563155 TGGCGGTGCCGGCACTGTCAGGG - Exonic
905357443 1:37394713-37394735 TGGTGGTGCTGGCGCTGTCTGGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906148812 1:43575963-43575985 TGGAGGTGACGGCAGTGGCAAGG - Intronic
907430100 1:54406522-54406544 TGCCGCGGCCGGCGCTGTCAGGG - Intronic
912376185 1:109211855-109211877 TGGCGGTGCCTTCAATGACATGG + Intergenic
915313201 1:155014855-155014877 GGGCGGTGGCGGAGCTGTCATGG + Exonic
918047525 1:180950542-180950564 TGCCGCTGCCCTCACTGTCACGG + Exonic
923208286 1:231779190-231779212 TGGCGGTGCAAGGACTGCCATGG - Intronic
1064227561 10:13500820-13500842 TGGCGGTACCAGCACTGGAAGGG + Intronic
1076108925 10:127846297-127846319 TGGCGGTGTGGCCACTGTCCTGG - Intergenic
1077410909 11:2403469-2403491 AGGAGGTGGAGGCACTGTCAGGG + Exonic
1081814984 11:45934036-45934058 TGGAGGTGGCGGCATTGGCAGGG + Exonic
1089639685 11:119839469-119839491 TGGCGGTGCACGCACCATCAGGG + Intergenic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1096461071 12:51821673-51821695 GGGCGGTGCCGGCGCGGGCAGGG + Intergenic
1112590267 13:100757059-100757081 TGGCGGTAGTGGCACTGGCATGG + Intergenic
1118206305 14:63727302-63727324 TGGCGGTGCCGGACATGGCATGG + Exonic
1119688500 14:76652431-76652453 TGGCAGTGCCTGCATTGTCTGGG - Intergenic
1122878252 14:104678632-104678654 TGGGGGTGCCGGGACTCTCCTGG - Intergenic
1124710892 15:32009549-32009571 TGGCTGTGCCTGCACTGCCCAGG + Intergenic
1124811008 15:32938155-32938177 TGGCTCTGCCTGCACTGACAAGG - Intronic
1129658911 15:77542315-77542337 TGATGGTGCTGGCACTGGCATGG + Intergenic
1130298842 15:82665331-82665353 GGGCTGGGCCGGCACTGCCAGGG + Intronic
1132331612 15:101015880-101015902 GGAGGGTGCCAGCACTGTCAGGG + Intronic
1132516810 16:369868-369890 TGGCTGTGCCGGCTCTGTGCCGG - Intronic
1139954114 16:70685307-70685329 TGGCGGTGACAGCATTGTCTGGG + Intronic
1140769305 16:78189007-78189029 TGGAGGTGCAGGCAGAGTCAAGG + Intronic
1146645270 17:34573002-34573024 TGGGGGTGTGGGCAGTGTCAGGG + Intergenic
1146806988 17:35872498-35872520 TGGCTGTCCCGGTACTGACAAGG - Intronic
1149605978 17:57925630-57925652 TGGGGGTGGCGGCACTGGCAGGG - Intronic
1151577502 17:74960076-74960098 TGGCACTGCTGGCACTGTCGTGG + Exonic
1154004700 18:10517045-10517067 CGGCAGTGCAGGCACTGGCAGGG + Intergenic
1168339699 19:55615894-55615916 CGGCCGTGGCGGCACTGGCAGGG + Exonic
929818525 2:45255673-45255695 TGGCACTGCAGGCACTGTAAGGG - Intergenic
937122917 2:119453082-119453104 TGGCCATGCCTGCACTGTCCTGG - Intronic
944292963 2:198028846-198028868 TGGGGGTGGTGGCACTGGCAGGG - Intronic
946322087 2:218960153-218960175 TGGCGGTGCCGCCGCCGTCGGGG - Exonic
948421372 2:237862686-237862708 TGGGGGTGGGGGCACTGGCAGGG - Intronic
948805416 2:240451826-240451848 GGGCGGTGCCGGCCCTGGCATGG - Intronic
1175845233 20:62054732-62054754 TGGAGGTGCCGGCACCTGCAGGG + Intronic
1176151360 20:63592766-63592788 AGGCGCTGCCGGCTCTGGCATGG - Intronic
1184876465 22:47279039-47279061 AGGGGGTGCCGGCAATGACAAGG + Intergenic
953660271 3:44886919-44886941 TGTCGGTGCTGACTCTGTCAGGG + Intronic
966883233 3:184361507-184361529 CGGCGGTTCCGGCTCTGTCCTGG + Exonic
984377734 4:178953887-178953909 TGGCGGTGGCGGCACGGTGAAGG - Intergenic
989161235 5:38393727-38393749 TGGCGGAGCAGGCTCTGTGAGGG + Intronic
989652730 5:43711369-43711391 AGGCGGAGCCGGTACTGTCCTGG - Intergenic
990405948 5:55491001-55491023 TGGATGTGACGGTACTGTCATGG + Exonic
992589754 5:78282137-78282159 TGGTGGTGACAGCAGTGTCAAGG - Intronic
1000554530 5:162709001-162709023 TGGCGGGGAAGGCACTGTGAAGG - Intergenic
1004044411 6:12011671-12011693 TGGCGGGGCCGGCGCGGTCTGGG + Intronic
1007181853 6:39934394-39934416 TGGCGGCGCGGCCACTGTCCCGG - Intronic
1007928232 6:45667505-45667527 TGGCAGTGGCTGCAGTGTCAGGG - Intergenic
1009673698 6:66788765-66788787 TGGCAGGGCCGGCAGTGACAGGG - Intergenic
1013329045 6:109080231-109080253 TTGCACTGCCAGCACTGTCATGG + Intronic
1016841880 6:148533369-148533391 TGGCAATCCCGGCCCTGTCATGG - Intronic
1019274909 7:171165-171187 TGGGGCTGCCGGCACTGCCTGGG - Intergenic
1019444822 7:1065949-1065971 TCGGGGTGCCGTCACTTTCAGGG + Intronic
1019577479 7:1744479-1744501 GGGAGGTGCCTGCACTCTCAGGG - Exonic
1019906969 7:4072231-4072253 TGGAGGTGCCTGTGCTGTCAGGG + Intronic
1024287810 7:47774410-47774432 TGGAGGTGCCTCCAGTGTCATGG - Intronic
1026978592 7:74513684-74513706 TGAGGGGGCAGGCACTGTCATGG + Intronic
1029707413 7:102283107-102283129 AGGCGCAGCCGTCACTGTCACGG - Intronic
1035688070 8:1540069-1540091 TGCCTGTGGCGGCACTGCCAGGG - Intronic
1057257545 9:93562608-93562630 TGGCTGTTCCAGCTCTGTCAGGG - Intronic
1186877908 X:13835066-13835088 TGGGGGTGGTGCCACTGTCATGG + Intronic
1189361618 X:40357891-40357913 TGGTGGTGCTGGCAATGTTATGG + Intergenic
1190328670 X:49222532-49222554 TGGAGATGCAGGCACTGCCAAGG - Exonic