ID: 903172780

View in Genome Browser
Species Human (GRCh38)
Location 1:21564036-21564058
Sequence CAATGCCCACAGATTTCCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903172780 Original CRISPR CAATGCCCACAGATTTCCCT GGG (reversed) Exonic
902636229 1:17736639-17736661 CAATGGCCCCAGATTTGGCTGGG - Intergenic
903172780 1:21564036-21564058 CAATGCCCACAGATTTCCCTGGG - Exonic
904961224 1:34334622-34334644 CATTTGCCACAGATTTCCATGGG + Intergenic
905400317 1:37697443-37697465 CAATGCCCAGAGTTTTAACTGGG + Intronic
907385584 1:54123273-54123295 CAAGGCCCACAAATGTCGCTGGG - Intergenic
910154973 1:84206625-84206647 CAATGCCCAAAGTTTTCATTGGG + Intronic
911416574 1:97582272-97582294 CACTGCCCACAGATTTCCTCAGG - Intronic
912698486 1:111858794-111858816 CAATGCCTACTCTTTTCCCTTGG + Intronic
915931877 1:160065766-160065788 CAATGCCAACAGATGTGTCTGGG + Intronic
916937952 1:169649664-169649686 CAATGGCCCCACATTACCCTGGG - Intergenic
918181052 1:182086322-182086344 CACTGCCCACAGATGGCCCTGGG + Intergenic
1066209651 10:33224263-33224285 CAGTGCCCCCAGCTTGCCCTGGG - Intronic
1067472711 10:46548205-46548227 CATTGCCCAAAGATTTCTCGAGG - Intergenic
1068737148 10:60426850-60426872 CAATGCCTACAGTTTTTCATAGG - Intronic
1069270533 10:66521488-66521510 GAATGCCCAGTGATTTCCCATGG + Intronic
1070354516 10:75626689-75626711 CACTGTCCACAGCTTTCCCTGGG + Intronic
1075499472 10:122959562-122959584 CAGTTCCCACAGATTTCCACTGG - Intronic
1078056443 11:8012869-8012891 GGATGCCCACTGACTTCCCTCGG + Intergenic
1078098212 11:8313355-8313377 CAAGGCCCACAGGTGTCCCCAGG + Intergenic
1078114157 11:8428214-8428236 TAATTCCCACACATTTTCCTTGG + Intronic
1079127307 11:17726984-17727006 CAATGGCTACATAATTCCCTGGG + Intergenic
1079459477 11:20667855-20667877 CAAGGCAGACAGATTTCCTTTGG + Intergenic
1079834553 11:25316810-25316832 CAATGCCCATAGTTTGCACTAGG - Intergenic
1081333672 11:41836476-41836498 CAATGCAAACAGATTTGCTTTGG + Intergenic
1083410624 11:62489965-62489987 AAGTGCCCAGAGATTTCCCTGGG + Intronic
1083869803 11:65479767-65479789 AAATGCCCACATCTTTCCCAGGG - Intergenic
1084315388 11:68342687-68342709 CTGTGCCCACAGATGTCCCTGGG + Intronic
1085954752 11:81378260-81378282 CCAAGCCTACAGATTTCCATGGG + Intergenic
1086052833 11:82614212-82614234 GAGTGACCACAGATTTCCCCAGG + Intergenic
1086544994 11:87957448-87957470 AAAAGCACACAGTTTTCCCTGGG - Intergenic
1086607142 11:88709437-88709459 CAATATCCATAGATTTCACTGGG + Intronic
1086755593 11:90558101-90558123 AAATGCCCGGAGATTTGCCTGGG - Intergenic
1091159292 11:133405205-133405227 CAACGCCCACAGGTCTCCCTAGG - Intronic
1091301551 11:134510996-134511018 CAATGCCCTCAGCTTTACCAAGG - Intergenic
1091562899 12:1628499-1628521 CAATAACTACAGATTTCCCCAGG - Intronic
1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG + Intergenic
1095950325 12:47778243-47778265 CACTGCCCCCAGCTTTTCCTGGG - Intronic
1101427459 12:104599704-104599726 ACATGCCCACAGTCTTCCCTGGG - Intronic
1103704352 12:122863243-122863265 CAATGCCCACAGCTTCCCTGGGG + Intergenic
1104495876 12:129238113-129238135 CAAAACCCACAGATTTCACAGGG - Intronic
1104657674 12:130585720-130585742 CAGTGCCCACTGAATTTCCTGGG - Intronic
1105581399 13:21699969-21699991 CAATGCACACATTTTTGCCTGGG + Intronic
1109095420 13:58107845-58107867 GAATGCCCAGAGATCTGCCTGGG + Intergenic
1111639675 13:90951734-90951756 CAATGCTCCCAGTTTTCTCTGGG - Intergenic
1115779789 14:36756577-36756599 CACTGCCTACCCATTTCCCTTGG + Intronic
1115795207 14:36927550-36927572 CTATGGCCACAGATTCCCATGGG - Intronic
1116432534 14:44863544-44863566 CCATGGCCAGAGATTTCCCAAGG - Intergenic
1117549519 14:56819770-56819792 CAACTCCTACAGTTTTCCCTAGG - Intergenic
1118033523 14:61841101-61841123 AAATCCCCTAAGATTTCCCTGGG + Intergenic
1119855399 14:77896622-77896644 CAGTGCCCTCAGATGGCCCTTGG - Intronic
1120753384 14:88218875-88218897 AACTGCCCAGATATTTCCCTGGG + Intronic
1124162416 15:27284608-27284630 AAGTGCCCACAGCTTTCTCTTGG - Intronic
1124174303 15:27407839-27407861 CAATGCCCAAAAAATTCTCTGGG - Intronic
1125790590 15:42362561-42362583 AAATGCCCACATGTTCCCCTGGG + Intronic
1128769577 15:70271825-70271847 CAATGACTACAGAGTTTCCTTGG - Intergenic
1129824360 15:78625026-78625048 CAATGCTCACATATTTACTTAGG + Exonic
1129897508 15:79119353-79119375 CAATGACGACAGCTTTCCCTTGG + Intergenic
1131243616 15:90770475-90770497 CAATCCCCACATATTTATCTAGG + Intronic
1134572896 16:15306833-15306855 CAATGGCCACCCATGTCCCTTGG + Intergenic
1134729488 16:16449149-16449171 CAATGGCCACCCATGTCCCTTGG - Intergenic
1134937947 16:18262701-18262723 CAATGGCCACCCATGTCCCTTGG + Intergenic
1135963855 16:27019918-27019940 CAATACATAAAGATTTCCCTCGG - Intergenic
1136745481 16:32586013-32586035 CAATGCCCCCCAATATCCCTTGG - Intergenic
1137887825 16:52125897-52125919 CAATAGTCAAAGATTTCCCTGGG + Intergenic
1138108390 16:54304165-54304187 CCATGCCCGCAGGCTTCCCTCGG - Intergenic
1138893863 16:61179181-61179203 CAATTACCACAGATTTCATTTGG - Intergenic
1141457525 16:84153789-84153811 CAAGGCCCACAGTTTGCACTAGG + Intronic
1203047607 16_KI270728v1_random:845218-845240 CAATGCCCCCCAATATCCCTTGG - Intergenic
1146243423 17:31253209-31253231 AAATGCCCACAAATTGCCTTTGG - Intronic
1149577145 17:57722303-57722325 CTTTGCCCCCAGCTTTCCCTGGG + Intergenic
1151813476 17:76459032-76459054 CAAGTCCCACAGTTTTCCCAGGG - Intronic
1152637725 17:81436989-81437011 CAAGCTCCACAGATTTCCCTGGG + Intronic
1155235128 18:23811201-23811223 AGATGTCCACAAATTTCCCTGGG + Intronic
1159224779 18:65519548-65519570 AAATGATCACAGATTTCTCTAGG + Intergenic
1161332752 19:3696174-3696196 CAATGCCCACAGGTCTCCCTCGG + Intronic
925421357 2:3715333-3715355 CAATGGGCACAGATTTAACTTGG - Intronic
925540423 2:4960764-4960786 CATTGCCCAAAGAGTACCCTGGG + Intergenic
925783336 2:7404173-7404195 GCATGCTCACAGGTTTCCCTTGG - Intergenic
926213897 2:10891675-10891697 CCTTGCTCCCAGATTTCCCTTGG + Intergenic
927642767 2:24855836-24855858 CCATGCCGACAGATTGCCCTGGG - Intronic
931957951 2:67449746-67449768 GACTGTCCACAGTTTTCCCTGGG + Intergenic
932404194 2:71503001-71503023 CCATGCCCAAGTATTTCCCTAGG + Intronic
932410806 2:71546475-71546497 CTCTGCCCACAAATTTGCCTGGG + Intronic
934613636 2:95758179-95758201 CAACACCCACAGGATTCCCTGGG + Intergenic
934647264 2:96066236-96066258 CAACACCCACAGGATTCCCTGGG - Intergenic
935607107 2:104982285-104982307 CCACGCCCGCAGATTTCCCATGG - Intergenic
938241844 2:129748231-129748253 CAGTGCCCAGAGATGTTCCTAGG - Intergenic
938310644 2:130286347-130286369 CAATGTCCCCAGATTTCCTCAGG + Intergenic
940972640 2:159910146-159910168 CGATGCCCACAGATTGTCCCAGG + Intergenic
941673032 2:168315554-168315576 CAATACCCAGAGATTTATCTTGG + Intergenic
942410732 2:175706918-175706940 CAATGCCCAAGGATTTGACTGGG - Intergenic
943294114 2:186115294-186115316 CCATACCCACAGAATTCCCCTGG - Intergenic
946420722 2:219563091-219563113 CTGTCCCCAGAGATTTCCCTTGG + Intronic
946623558 2:221586149-221586171 CAATTTCCACATATTTTCCTTGG + Intergenic
948183940 2:236004231-236004253 CAGTGACCACAGATGTGCCTCGG + Intronic
1172359325 20:34301351-34301373 CCAGCCCCACAGTTTTCCCTGGG + Intronic
1173889591 20:46495938-46495960 AAATGACCACAGATACCCCTGGG + Intergenic
1174934357 20:54851635-54851657 CATAGCTCACTGATTTCCCTGGG + Intergenic
1177811719 21:25931654-25931676 AAATGCCCACTGTTTTTCCTTGG - Intronic
1179631687 21:42682729-42682751 CCATGCCCACAAAGTCCCCTGGG - Intronic
1180625417 22:17190706-17190728 CAGTGCCCCCAGGTTTGCCTAGG - Intronic
1184281576 22:43440502-43440524 CACTGCCCACATCTTTCCCAAGG + Intronic
1184813687 22:46854466-46854488 CAATGACCAAACATTACCCTGGG - Intronic
1185078350 22:48695362-48695384 AAATGCCCAAAGATTTCTCCTGG + Intronic
1185117852 22:48948248-48948270 CAATGCCCATGGATGTCCCCTGG + Intergenic
951542112 3:23791518-23791540 TAATGCCCACAGACTACCCAGGG + Intergenic
952596415 3:35024005-35024027 CAATGGCCACTGATTGCTCTGGG - Intergenic
953023874 3:39133809-39133831 CACTGCCCACAGATTACCCTTGG + Intronic
953710783 3:45268598-45268620 CAATGCACACAGTTGTTCCTTGG + Intergenic
956110851 3:65868618-65868640 TAATGCCGACAGATTTCCATTGG - Intronic
956531892 3:70229753-70229775 CAATGCAGATAGATATCCCTAGG - Intergenic
957995431 3:87683142-87683164 CGGTGCCCACAATTTTCCCTAGG + Intergenic
959371973 3:105538178-105538200 CAATGCCATCAAATTTCACTTGG - Intronic
960390540 3:117072576-117072598 CAAAGCCCAGAGGTTTACCTTGG + Intronic
961349633 3:126291668-126291690 CCAGGCTCACAGATGTCCCTGGG + Intergenic
961580000 3:127873196-127873218 CAATGCACACAGAGTCTCCTGGG - Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
961965775 3:130901261-130901283 CAATGACCACATCTTTCTCTGGG - Intronic
963610276 3:147458256-147458278 CAATTCCCTCTGATTTCCCAGGG + Intronic
964428818 3:156582200-156582222 CAATACACACACATTTCCTTTGG - Intergenic
965240202 3:166187375-166187397 CAAAGGGCACAGATTTCCCATGG + Intergenic
966509167 3:180742588-180742610 TAATGCTCACAGTTTTTCCTTGG + Intronic
970311568 4:14787721-14787743 CAATGCCTAGAGATCTGCCTGGG - Intergenic
970419987 4:15897033-15897055 CACTGCTCAGAGATTTCCCCTGG - Intergenic
970546919 4:17139205-17139227 CACTTCCCAGAGTTTTCCCTGGG - Intergenic
971763045 4:30793781-30793803 CAATGCCCAAAGGATTCACTTGG + Intronic
972138898 4:35930712-35930734 CATTGTCCAAAGACTTCCCTAGG + Intergenic
973866381 4:55118348-55118370 CAGTGAACACAGATTTACCTTGG + Intronic
975940830 4:79643666-79643688 TAATGCCCTCAGTTTTTCCTAGG - Intergenic
976486207 4:85607915-85607937 CAAGGCCCAGAGATTTTCGTTGG - Intronic
977529362 4:98182055-98182077 CAATGCCCACGGTTTTTACTGGG + Intergenic
983139818 4:164136370-164136392 AAGTGCCAACAGATATCCCTTGG + Intronic
983313580 4:166097558-166097580 CAATGCCCATAGATTTGCTTGGG + Intronic
983491546 4:168396193-168396215 AAGGCCCCACAGATTTCCCTTGG + Intronic
985920644 5:2969832-2969854 CAATGCCCATAGTTTCCCTTAGG - Intergenic
986927190 5:12769606-12769628 CATTGCCTACAGAGTCCCCTAGG + Intergenic
987151042 5:15040295-15040317 CAAAGCCCATAGTTTTCCCAAGG - Intergenic
988103147 5:26708238-26708260 CAATGGCCCGAGATTTACCTTGG - Intergenic
988931084 5:36036069-36036091 CAAAGCCAACAGAATTTCCTTGG - Intronic
989246722 5:39263618-39263640 CCATACTCTCAGATTTCCCTGGG + Intronic
992130700 5:73689646-73689668 CAATGCTCATATATATCCCTAGG - Intronic
992189066 5:74272850-74272872 GAACGCCCACAGATTTCTCTGGG - Intergenic
992456727 5:76923175-76923197 CAAGGCCCACAGATTACATTTGG + Intergenic
994147655 5:96412797-96412819 CAATGCCCAGAGCTTTTGCTGGG - Intronic
994211525 5:97092166-97092188 CAAAGTCCAGAGATTGCCCTAGG - Exonic
997865244 5:137456262-137456284 CAGTGCTCACAGCTTTCCTTTGG + Intronic
1002951056 6:1811824-1811846 CAATGTCCACAGAATTCTCTTGG + Intronic
1003229256 6:4235660-4235682 CAATGCCAACAAGTTTCTCTGGG - Intergenic
1005039744 6:21589995-21590017 CAATGACATCAGATTTCCCAGGG + Intergenic
1005150528 6:22743752-22743774 AAGTGCCAACACATTTCCCTTGG - Intergenic
1006505921 6:34488532-34488554 CAGTGCCCAGAGTTGTCCCTGGG + Intronic
1008893623 6:56525758-56525780 CATTGCCCACAGTCTTCCCAGGG + Intronic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1011635448 6:89368321-89368343 TAAGGACCAGAGATTTCCCTGGG + Intronic
1015525035 6:134167950-134167972 AAAAGCTCACAGCTTTCCCTTGG + Intergenic
1017604125 6:156114967-156114989 CAATGCCCACAGGTTTTGATGGG - Intergenic
1017746793 6:157454270-157454292 CACTGCCTACATATTTTCCTTGG + Intronic
1019686376 7:2384307-2384329 CAAGGCCCCCAGTTTCCCCTTGG + Intergenic
1021589178 7:22242157-22242179 CCCTGCCCACAGTTTACCCTCGG - Intronic
1022036096 7:26536310-26536332 CAATGCACACAGACCTTCCTAGG - Exonic
1024220723 7:47284438-47284460 CAAGACCCACAGCTCTCCCTTGG - Intronic
1029156151 7:98519421-98519443 CTATGCCCACTGGTTTCCCCTGG - Intergenic
1030034787 7:105399782-105399804 TGATGCCCAAAGATTTACCTGGG + Intergenic
1030754171 7:113268495-113268517 GAATGCCCAGAGATATGCCTGGG - Intergenic
1031237722 7:119197638-119197660 AAATGCCGAGAGATTTTCCTGGG - Intergenic
1031295427 7:119996474-119996496 AAAAACGCACAGATTTCCCTGGG + Intergenic
1031403431 7:121353686-121353708 CAATGCCCAGAGATTTTATTAGG - Intronic
1036463851 8:8978196-8978218 CAATGTCCACAGTTTTTACTGGG - Intergenic
1037549205 8:19953655-19953677 CAATGCCTGCAGATTTCTCTGGG + Intronic
1039619735 8:38985553-38985575 CAGTGCCCTCTGATTTCACTAGG - Intronic
1041221447 8:55655684-55655706 CACTGCCCACAGAGTGCCATAGG + Intergenic
1045195105 8:99922791-99922813 CCATGCCCACAGATTTTTTTTGG + Intergenic
1046965721 8:120163420-120163442 CAATGTCCACACAGTTCCTTAGG + Intronic
1049305915 8:141903883-141903905 CACTCCCCACAGATGTGCCTGGG - Intergenic
1051367921 9:16334307-16334329 CAAAGGCCCCAAATTTCCCTAGG + Intergenic
1053015120 9:34657446-34657468 CCATGCCCACAGGATCCCCTAGG + Exonic
1053346580 9:37382828-37382850 AAAGGCCCCCAGATTTCCCAGGG + Intergenic
1057427824 9:94968055-94968077 CAAAGGCCACAGATTGCGCTTGG - Intronic
1057496447 9:95564943-95564965 CCATGCCCACAGAAATCCCTTGG - Intergenic
1186126327 X:6418397-6418419 CACTGCCCACAGTTTGCCCTGGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1188408500 X:29842075-29842097 CAGTGCCCAGAGATTTTACTGGG + Intronic
1188545888 X:31306489-31306511 AATTTCCCACAGATTTCCTTAGG + Intronic
1189660731 X:43295448-43295470 CAATGTCCACACATTGCCATGGG - Intergenic
1190030714 X:46970253-46970275 AAATGGCAACAAATTTCCCTGGG - Intronic
1191272667 X:58496796-58496818 AAGTGCCCACAAATATCCCTGGG - Intergenic
1193986286 X:88244455-88244477 AAATGCCCAGAATTTTCCCTGGG + Intergenic
1195880695 X:109589978-109590000 CAATGCCCACAAATGTCACCAGG + Intergenic
1195991939 X:110691498-110691520 GGATGCCAACAGGTTTCCCTGGG - Intronic
1200807585 Y:7448130-7448152 CAATCCCTACAGAATTCCTTGGG + Intergenic