ID: 903172996

View in Genome Browser
Species Human (GRCh38)
Location 1:21565149-21565171
Sequence GGCAGTGCATGGAGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 9, 3: 44, 4: 366}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903172996_903173009 4 Left 903172996 1:21565149-21565171 CCTTCAGCCCTCCATGCACTGCC 0: 1
1: 0
2: 9
3: 44
4: 366
Right 903173009 1:21565176-21565198 ACAAATTTCTGGGGGCTACTTGG 0: 1
1: 0
2: 0
3: 10
4: 122
903172996_903173003 -4 Left 903172996 1:21565149-21565171 CCTTCAGCCCTCCATGCACTGCC 0: 1
1: 0
2: 9
3: 44
4: 366
Right 903173003 1:21565168-21565190 TGCCCCCCACAAATTTCTGGGGG 0: 1
1: 0
2: 1
3: 10
4: 110
903172996_903173001 -6 Left 903172996 1:21565149-21565171 CCTTCAGCCCTCCATGCACTGCC 0: 1
1: 0
2: 9
3: 44
4: 366
Right 903173001 1:21565166-21565188 ACTGCCCCCCACAAATTTCTGGG 0: 1
1: 0
2: 0
3: 22
4: 129
903172996_903173002 -5 Left 903172996 1:21565149-21565171 CCTTCAGCCCTCCATGCACTGCC 0: 1
1: 0
2: 9
3: 44
4: 366
Right 903173002 1:21565167-21565189 CTGCCCCCCACAAATTTCTGGGG 0: 1
1: 0
2: 4
3: 10
4: 152
903172996_903173000 -7 Left 903172996 1:21565149-21565171 CCTTCAGCCCTCCATGCACTGCC 0: 1
1: 0
2: 9
3: 44
4: 366
Right 903173000 1:21565165-21565187 CACTGCCCCCCACAAATTTCTGG 0: 1
1: 0
2: 2
3: 16
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903172996 Original CRISPR GGCAGTGCATGGAGGGCTGA AGG (reversed) Intronic
900794893 1:4701932-4701954 GGCTGTGCATGGCGGGGTGTTGG - Intronic
900979674 1:6039260-6039282 GGCAGAGCATAGGGGCCTGAGGG + Intronic
901092599 1:6651973-6651995 GGCAGTGCATGCGGGGGTGGGGG - Intronic
901668394 1:10839355-10839377 GGCAGTGCAGAGAGGACTGGGGG + Intergenic
901757928 1:11452558-11452580 GCAAGTGCATCGTGGGCTGACGG + Intergenic
901819336 1:11816688-11816710 GGCAGGGCCTGGAGGGATGGTGG + Intronic
902292749 1:15446183-15446205 GGCAGTGAATGGATGGATGGAGG - Intronic
902573057 1:17359240-17359262 GGCAGTGAGTGGGGGACTGATGG - Intronic
902873317 1:19326886-19326908 GGCTGAGCTTGGAGGCCTGAGGG + Intronic
903172996 1:21565149-21565171 GGCAGTGCATGGAGGGCTGAAGG - Intronic
903218267 1:21854879-21854901 GGCAGTGCCTGCAGGGCTGGTGG + Exonic
903768018 1:25747189-25747211 GCCAGTGCAGGGCGGGCTCAAGG - Intronic
904004661 1:27357456-27357478 GGCGCTGCAAGGACGGCTGAGGG - Exonic
904375935 1:30082554-30082576 CTCAGTGCCTGGAGGGCTGATGG + Intergenic
904581089 1:31544801-31544823 TGCAGTGCAGGGAGGGCAGTGGG + Intergenic
905231262 1:36516143-36516165 GGCAGTGCCTGGAGGTCAGGGGG - Intergenic
906608583 1:47187395-47187417 GGCCCTGCATCCAGGGCTGAAGG + Exonic
907074593 1:51566749-51566771 TGCAGTGCAGGGAAGGATGAAGG - Intergenic
907310921 1:53538614-53538636 GGCAGGCCAGGGAGGGCTGGGGG + Intronic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
910439859 1:87240974-87240996 GCCAGTGGATGGAGCTCTGAGGG + Intergenic
910984711 1:92994258-92994280 AGCAGTGAATTGAGGGCTCAAGG - Intergenic
911514114 1:98846248-98846270 GGGAGTGCAAGGAGGGAGGAGGG - Intergenic
912703864 1:111897602-111897624 GGCAGGGCATGCAGGTCTGAGGG + Intronic
913491179 1:119381369-119381391 GGCAGGGGAGGGAGGGCTGATGG + Intronic
914872161 1:151484177-151484199 GGCAGTGCATGGAGTGCTAAGGG - Intergenic
914938872 1:152004397-152004419 GGCAGTGAAAGGAGGCCAGAAGG + Intergenic
914941036 1:152023289-152023311 GGCAGGGAACGGAGGGCAGATGG - Intergenic
915312089 1:155009954-155009976 CGGAGTTCAGGGAGGGCTGAAGG + Intronic
915731642 1:158058402-158058424 GGCAGGGCAGGGAGGGAGGAGGG - Intronic
915938293 1:160101616-160101638 GGTAGTACATGGAGGGCAGGTGG - Intergenic
919986574 1:202679868-202679890 GGCACAGCATTGAGGGCTGAAGG - Intronic
920068714 1:203287450-203287472 GGGAGTGGGTGGAGGCCTGAGGG + Intergenic
920378624 1:205522915-205522937 GGCAGTGGAGGCAGTGCTGAGGG + Intronic
921221500 1:212977106-212977128 GGCAGTGTTGAGAGGGCTGAGGG + Intronic
921436508 1:215129675-215129697 GGCAGTGCCTGGGGGACTGGAGG + Intronic
922767240 1:228162536-228162558 GGGAGTGCATAGTGGGGTGAGGG + Intergenic
922865946 1:228861666-228861688 GGCAGTGCCTGCAGGGATGATGG + Intergenic
923291103 1:232547100-232547122 GGAAGTGGATGGTGGGCAGAGGG + Intronic
1062830740 10:603936-603958 GGCAGTGGTTGGAGGGGTGCCGG - Intronic
1064197717 10:13259513-13259535 GGCAGTGGGGGGGGGGCTGAAGG - Intergenic
1064398736 10:15002864-15002886 GGCAGTTCAGTGAGTGCTGAGGG - Intergenic
1064574938 10:16735338-16735360 GCCAGTGAATGCAGGGTTGAGGG + Intronic
1065133010 10:22641738-22641760 GGCCGGGCATGGGGGGCTCATGG - Intronic
1065695312 10:28374312-28374334 GGCGGTGCAGGAAGGGCTGTGGG - Intergenic
1066421860 10:35271302-35271324 TGCAGTGGATGGATTGCTGAAGG + Intronic
1066431590 10:35357048-35357070 GGAAGAGCATGCAGGGCAGAAGG - Intronic
1066794460 10:39103860-39103882 GGGAGTGCATGGATGCCTAAAGG + Intergenic
1067142781 10:43670466-43670488 GGCAGTGCATGGGGGTCTGGTGG - Intergenic
1067424332 10:46193265-46193287 GGCAGTGGTTAGAGCGCTGAGGG - Intergenic
1067709870 10:48639496-48639518 GGCAGAGAATAGAGGGCTTACGG + Intronic
1068192316 10:53667698-53667720 GCCTGGGCATGGAGTGCTGAGGG - Intergenic
1068620453 10:59176444-59176466 GGCAGTGGCTGGAGGGCAGGTGG + Intergenic
1068945185 10:62722808-62722830 GCCTGTGCATGGGGAGCTGACGG - Intergenic
1069260468 10:66387941-66387963 GTCAGGGGATGGAGGGCTGGGGG + Intronic
1069832355 10:71289070-71289092 TGCAGGGCAGGGAGAGCTGAAGG + Intronic
1070387124 10:75935693-75935715 GGCAGGGCATGAAGGGCTGCAGG + Intronic
1070876515 10:79816901-79816923 GGCAGTGGTTAGAGCGCTGAGGG + Intergenic
1071507436 10:86241208-86241230 GCCAGGGCATGGTGGACTGAAGG - Intronic
1071643446 10:87339079-87339101 GGCAGTGGTTAGAGCGCTGAGGG + Intergenic
1073463812 10:103682115-103682137 AGCTGTGCAAGCAGGGCTGAGGG + Intronic
1074785213 10:116833262-116833284 GGCAGTTCCTGCAGGGATGACGG - Intergenic
1075397890 10:122141120-122141142 GCCAGGGCCTGGCGGGCTGATGG + Intronic
1075583923 10:123643660-123643682 GGCAGGGGCTGCAGGGCTGATGG - Intergenic
1075814802 10:125256693-125256715 GGGTGGGGATGGAGGGCTGATGG + Intergenic
1075968509 10:126633187-126633209 GGCAGTTGATGGAGGGAGGATGG - Intronic
1076591459 10:131586587-131586609 TGAAGTTCCTGGAGGGCTGAAGG - Intergenic
1076754968 10:132564672-132564694 GGCAGTGAGTGCAGGGCAGACGG + Intronic
1077015136 11:395988-396010 GGCAGAGGGTGGAGGGCGGAGGG - Intronic
1077227728 11:1445687-1445709 GGCAGTGCAGGCCGGGCTGGAGG - Intronic
1077383869 11:2259960-2259982 GAGAGGACATGGAGGGCTGAGGG + Intergenic
1077741347 11:4849013-4849035 GGCGGTGCAGGGCGGGCTGCAGG + Exonic
1078670134 11:13357253-13357275 TGGAGAGCATGGAGGGCAGAAGG - Intronic
1079184892 11:18227855-18227877 GGGAGTGCTGGGAGGGGTGACGG - Intronic
1080248124 11:30202573-30202595 GCCAATGGATGGAGGGCTGAGGG + Intergenic
1081891134 11:46543173-46543195 GGCGCTCCGTGGAGGGCTGAGGG + Intronic
1081915835 11:46729566-46729588 GTCTGTGCAGGGCGGGCTGAGGG + Intronic
1082009644 11:47441565-47441587 GGGAGTGCTGGGAGGGCTGGAGG + Intronic
1082580168 11:54856232-54856254 GGCAGTGCATGGAGGCCTAAGGG + Intergenic
1083064790 11:59913595-59913617 GGCAGTGCAGAGAGGGCTGGAGG + Intergenic
1083384387 11:62296785-62296807 GGCAGGGCAGGGAGGGCTTCTGG + Intronic
1083486858 11:62988523-62988545 GGGAGTGGGTGGAGTGCTGAGGG + Intergenic
1083741902 11:64715722-64715744 GGCAGTCCTTGGAGGGGTGTTGG - Intronic
1083799385 11:65037779-65037801 AGCAATACATGGAGGGCTGTAGG + Intronic
1083861648 11:65423216-65423238 GGCAGTGGGTGCAGGGCTGCAGG + Intergenic
1083911390 11:65712249-65712271 GGCAGTGGAGGGAGGGAAGATGG + Exonic
1084486441 11:69450936-69450958 GGCTGTGTTTGGAAGGCTGATGG - Intergenic
1084520493 11:69659751-69659773 GGCAGTGCATGGAATGCTGATGG - Intronic
1084557886 11:69885706-69885728 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084557904 11:69885748-69885770 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1085693693 11:78686268-78686290 GGAGGTCCATGGAGGGGTGAAGG + Intronic
1085793547 11:79516739-79516761 GGGGGTGCAGGGAGAGCTGATGG + Intergenic
1086443646 11:86852083-86852105 GGCAGTTCAGTGAGTGCTGAGGG - Intronic
1086889965 11:92246124-92246146 GGCAGTGGATGGAGTGAAGAGGG + Intergenic
1087015605 11:93551650-93551672 GTCAGTGCCTGGAGAGCGGATGG + Intergenic
1087401884 11:97677702-97677724 GGTAGTGGATGGTGGGTTGAGGG - Intergenic
1088547044 11:110969576-110969598 GTCAGTCCATGCAGGGGTGATGG - Intergenic
1089643988 11:119865884-119865906 GGGTGTGCAGGGAGGACTGAAGG - Intergenic
1090747665 11:129720307-129720329 GGCTGGGCCTGCAGGGCTGAGGG - Intergenic
1091603460 12:1931376-1931398 AGCACTGCATGGAGCACTGACGG + Intergenic
1092193222 12:6534718-6534740 GGCTGGGCATGGAGGCCTGGTGG + Intronic
1092625290 12:10320304-10320326 GGCAGTGGATGGAGGCCAAAAGG + Intergenic
1093491499 12:19710069-19710091 GGTAGTTCTTGGAGAGCTGAGGG + Intronic
1093550432 12:20403452-20403474 GGCACTAGATGGAGGCCTGAGGG + Intronic
1094526349 12:31233824-31233846 GGCAAGGCATGGAGGGGTGTGGG - Intergenic
1094540898 12:31362581-31362603 GGAAGTGCATGGGGGGCTCCCGG + Intergenic
1096233020 12:49907634-49907656 GGCAGTGCTGGGGTGGCTGAGGG + Intergenic
1096507543 12:52104519-52104541 GGCAGTTCAGTGAGTGCTGAGGG + Intergenic
1096578379 12:52569069-52569091 TGCAGAGCATGGAGGGTTGTGGG + Intronic
1098171521 12:67751803-67751825 CGCAGTGGCTGGAGGGCCGAAGG - Intergenic
1101966941 12:109288027-109288049 GGCACTGCATGGACTGCGGAGGG - Intronic
1102349719 12:112183619-112183641 GGCTCTGCAAGGAGGGTTGAAGG - Intronic
1102370744 12:112381317-112381339 GAGAGTGCATGGAGGGCCGCTGG + Intronic
1103854032 12:123952391-123952413 GGCAGAGCAAGGAGCCCTGAGGG + Intronic
1103972050 12:124678600-124678622 GGCCGTGCAGGGAGGCCTCAAGG - Intergenic
1104486826 12:129158602-129158624 GGCAGAGGATGGAGGCCTAAAGG + Intronic
1105918933 13:24942698-24942720 GGAGGTGCCTGGAGGTCTGAAGG + Intergenic
1107482943 13:40800201-40800223 GGAGGTGCCTGGAGGTCTGAAGG + Intronic
1109622208 13:64925399-64925421 TTCAGGCCATGGAGGGCTGAAGG - Intergenic
1109840004 13:67908184-67908206 GGCAGTGCAGTGAGTGCTGAGGG + Intergenic
1113579937 13:111421485-111421507 GTAAGTGCATGGAGGGGTCAGGG + Intergenic
1113590335 13:111494392-111494414 GGCAGGGCATGGAGGGATGGAGG + Intergenic
1114657159 14:24323073-24323095 AGCAGTGCATGGAGTACTGTGGG + Exonic
1117995574 14:61474552-61474574 GGCAGGGGATGGGGGGCTGGGGG + Intronic
1119375594 14:74189614-74189636 GGCAGAGCAAGGAGAGTTGATGG + Intronic
1120095715 14:80385529-80385551 GGCAGTGCCTGCACTGCTGATGG + Intronic
1121383996 14:93500361-93500383 GACAGTGCCTGGAGGGCAGCAGG - Intronic
1122115258 14:99524290-99524312 GGCAGGGCAGGGCCGGCTGAAGG - Intronic
1122440942 14:101731478-101731500 TGCTGTGCATGGAGGGGTGCTGG - Intronic
1122638322 14:103141141-103141163 GGGCATGCATGGGGGGCTGAGGG - Intergenic
1124033433 15:26031835-26031857 GGCAGGGCATGGAAGGGTGAGGG + Intergenic
1125518914 15:40337648-40337670 GGCACTGCTGGGAGGGCTGCAGG - Intronic
1126686478 15:51252691-51252713 TCCAGTGCATGGAGGGCACACGG + Intronic
1128054290 15:64688351-64688373 GGCATGGCCTGGAGGGCTGGTGG - Exonic
1128254212 15:66185220-66185242 GGCAGTGCAGGGTGGGAGGAGGG - Intronic
1130110403 15:80959290-80959312 CGCAGTGCCTGGAAGGATGAAGG + Intronic
1132253958 15:100357768-100357790 GTCAGTGGGTGGAGGGCTGGGGG + Intergenic
1132339934 15:101071886-101071908 GGCATTCCATGGAGCTCTGAGGG + Intronic
1132461335 16:56662-56684 GGCAGAGCATGGGGGACTAAGGG - Intronic
1132691808 16:1185028-1185050 GGCTGGGCAGCGAGGGCTGATGG - Intronic
1132886202 16:2183317-2183339 GGCAGTGCTTGGAGGCTTGGTGG + Intronic
1133234592 16:4382043-4382065 GGCAGTGGAGGGCGGGCTGGGGG - Exonic
1133530258 16:6648568-6648590 GGCAGTGGACTGAAGGCTGAAGG - Intronic
1133701186 16:8310636-8310658 GGGGGTGCATGAAGGGCAGAAGG + Intergenic
1133732700 16:8590216-8590238 GGCTGGGCGTGGAGGGCCGAGGG - Intergenic
1134833865 16:17345443-17345465 GGCAGTGCATGGAGGCACGGAGG + Intronic
1135389946 16:22083340-22083362 TCCAGTGCATACAGGGCTGATGG + Exonic
1136145661 16:28315004-28315026 GGGAGTGCAGGGAGGGTAGAGGG + Intronic
1136509133 16:30724994-30725016 AGCAGTGGAGGGAGGGCTGGGGG - Exonic
1136926031 16:34375214-34375236 GGCAGTGCAAGCACGGCTGCTGG - Intergenic
1136978543 16:35036592-35036614 GGCAGTGCAAGCACGGCTGCTGG + Intergenic
1137370070 16:47896979-47897001 TGCAGCCCATGGAGGGCTGGCGG + Intergenic
1137845944 16:51688192-51688214 GGGAAGGCATGGAAGGCTGAAGG + Intergenic
1138029274 16:53547010-53547032 ATCAGTGCATGGAGGGTGGAGGG + Intergenic
1138430080 16:56962976-56962998 GGCAGTGGATGAGGGGCTGCAGG - Intronic
1139464151 16:67145206-67145228 GGAAGAGGATGGAGGGGTGAAGG - Intronic
1140117701 16:72057133-72057155 AGCAGTACAGGGAGGGCTCAGGG - Intronic
1140117918 16:72058857-72058879 AGCAGTACAGGGAGGGCTCAGGG - Intronic
1140119935 16:72074886-72074908 GGCAGTACAGGGAGGGCTCAGGG - Intronic
1140891369 16:79288084-79288106 GGCATTGGAGGGAGGGCAGAGGG + Intergenic
1141788712 16:86218541-86218563 GGCAGAGGTTGGAGGGATGAAGG + Intergenic
1142601460 17:1054861-1054883 GGCGCTGCAGGGAGGGGTGAGGG + Intronic
1142805148 17:2367542-2367564 GGCAGATCAGGGAGGGCAGAAGG + Intronic
1143151471 17:4809626-4809648 AGCAGTGCAGGGTGGGCTGGGGG + Intronic
1143183738 17:4998715-4998737 GGCAGAGCATGGGAGGGTGAGGG - Intronic
1143777717 17:9210238-9210260 GGCAGGGCAGGAAGGTCTGAGGG - Intronic
1144586118 17:16488891-16488913 GGCAGTTCACGGTGGGCTGAAGG - Intronic
1144628197 17:16856270-16856292 GGGAGTGCACAGAGGGCTGGGGG + Intergenic
1145159789 17:20566837-20566859 GGGAGTGCACAGAGGGCTGGGGG + Intergenic
1146083368 17:29803804-29803826 GTCAGTGCAAGGAGGACTGAAGG + Intronic
1146143233 17:30388112-30388134 GGCAGAGGATGGAGAGATGATGG - Intronic
1146719376 17:35113073-35113095 GGCAGGGCATGGAGGGTAGGTGG - Intronic
1147197764 17:38779068-38779090 GGCAGTCCATGGGGGCCTGATGG + Intronic
1147387037 17:40088958-40088980 GGCAATGCAAGGAGGACAGAGGG - Intronic
1148557771 17:48588788-48588810 GGCAGTGGATAGAGAGCTCAGGG + Intronic
1148805375 17:50261201-50261223 GGAAGAGCATGGAGGGCAGAGGG + Intergenic
1149482897 17:57017968-57017990 GGCAGAGGATGGAGAGATGATGG - Intergenic
1149866600 17:60154580-60154602 GAAAGTGCATGCAGGGCAGAAGG - Intronic
1150283132 17:63940834-63940856 GGCAGTGTCTGAGGGGCTGATGG + Exonic
1151318518 17:73338519-73338541 GGCAGTGAGAGGAGGGGTGAAGG + Exonic
1151371635 17:73650281-73650303 GGCAGAGCATGGGGAGGTGAGGG + Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1152382514 17:79949400-79949422 AGCAGGGCCTGGAGGGGTGAAGG - Intronic
1152459411 17:80433372-80433394 GGCACAGCATGGCGGACTGACGG - Intronic
1152700946 17:81819546-81819568 GGCAGTGGCAGCAGGGCTGAAGG + Intergenic
1153911133 18:9707897-9707919 GGCAGCGCGTGGAGGTCTGCGGG - Intergenic
1153968116 18:10200460-10200482 GGCAGAGCACACAGGGCTGAGGG + Intergenic
1154191589 18:12234977-12234999 GGCCGTGCAAGGAGGAGTGATGG + Intergenic
1156464715 18:37341508-37341530 GGCAGTGAGTGGAGGGCATAAGG + Intronic
1156523742 18:37746643-37746665 GGCAGGGCAGGGAGGGTTGCTGG + Intergenic
1157611159 18:48956650-48956672 GACAGTACAAGGAAGGCTGATGG + Intergenic
1158633010 18:59132368-59132390 GGCAGAGAATGGAGAGATGATGG + Intergenic
1158799580 18:60890519-60890541 AGCAGGGCAGGGAGGGATGATGG - Intergenic
1159469954 18:68839632-68839654 GGCAATGCATGGAAGGCTGGGGG + Intronic
1160154365 18:76422294-76422316 CGCAGTGCAGGGAGTGCCGAGGG - Intronic
1160507946 18:79437678-79437700 GGCAGAGGGTGGAGGGCAGAGGG - Intronic
1160904362 19:1445512-1445534 GGCAGGGCATGGGGAGCTGCTGG - Intergenic
1160904983 19:1447744-1447766 GCCAGGGCCTGGAGGGCTGAGGG - Intronic
1160905761 19:1451070-1451092 GGCTGTGCATGGGGGACTGTGGG + Intronic
1160985641 19:1837354-1837376 GGCTGTGCATGGAGGGCCCCGGG - Intronic
1161269657 19:3382836-3382858 GCCAGTGCATGCAGGGCCCAGGG + Intronic
1161587862 19:5115191-5115213 GGCAGCTCCTGGAGGGCTGCAGG + Intronic
1161746484 19:6063392-6063414 TGCAGTGCATGGAGGGCCACCGG + Intronic
1161916092 19:7229283-7229305 GCAAGTGGATGGAGGGATGATGG + Intronic
1161984487 19:7646221-7646243 GGCAGGGCAGGGAGGGCAGCAGG - Intronic
1162137998 19:8567962-8567984 GGGAGAGCCAGGAGGGCTGATGG - Intronic
1162444313 19:10712894-10712916 GGCAGGGCATGGAGGGGACAGGG + Intronic
1163190482 19:15673415-15673437 GGCAGGGCAGGGAGGGCTCAGGG - Intronic
1163218500 19:15897711-15897733 GGTAGAGCAGGGAGGGCTCAGGG + Intronic
1163848466 19:19650478-19650500 GGCAGTGCCAGGAGGGCTGGCGG - Intronic
1163875349 19:19863177-19863199 GACTGTGCATGAAGGGCTGCAGG - Intergenic
1164401490 19:27905173-27905195 GGCAGTGCATGGAGGTGGGAAGG + Intergenic
1164869732 19:31632732-31632754 CACAGTGCATGGATGGCTGCAGG + Intergenic
1165982143 19:39734015-39734037 GGCAGTGCAAGGAGAGGTGATGG + Intronic
1166326518 19:42054218-42054240 GGAAGAGCAGGGAGGGCAGAGGG + Intronic
1166386080 19:42382092-42382114 CACAGTGCCTGGAGGGCTGTAGG - Intergenic
1166863950 19:45825141-45825163 GGCAGGGCCTGGTGGGCTCAGGG + Intronic
1167450545 19:49565831-49565853 GGACGTGCCTGGTGGGCTGATGG - Intronic
1168306821 19:55440476-55440498 GGCAGTGCAAGGCGGGCGTAGGG + Intronic
925059582 2:880671-880693 TGCAGTGCATGATGGGCTGTGGG - Intergenic
926251566 2:11157944-11157966 CGCAGTCCATGGAAGGCTGCAGG - Intronic
926679681 2:15654049-15654071 GGCAGTGCCGGGAGGTGTGAAGG - Intergenic
927050687 2:19325105-19325127 TGCAGTCCAGGGAGGGCTCAAGG + Intergenic
927100895 2:19787070-19787092 GGCAGTGCCTGGATGGTTAAGGG + Intergenic
928087546 2:28355391-28355413 GGTAGTGCAAGGAGAACTGATGG - Intergenic
928128684 2:28633502-28633524 CGGAGTGCTTGGAAGGCTGATGG - Intronic
928372740 2:30752817-30752839 GGCACAGCATGGAGGGCTAGGGG + Intronic
929452087 2:42044741-42044763 GCCAGCTCATGGAGGCCTGAAGG + Intergenic
929777260 2:44937215-44937237 GGCAGTGCAGGGAGGGGAGCGGG - Intergenic
932351362 2:71034903-71034925 GGCAGTTCAGTGAGTGCTGAGGG + Intergenic
932751784 2:74375885-74375907 GACATTGCATGGAGAGCTGCTGG - Intronic
932758273 2:74423546-74423568 TGCAGGGCATGGAGGGGTGCTGG + Intronic
933155506 2:78968885-78968907 TGCTGTGGATGGAGGGGTGAGGG - Intergenic
936451304 2:112635830-112635852 GGCAGGACATGGAGGCCTGGTGG + Intergenic
937511516 2:122600246-122600268 GGAAGAGCATGCTGGGCTGATGG - Intergenic
938163590 2:129007900-129007922 GCCAGGGCATTGAGGGCTGCAGG + Intergenic
938702092 2:133888552-133888574 TGAAGTGCATGGAGGGCAGAGGG + Intergenic
940870915 2:158859546-158859568 GGCAGTTCAGTGAGTGCTGAGGG + Intronic
941917622 2:170822771-170822793 GGCAGGCCATGGAGGGCTCCAGG - Intronic
942116589 2:172735246-172735268 GGCAGTGCGGGCAGGGCTGAGGG - Intergenic
942302942 2:174579845-174579867 TGGAGGGCTTGGAGGGCTGAGGG + Intronic
942440870 2:176035126-176035148 GGCAGTGGTTGGAGGTTTGAAGG - Intergenic
944661510 2:201925320-201925342 GACAGTGGATGGAGGCCTGTGGG + Intergenic
946182034 2:217954701-217954723 GGCAGGGCAGGAAGGGCTGCTGG - Intronic
947708243 2:232293576-232293598 GGGAGTGCATGGAGCTCTGCAGG + Intronic
948326924 2:237131876-237131898 GGCAGAGGAGGCAGGGCTGAGGG - Intergenic
948371775 2:237494208-237494230 GGCAGAGGGTGGAGGGCAGAGGG + Intronic
948489392 2:238302823-238302845 GGCAGTGTGTGGAGGGGTGGAGG + Intergenic
948790100 2:240372522-240372544 GGCAGGGCATGGAGGGGGCAGGG + Intergenic
948794911 2:240397548-240397570 GGCAGTGCAGGGGGTGCTGGAGG - Intergenic
948808350 2:240462615-240462637 GGCAGAGCATGGGGGTCTGGAGG - Intronic
1171376223 20:24695941-24695963 GGCTGAGCATGGAGGGCTGGTGG - Intergenic
1172636706 20:36414896-36414918 GGGAATGCAAGGAGGGATGAGGG + Intronic
1172838769 20:37889328-37889350 GGCACAGGATGGAGGACTGATGG + Intergenic
1173606313 20:44334391-44334413 GGCAGAGCAGTGAGGGGTGAGGG - Intergenic
1173873395 20:46355442-46355464 GGCAGAGCAAGCAGGGCTGTTGG - Intronic
1175633418 20:60560710-60560732 GGCAGGGCAGGGAGGGGTCAGGG + Intergenic
1175825065 20:61932215-61932237 GGGAGGACATGGGGGGCTGAGGG - Intronic
1175934615 20:62509234-62509256 GGTAGAGGATGGAGGGGTGAAGG - Intergenic
1175935029 20:62510368-62510390 GGCAGAGGATGGAGGGGTGGAGG - Intergenic
1175976732 20:62714247-62714269 CGCAGGGCATAGAGGGCTGTTGG + Intronic
1176388644 21:6152144-6152166 GGCACTGCTTGCAGGGCAGATGG - Intergenic
1176816854 21:13610774-13610796 GGCAGGACATGGGGGGATGATGG + Intronic
1177262559 21:18749841-18749863 GGGAGGCCAAGGAGGGCTGAGGG + Intergenic
1177397751 21:20559731-20559753 GGAAGGGCATTGAGGTCTGATGG - Intergenic
1178443569 21:32618307-32618329 GGCAGTTCAGTGAGTGCTGAGGG + Intergenic
1179266722 21:39810114-39810136 GACAGGGCATGGACGCCTGAGGG - Intergenic
1179730067 21:43362663-43362685 TGCAGTGCGTGGAGTGCAGAAGG - Intergenic
1179734828 21:43386104-43386126 GGCACTGCTTGCAGGGCAGATGG + Intergenic
1180708463 22:17823959-17823981 GGGAGAGCATTGGGGGCTGAAGG + Intronic
1181041728 22:20195505-20195527 GGAAGTGCAAGCAGGGCTCACGG - Intergenic
1181508369 22:23377037-23377059 GGTGGTGCCTGGTGGGCTGATGG - Intergenic
1182137399 22:27918981-27919003 GGCAATGCCTGGAGGGCCGAGGG + Intronic
1183249839 22:36722762-36722784 GACAGTGCAAGGAGGGATGGGGG - Intergenic
1183518738 22:38283842-38283864 GCCGGTGCAGGAAGGGCTGATGG - Intergenic
1184217276 22:43076093-43076115 GGCAGTGCCTGGAGGGATGTGGG - Intronic
1184479243 22:44737412-44737434 GGCCGAGCAAGGAAGGCTGATGG - Exonic
1185032885 22:48453972-48453994 GGCAGTGCAGGAATGGCTGTTGG - Intergenic
1185272885 22:49936764-49936786 GGGTGTGGATGGAGGGCTGTGGG - Intergenic
950147980 3:10665334-10665356 GACACTGAATGGAGGTCTGAAGG - Intronic
950212980 3:11137439-11137461 GGAAGAGAATGGAGGGGTGACGG + Intronic
951652042 3:24961629-24961651 GGCGGGGCATGGAGTTCTGACGG + Intergenic
952858873 3:37795661-37795683 GCCAGTGAAGGGATGGCTGATGG - Intronic
954448879 3:50561114-50561136 GGCAGGGCCTGGAGGGCTGCTGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959082152 3:101813341-101813363 GGCGGGGCAGGGAGGGCTGCGGG - Intronic
960298367 3:115971112-115971134 GGCAGCGCATATAGGGCTGGAGG + Intronic
960443842 3:117723062-117723084 AGCAGTTCATGGAGGGGAGAGGG - Intergenic
960495072 3:118363319-118363341 GGCAGTGCAGGGAAGGCTGATGG + Intergenic
961273619 3:125709329-125709351 GGCAGTTCAGTGAGTGCTGAGGG + Intergenic
962677820 3:137769406-137769428 AGAAGTGCATGAAAGGCTGACGG - Intergenic
963169509 3:142236686-142236708 GGGAGTTCAAGGAGGGCAGATGG - Intergenic
964556832 3:157949108-157949130 TGCAGAGCAGGGAGGGCTGCAGG - Intergenic
964927311 3:161975120-161975142 GGGAGGCCAAGGAGGGCTGAGGG - Intergenic
966932202 3:184683044-184683066 GTCAGAGCATTGAGGGGTGAAGG - Intronic
967221237 3:187249800-187249822 GGCTGTGCAGGAAGGGCTGTGGG - Intronic
967758145 3:193193528-193193550 GGCACTGCTTGGTAGGCTGAAGG - Intergenic
967979393 3:195056537-195056559 GGGAGTGAAAGGAGGGCTGCAGG + Intergenic
968452741 4:682905-682927 GGCAGTGCAGCGGGGGCTGAGGG - Intronic
968551529 4:1226055-1226077 GGTGGGGCATGGAGGGCGGAAGG - Intronic
968905153 4:3447471-3447493 GGCTGTGCAAGGGGGGCTGGAGG - Exonic
968940482 4:3634942-3634964 GGCAGGGCAGGGTGGCCTGAGGG - Intergenic
969248948 4:5954592-5954614 GGCAGCGCATGGAGAGGGGAGGG + Intronic
969586692 4:8097963-8097985 GGAGCTCCATGGAGGGCTGAGGG + Intronic
969605780 4:8201611-8201633 GGCTGGGCCTGCAGGGCTGAGGG + Intronic
973026773 4:45283479-45283501 AGCAGGGCATGGAGTGGTGACGG + Intergenic
973737704 4:53888798-53888820 GCCAGGGGATGGAGGGCAGAGGG + Intronic
974004724 4:56544679-56544701 GGCAGCGGCTGGAGGGCTGCGGG - Intronic
976385037 4:84447316-84447338 GGTAGTGCATTGCAGGCTGAGGG + Intergenic
976565473 4:86547233-86547255 CACAGTGCAGGGCGGGCTGAAGG - Intronic
976700819 4:87966804-87966826 GGCAGAGGATGGAGAGATGAAGG + Intergenic
977623212 4:99161438-99161460 ATCACTACATGGAGGGCTGAAGG - Intergenic
980538901 4:134166830-134166852 GTCAGTGAATGAAGGGCAGAGGG - Intergenic
980639910 4:135564376-135564398 GGCAGTGGAAGTAGGGCTGTGGG + Intergenic
984117402 4:175698877-175698899 GGCAGTGTATGTAGGGGTGAGGG - Intronic
984297049 4:177865721-177865743 GGCACTGCATGGAGGCCAGTTGG + Intronic
984919444 4:184750805-184750827 GGCACTGCAGGAAGGGCTTACGG - Intergenic
985699712 5:1363279-1363301 GGCCGTGCATGCAGGGAGGAGGG - Intergenic
986690010 5:10306519-10306541 GGAAGTGCATCCAGGGCTCAGGG + Intronic
990715536 5:58632493-58632515 GTCTGTTCACGGAGGGCTGAAGG + Intronic
991491580 5:67188864-67188886 GGCAGTGCCTGGAGGACTTTGGG - Intronic
991638752 5:68732876-68732898 GGGAGTGGACTGAGGGCTGATGG - Intergenic
994162388 5:96571235-96571257 GGCAGCGCAGGGAGGGCTAGAGG + Intronic
995565061 5:113425860-113425882 GGAAGTGGATGGAGGGAAGATGG + Intronic
997376902 5:133403810-133403832 GCCAGTTCATGGGGGGCTGGGGG + Intronic
997643982 5:135468216-135468238 GACAGGCCATGGTGGGCTGATGG + Intergenic
997972931 5:138419137-138419159 GTCAGGGCAAGGAGGCCTGATGG - Exonic
998136501 5:139676981-139677003 GACAGAGCACGGGGGGCTGAGGG - Intronic
1000753989 5:165133569-165133591 GCCAGTGCATGGAGGAGTGCAGG - Intergenic
1002333286 5:178460398-178460420 GGCAGTGCCAGGTGGGCTGCTGG + Intronic
1002535919 5:179875285-179875307 AGCTGTGCAGTGAGGGCTGAGGG + Intronic
1002991827 6:2245592-2245614 GGCCGTGCAGGGAGGGCCGGGGG + Exonic
1003026061 6:2556802-2556824 GGCAGTGCTTGTAGGGCGGGCGG - Intergenic
1003487974 6:6595879-6595901 AGCAGTGTGTGGAGGGCTGTGGG + Intronic
1004250033 6:14016149-14016171 AAGAGTGCATGGAGGGCTGCAGG + Intergenic
1005148628 6:22722040-22722062 GGCAGTCCCTGAAGGGCTGAAGG + Intergenic
1006188793 6:32195468-32195490 GGCATTTCTTGGAGGGCTGGGGG + Exonic
1007959693 6:45947471-45947493 GGCAGTGGATGGAGGGGTGAGGG - Intronic
1010799064 6:80152981-80153003 AGCAGTGCTTGGAGGGCTTTGGG + Intronic
1012624861 6:101393232-101393254 GCCAGGGCTTGGAGGGCTGCTGG - Intergenic
1012832287 6:104219309-104219331 GTCAGGGGGTGGAGGGCTGAGGG + Intergenic
1018632780 6:165835068-165835090 GGCAGTGCACAGAGGGCAGTTGG + Intronic
1018852469 6:167650953-167650975 CGGAGTGCAGGGAGGGCTGGGGG - Intergenic
1018869323 6:167769162-167769184 CGCAGGGCTGGGAGGGCTGACGG + Intergenic
1019327469 7:445513-445535 GGCAGGCCAGGGAGGGGTGAGGG - Intergenic
1020073679 7:5243610-5243632 GGCACCGCAGGCAGGGCTGAGGG + Intergenic
1022485974 7:30777900-30777922 GGCAGTTCAGGGTGGGATGATGG + Intronic
1023402870 7:39802983-39803005 GGAATTGAATGGAGAGCTGAGGG + Intergenic
1023837254 7:44075544-44075566 GGCAGTGCCTGCTGGGCTGTGGG + Intronic
1024534536 7:50419037-50419059 GGGAGTGAATGGGAGGCTGAGGG - Intergenic
1024992020 7:55242320-55242342 ACCATTGTATGGAGGGCTGATGG + Intronic
1025578273 7:62676083-62676105 GGCAGTGCATTGAGGCCTATGGG + Intergenic
1030514103 7:110519582-110519604 GGAAGCTGATGGAGGGCTGAGGG - Intergenic
1033658185 7:143387255-143387277 GGCAGTGAAGCCAGGGCTGAGGG + Intronic
1034274095 7:149816555-149816577 GGGAGGGCAGGGAGGGCTGTGGG - Intergenic
1036653120 8:10658512-10658534 GGCAGTGCAGGGAGCCCTGGTGG + Intronic
1036818906 8:11923556-11923578 GGCAGTTCAGTGAGTGCTGAGGG - Intergenic
1037753942 8:21699593-21699615 GGCAGTGCAGTGAGGGCTGCAGG - Intronic
1037764373 8:21763293-21763315 GGCAGCTCATGGATGGCTGGGGG + Intronic
1039920282 8:41888908-41888930 GGCAGAGGATGGAGAGCTTAGGG - Intronic
1040493126 8:47942902-47942924 GAGAGTGGGTGGAGGGCTGAGGG - Intronic
1048240188 8:132733544-132733566 GGCAGTGCAAGGAAGCCTGCAGG - Intronic
1048292601 8:133192034-133192056 GGCAGTGCAAGGAGGGCAGGAGG + Intronic
1048339798 8:133529726-133529748 GGCAGTGCATGAGGGGCTAGTGG - Intronic
1048798178 8:138170998-138171020 GGGAGCGCATGGAGTGCAGAGGG - Intronic
1049392727 8:142380443-142380465 TGAACTGCATGGAGGGCAGAGGG + Intronic
1049444409 8:142623455-142623477 GGGAGGGCATGGCAGGCTGAGGG + Intergenic
1049642624 8:143722328-143722350 GGCAAAGCAGGGAGGGCTAAGGG - Exonic
1050678797 9:8086181-8086203 GGCTCTGCATGATGGGCTGATGG + Intergenic
1050703176 9:8364654-8364676 GGCAGTGCCTGGAGCTGTGATGG - Intronic
1051689213 9:19691485-19691507 GGTAGTGCATGGATGACTGAGGG - Intronic
1052610900 9:30772791-30772813 GGCAGGGCAGAGAGGGCTGAAGG - Intergenic
1052844017 9:33318952-33318974 GGCATTGCTGGCAGGGCTGAGGG - Exonic
1055348293 9:75359338-75359360 AGAACAGCATGGAGGGCTGATGG + Intergenic
1056079198 9:83073115-83073137 GGAAGTGCATGGGGGACTTATGG - Intergenic
1056863965 9:90213191-90213213 GGCAGTTCAGTGAGTGCTGAGGG + Intergenic
1056915930 9:90746228-90746250 GGCAGTTCAGTGAGTGCTGAGGG - Intergenic
1057064177 9:92033462-92033484 TGCTGTGCATGGAGTCCTGAGGG + Intronic
1057572389 9:96214500-96214522 GGATGGGCATGGAGGGCTCAGGG + Intergenic
1057907402 9:98993435-98993457 GGCTGTGCCTCGAGGCCTGATGG + Intronic
1058736579 9:107899651-107899673 GGGAGTGCAGGGAGAGCTAATGG + Intergenic
1060105431 9:120870015-120870037 GGCAGGGCTGGGAGGGCTGAGGG + Intronic
1060506662 9:124202918-124202940 GGCAGTGCTGGAAGGGGTGAGGG + Intergenic
1060894653 9:127209827-127209849 GGCTGACCATGGAGGACTGAGGG + Intronic
1061300800 9:129703914-129703936 GGCAGTGCCTGCGAGGCTGACGG - Intronic
1061621061 9:131811704-131811726 GGCAGAGCACGGAGGGCTCCGGG - Intergenic
1061986698 9:134134434-134134456 TGCTTTGCCTGGAGGGCTGAAGG + Intergenic
1062031791 9:134365146-134365168 GGCTGTTGCTGGAGGGCTGATGG + Intronic
1062035221 9:134379894-134379916 GGCAGAGCCTGGAGGCCTGCTGG + Intronic
1062094797 9:134697633-134697655 GGGAGTGCATGGGGCACTGAGGG - Intronic
1062139112 9:134945680-134945702 GGCAGAGGGTGGAGGGCAGAGGG + Intergenic
1062344584 9:136109046-136109068 GGCAGGGCGGGGAGGGCAGAGGG - Intergenic
1062484641 9:136769224-136769246 GGCAGTGCATGGGGGGGTGGCGG - Intergenic
1062484659 9:136769259-136769281 GGCAGTGCATGGAGGGGTGGCGG - Intergenic
1062484674 9:136769293-136769315 GGCAGTGCATGGAGGGGTGGCGG - Intergenic
1062484684 9:136769318-136769340 GGCAGTGCATGGGGGGGTGGCGG - Intergenic
1062484701 9:136769352-136769374 GGCAGTGCATGGAGGGGTGGCGG - Intergenic
1062484711 9:136769377-136769399 GGCAGTGCATGGGGTGGTGGCGG - Intergenic
1062484727 9:136769412-136769434 GGAAGTGCATGGGGGGGTGGCGG - Intergenic
1062484743 9:136769445-136769467 GGCAGTGCATGGGGGGTGGCGGG - Intergenic
1062484774 9:136769512-136769534 GGCAGTGCATGGGGGGTGGCGGG - Intergenic
1062484805 9:136769579-136769601 GGCAGTGCATGGGGGGTGGCGGG - Intergenic
1062484822 9:136769613-136769635 GGCAGTGCATGGAGGGGTGGCGG - Intergenic
1062484833 9:136769638-136769660 GCCAGTGCATGGGGGGGTGGCGG - Intergenic
1062484848 9:136769673-136769695 AGCAGTGCATGGAGGGGTAGCGG - Intergenic
1185469470 X:373923-373945 GGCAGTGCAGGGAGCGGAGAAGG - Intronic
1187956466 X:24523583-24523605 GAAAGAGCATGGAGGGATGACGG + Intronic
1189259700 X:39669633-39669655 GGCAGAGCAAGGATGGCTGATGG - Intergenic
1189896822 X:45664927-45664949 GGCATAGCATGGTGGGCTGCAGG + Intergenic
1190691154 X:52914523-52914545 GGCAGGGAATGGAGGGTTGATGG - Intergenic
1190694829 X:52941269-52941291 GGCAGGGAATGGAGGGTTGATGG + Intronic
1191053889 X:56222702-56222724 GGCAGGGCATGGCGGGCTGCAGG + Intergenic
1194363164 X:92979674-92979696 GTCAGAGCATGGGGGGCTGGGGG + Intergenic
1195319261 X:103708296-103708318 GGCTGTGAATGGGGGCCTGAGGG - Intronic
1198232706 X:134707449-134707471 GTCAGAGGATGGAGGGCTGGGGG - Intronic
1198440824 X:136661351-136661373 GGCTGTGCATGGAGAATTGATGG - Intergenic
1200323831 X:155216838-155216860 GGCAGGGCAGGGCGGCCTGAGGG + Intronic
1200671405 Y:6095920-6095942 GTCAGAGCATGGGGGGCTGGGGG + Intergenic
1201775769 Y:17664072-17664094 GGCAGTCCATTGAGGCCTAAGGG - Intergenic
1201825787 Y:18241920-18241942 GGCAGTCCATTGAGGCCTAAGGG + Intergenic