ID: 903173102

View in Genome Browser
Species Human (GRCh38)
Location 1:21565609-21565631
Sequence AGATGAGGAGGGGGGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 474}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903173102 Original CRISPR AGATGAGGAGGGGGGGCCGC AGG Intronic
900072088 1:779062-779084 AGATGAGGCGAGTGGGCGGCCGG - Intergenic
900387314 1:2416546-2416568 AGCTGGGGAGGGTGGGCAGCGGG + Intergenic
900516121 1:3082963-3082985 AGAGGAAGAGGTGGGGGCGCTGG + Intronic
900526002 1:3128972-3128994 AGATGAGGAGGGTGGCCCTGGGG + Intronic
900639647 1:3682519-3682541 AGAGCAGGAGGGGTGGCCCCGGG + Intronic
900650313 1:3727183-3727205 TGATGATGAGGATGGGCCGCCGG - Exonic
901120222 1:6885788-6885810 GGAGGAGGAGGGGAGGCAGCAGG - Intronic
902963992 1:19984822-19984844 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
904337865 1:29809845-29809867 AGGTGAGGAGGTGGGGGCTCAGG + Intergenic
904462056 1:30686090-30686112 AGGTGAGGAGGTGGGGGCTCAGG - Intergenic
904465255 1:30703875-30703897 AGATGAGGAGGGTGGCGTGCTGG - Intergenic
904619390 1:31766287-31766309 GAAGGAGGAGGGGGGGCCTCAGG - Intergenic
904871715 1:33623503-33623525 AGAGAAGGAGGGAGGGACGCAGG - Intronic
905107504 1:35573314-35573336 AGAGGAGGAAGGGCGGGCGCTGG + Intergenic
905433909 1:37943911-37943933 AGGTGAGGATGGGGGCCCGCTGG + Intronic
905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG + Intergenic
906653814 1:47533576-47533598 GGAGGAGGAGGGGGCGGCGCCGG + Intergenic
906931839 1:50177633-50177655 AGATGAGGATGGGAGGTGGCAGG + Intronic
908014250 1:59814936-59814958 GGGTGAGGAGGGGGTGACGCCGG + Exonic
914214249 1:145610205-145610227 AAATGAGCAGGGAGGGGCGCAGG - Intronic
914466187 1:147930607-147930629 AAATGAGCAGGGAGGGGCGCAGG - Intronic
917291646 1:173477370-173477392 CGGTGATGAGGGGGCGCCGCTGG - Exonic
917594907 1:176519375-176519397 AGGTGAGGAGGTGGGGCTGGTGG + Intronic
917973396 1:180222993-180223015 AGATGAGGAAAGGGGGAAGCGGG + Intergenic
918077075 1:181178503-181178525 GGATGGGGTGGGGGGGCAGCGGG + Intergenic
919822928 1:201484285-201484307 AGATGAGGAGGGGGGAAGGCTGG - Exonic
920494027 1:206441366-206441388 TGAGGAGCAGAGGGGGCCGCGGG + Intronic
920571522 1:207021716-207021738 GTGTGTGGAGGGGGGGCCGCTGG - Exonic
921031522 1:211338902-211338924 AGATGAGGAAGGGGTGACACAGG + Intronic
921207132 1:212858467-212858489 CGATGAGGAGGGGGCGGCGGTGG + Exonic
921604551 1:217138325-217138347 AGACGAGGAGGGCGAGGCGCTGG + Intergenic
922267022 1:223993017-223993039 AGATGAGGCGAGTGGGCGGCCGG - Intergenic
923140047 1:231153758-231153780 AGGTGAGGAGGGAGGGCTGAGGG - Intergenic
923429244 1:233905022-233905044 ACTTGAGGCGGAGGGGCCGCGGG - Exonic
923523259 1:234752463-234752485 ACATGAGGAAGGGTGGCCCCAGG - Intergenic
924539645 1:244969895-244969917 GGAGGAGGAGGCCGGGCCGCGGG + Exonic
1066458291 10:35590839-35590861 ATATGAGGAGGTGGGGCCTTTGG - Intergenic
1067163474 10:43846472-43846494 AGAGGAGGAGCGGGGCCCTCGGG + Intergenic
1069427454 10:68301342-68301364 AGAGGAGTAGAGGGGGCCACTGG + Intronic
1070534794 10:77368176-77368198 TGATGAGGATGGGGGGCAACTGG - Intronic
1070937856 10:80315424-80315446 AGGTGTGGAGGGAGGGGCGCAGG + Intergenic
1071519425 10:86319799-86319821 AGAGGAGGAGGGGCAGCCCCTGG - Intronic
1072935452 10:99708156-99708178 GGATGAGGAGGGGGTGGGGCAGG - Intronic
1073172137 10:101519504-101519526 AGAAGAGGAAGGGGGACAGCTGG - Intronic
1075475114 10:122727671-122727693 CCTTGAGGAGGAGGGGCCGCGGG + Intergenic
1076294653 10:129375245-129375267 AGCTGGTGAGGTGGGGCCGCAGG - Intergenic
1076889769 10:133277721-133277743 ACATGGGGGGGGGGGGCCTCAGG + Intergenic
1077194152 11:1270932-1270954 AAATGAGGAGGGAGGTCCCCAGG - Intergenic
1077194899 11:1274576-1274598 AGGAGAGGAGGGGGAGCCTCCGG + Exonic
1077216192 11:1396163-1396185 AGACGAGGAGCGGGGGACGCAGG - Intronic
1077317963 11:1927669-1927691 AGCAGAGGAGGCAGGGCCGCAGG + Intronic
1077467570 11:2740813-2740835 AGAGGAGGAGACGTGGCCGCAGG - Intronic
1077491534 11:2863007-2863029 GGCTGAGGAAGGCGGGCCGCGGG - Intergenic
1079892915 11:26080025-26080047 AGAGGAGGAGGGGGGAGGGCGGG + Intergenic
1081659693 11:44880407-44880429 AGATGAGGAGAGGGAGTCCCAGG - Intronic
1083205541 11:61146581-61146603 GGAGGAGGAGGGAGGGCTGCGGG + Intronic
1083618597 11:64038089-64038111 AGATGGGGAGGAGGGGACACAGG - Intronic
1083780208 11:64913763-64913785 AGATGGGGAGTGGGGGCTGCTGG - Intronic
1084566349 11:69931075-69931097 GGGTGGGGAGGTGGGGCCGCAGG + Intergenic
1084618541 11:70252449-70252471 AGATGAGGAGGGCGGGCTGGGGG + Intergenic
1084889598 11:72230189-72230211 GGATGTGGAGGGTGGGCGGCTGG + Exonic
1085052313 11:73386226-73386248 GGATGGGGAGGAGGGGCCCCAGG - Intronic
1085109263 11:73873303-73873325 CGATGAGGAGGAGGACCCGCTGG - Exonic
1086048826 11:82565076-82565098 AGAGGAGGAGGGGGGACAGGAGG + Intergenic
1089192050 11:116660381-116660403 AGATGATGAGAAGGGGCCGGTGG + Intergenic
1089287143 11:117414914-117414936 ATATGAGGAGGCGGGGCCTTTGG - Intergenic
1089612356 11:119676598-119676620 AGAAGGGGATGGTGGGCCGCAGG + Intronic
1090068727 11:123525758-123525780 AGGTGAGGGTGGGGGGCAGCCGG + Exonic
1090173102 11:124622711-124622733 AGGAGAGGAGGGAGGGCCGGCGG - Intergenic
1091906032 12:4189766-4189788 GGATGAAGAGGGAGGGCCGGGGG + Intergenic
1092054216 12:5495776-5495798 AGATGAGGAGGGGTGGTCACAGG - Intronic
1092256328 12:6928282-6928304 AGAAGAGGAGAGGGGGGCGGGGG + Intronic
1093081551 12:14817476-14817498 AGTTGAGGAGTGGGGGGCGAGGG - Intronic
1093583185 12:20807383-20807405 GGCTGAGGAGGGCGGGGCGCAGG - Intergenic
1095221999 12:39626608-39626630 AGAAGGGGAGGAGGGGCAGCAGG - Intronic
1095989548 12:48025296-48025318 AGATGGGGAGGGGATGCCGTGGG + Exonic
1096191653 12:49623665-49623687 CGATGGGGCGGGGAGGCCGCTGG + Intronic
1097155084 12:57006478-57006500 CGACGAGGAGGCGGCGCCGCCGG + Intergenic
1097222691 12:57460200-57460222 AGGTGAGAAGGGGGGGCAGGCGG + Exonic
1097395750 12:59072585-59072607 AGAAGAGGAGGGGGAGCTGTAGG + Intergenic
1098450212 12:70610416-70610438 AGATAGGGAGGGGGAGACGCTGG - Intronic
1101399934 12:104378339-104378361 AGATGACACAGGGGGGCCGCAGG - Intergenic
1103649597 12:122422500-122422522 AGGTGAGCAGGGGGCGGCGCGGG - Exonic
1103678748 12:122676968-122676990 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
1103954354 12:124567928-124567950 AGAGGAGGAGGAGGGCCCCCGGG - Intergenic
1105414050 13:20193545-20193567 GGCCGAGGAGGGGGCGCCGCTGG + Intergenic
1105805643 13:23950400-23950422 AGATGAGGAGGGGGAGGAGGTGG - Intergenic
1105883449 13:24623347-24623369 AGATGTGGAGGGAGAGGCGCGGG + Intergenic
1106054204 13:26222730-26222752 GGATGAGGAGGGAGGATCGCTGG - Intergenic
1106125480 13:26897238-26897260 ACATGAAGAGGTGGGGCCTCTGG - Intergenic
1106269505 13:28139177-28139199 AGGTGAGGGGGGGAGCCCGCGGG - Intronic
1107102934 13:36613523-36613545 AGATGAGGAAGTTGGGCCTCAGG - Intergenic
1107400410 13:40063692-40063714 AGAGGAGGAGGGGAGTCCCCAGG + Intergenic
1107851643 13:44577355-44577377 GGAGGAGGAGGGGCGACCGCCGG + Intergenic
1107966880 13:45605089-45605111 AGTTGAGGGGGAGGGGCCTCGGG - Intronic
1109158861 13:58947332-58947354 AGATAAGGAGGGTGGACTGCAGG - Intergenic
1111412081 13:87890728-87890750 AGTTGAGGAAGGGGTGCTGCTGG + Intergenic
1112437890 13:99404632-99404654 TGATGAGGAGGGGGGCCCAGGGG - Intergenic
1113086069 13:106570589-106570611 GTATGAGGAGGTGGGGCTGCTGG - Intergenic
1113086077 13:106570621-106570643 GTATGAGGAGGTGGGGCTGCTGG - Intergenic
1113086085 13:106570653-106570675 GTATGAGGAGGTGGGGCTGCTGG - Intergenic
1113765162 13:112876702-112876724 AAATGAGGGGTGGGGGCCCCTGG + Intronic
1114455119 14:22849021-22849043 AGAAGAGGAGGGGGAGCCTAGGG + Intronic
1114549711 14:23525752-23525774 GGAGGAGGAGGGGTGGCAGCTGG + Exonic
1116018191 14:39431823-39431845 AGATGCGGAGCTGGGGCCACAGG + Exonic
1119921758 14:78453097-78453119 AGATGAGGAGGGTGGTCACCAGG + Intronic
1122116701 14:99531159-99531181 AGAGGAGGAGGGTGGGCTGGGGG + Intronic
1122315399 14:100823514-100823536 AAATGATGAGGGGGGGGAGCAGG - Intergenic
1122316139 14:100827074-100827096 AGCTGGGGATGGGGTGCCGCGGG + Intergenic
1122917824 14:104866868-104866890 AGAGGAGAAGGGGAGGCTGCCGG - Intronic
1122952281 14:105051650-105051672 AGATGAGGATGGCGGTCCTCCGG + Exonic
1123024859 14:105419811-105419833 GGAAGAGGAGGAGCGGCCGCGGG - Exonic
1123813646 15:23954956-23954978 AGGTGGGGAGTGAGGGCCGCAGG + Intergenic
1125336850 15:38635360-38635382 AGATGAAAAGGGGCTGCCGCAGG - Intergenic
1125830670 15:42715102-42715124 AGATGAGAAGCCGGGGCCTCTGG + Intronic
1126034893 15:44536952-44536974 AGAGGCGGAGGGGGGGGCGGAGG - Intergenic
1126140141 15:45430581-45430603 ATATAAGGTGGGGAGGCCGCCGG + Intronic
1126598998 15:50409730-50409752 AGAATAGGAGGGGGGGTTGCTGG + Intergenic
1127088571 15:55446293-55446315 AGACGGGGGGGGGGGGCAGCTGG + Intronic
1127367928 15:58309115-58309137 AGAGGAGGAGGGCAGGCTGCAGG - Intronic
1127884767 15:63189555-63189577 AGAGGCGGGGAGGGGGCCGCGGG - Exonic
1128067829 15:64775507-64775529 AGGTGGGGAGGGGGTGCGGCGGG + Exonic
1128147281 15:65338777-65338799 AGATGAGGAGGCAGGGCTGGAGG - Intronic
1128393331 15:67198170-67198192 AGATGAGGATGGGGTGATGCTGG - Intergenic
1128582396 15:68818943-68818965 GGGAGAGGAGGGGGCGCCGCCGG - Intronic
1128762446 15:70226572-70226594 AGCTGAGAAGGAGGGGCAGCAGG - Intergenic
1129193825 15:73952779-73952801 AGATCATGAGGTGGGGCTGCAGG + Intergenic
1129196896 15:73973738-73973760 AGGTGTGGAGGGAGAGCCGCGGG + Intergenic
1129227285 15:74177300-74177322 AGATGAGGAGAAGGGGACACAGG + Intergenic
1129720992 15:77877876-77877898 AGATGGGGAGGGGGAACGGCGGG + Intergenic
1130002518 15:80059808-80059830 AGGTGAGGAGCGCGGCCCGCGGG + Exonic
1130254746 15:82320678-82320700 ACACGAGGAGGGGAGGCCCCTGG - Intergenic
1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG + Intergenic
1132478123 16:152765-152787 AGGTGAGGGGAGGGGGCTGCAGG - Exonic
1132480071 16:162977-162999 AGGTGAGGGGAGGGGGCTGCAGG - Intronic
1132500244 16:281756-281778 TGACAAGGAGGGTGGGCCGCCGG + Exonic
1132732103 16:1367607-1367629 TGAGGGGGAGGGAGGGCCGCAGG - Intronic
1132765783 16:1533499-1533521 AGATGGGGAGGGGCGGCAGGAGG + Intronic
1133036600 16:3036976-3036998 AGGTGAAGGGGCGGGGCCGCGGG + Intergenic
1133140625 16:3741147-3741169 GGGTGAGGAGGGGTGGCGGCGGG - Intronic
1133168738 16:3966902-3966924 CGATGAGGCTGGCGGGCCGCCGG + Exonic
1133339572 16:5027780-5027802 AGAGGAGCAGTGGGGGCTGCCGG + Intronic
1133419970 16:5637800-5637822 TGGTGAGGAGGGAGGGCCACAGG + Intergenic
1134059481 16:11190551-11190573 AGTGGAGGGAGGGGGGCCGCTGG - Intergenic
1134063221 16:11211360-11211382 AGATGAGGAGGTGTGGACCCGGG - Intergenic
1134310212 16:13069743-13069765 AGATGAGGATGTGGGGCCTTTGG + Intronic
1134341705 16:13352694-13352716 AGATAAGGGGGGGGGGGGGCGGG + Intergenic
1135193674 16:20376701-20376723 AGCTGAGGAATGGGGGCTGCAGG - Intronic
1135980418 16:27142794-27142816 GGATGAGGTGGGAGGTCCGCAGG - Intergenic
1136088541 16:27902558-27902580 GGAGGGAGAGGGGGGGCCGCTGG + Intronic
1136147111 16:28322188-28322210 GGGTGTGGTGGGGGGGCCGCTGG - Exonic
1136185830 16:28588382-28588404 AAATGAGGAGAGGGGGCCTCAGG - Intronic
1136510759 16:30737114-30737136 AGAGGAGGAGGAGGGGCCGGGGG + Exonic
1138207369 16:55134764-55134786 TGAAGAGGAAGGGGGGCCCCAGG - Intergenic
1139364802 16:66426978-66427000 AGATGCGGGGCGGGGGGCGCGGG - Intergenic
1141182902 16:81766460-81766482 AGAGGAGGAGGAGGAGGCGCTGG - Intronic
1141538398 16:84699713-84699735 AGGTGAGGAGCCGGGCCCGCCGG + Intergenic
1142090407 16:88206868-88206890 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142090420 16:88206894-88206916 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142090492 16:88207044-88207066 GGAGGGGGAGGGGAGGCCGCGGG + Intergenic
1142112102 16:88338427-88338449 TGATGAGGAGAGGTGGCCTCGGG + Intergenic
1142278029 16:89133153-89133175 AGAAAAGGAGGGGGAGCTGCTGG + Exonic
1142392180 16:89808871-89808893 GGATGAGAAGGGGAGGCTGCAGG - Intronic
1142712006 17:1728454-1728476 AGAGGAGGAGGAGGGGGAGCAGG + Exonic
1142749357 17:1978077-1978099 AGTGCAGGAGGCGGGGCCGCGGG - Intronic
1142873812 17:2838631-2838653 AGATGAGGAAGGGAGGCGGGTGG + Intronic
1143113469 17:4567062-4567084 AGATGAGGAGGGGTGTCTCCGGG + Intergenic
1143537338 17:7549173-7549195 AGAGGCGGAGGGGGCGCCGGGGG + Exonic
1143626078 17:8110759-8110781 AGGTGAGGAGGAGAGGACGCTGG - Intronic
1143894498 17:10125650-10125672 AGATGAGGAGGGAGGAGGGCAGG + Intronic
1143961579 17:10725583-10725605 AGATGTGAATGGGGGGCTGCAGG + Intronic
1144685571 17:17223889-17223911 AGATGAGGTGCCGGGGCGGCAGG - Intronic
1144804701 17:17956840-17956862 AGATGTGGAGGGAGAGGCGCGGG - Intronic
1145110240 17:20155994-20156016 AGATGAGGGGGCGGGGCCCACGG + Intronic
1146666372 17:34707244-34707266 AGATGAGGAGGGTGGGAGGTAGG - Intergenic
1147186831 17:38717570-38717592 AGAAGAGGAGGGGAGGGTGCTGG - Exonic
1148047535 17:44753344-44753366 TGATGTGGAGGGGTGGCAGCAGG - Intergenic
1148127113 17:45242570-45242592 AGATGAGGAGGGGGAGGCCCAGG + Intronic
1148540311 17:48475068-48475090 AAAGGTGGAGGGGGTGCCGCTGG - Intergenic
1148662631 17:49347462-49347484 AGCTGAGGTGGGAGGACCGCTGG + Intronic
1148820969 17:50359426-50359448 AGAGGAGGAGGGGGTGCTGGTGG + Intronic
1151947113 17:77325787-77325809 AGATCATGAGGGGTGGCCCCAGG - Intronic
1152285172 17:79408356-79408378 AGATGAGGAGGTGAGTCCACGGG + Intronic
1152287631 17:79421979-79422001 AGATGAGGAGGGGGACTTGCCGG + Intronic
1152557552 17:81061422-81061444 AGATGGGGAGGGAGGGCCCGAGG - Intronic
1152574561 17:81134347-81134369 AGGTGAGGCCTGGGGGCCGCGGG - Exonic
1152612534 17:81322809-81322831 GGATGAGGTGGAGGGGCCGGTGG - Intronic
1153121318 18:1730300-1730322 ATATGAGAAGGGGGGGCCATGGG + Intergenic
1154253998 18:12767270-12767292 AGGTGAGGGGGCAGGGCCGCAGG - Intergenic
1154345804 18:13542652-13542674 AGATAAGGAGGCGGGGCGGGCGG + Intronic
1155442968 18:25881194-25881216 GGATGAGGAGGAGGGGCAGGCGG + Intergenic
1156555506 18:38063339-38063361 AGATGAGAAGGGAGGGCACCAGG + Intergenic
1157501659 18:48194818-48194840 AGATGAGGAGGAGTGGGTGCTGG + Intronic
1157605429 18:48923200-48923222 AGAGGAGGAGCTGGGGCTGCAGG - Intronic
1157725270 18:49959125-49959147 AGATGAGGAGGGGGTGTTCCAGG - Intronic
1159040175 18:63317929-63317951 AGAGGAGGAGGTAGGGACGCCGG + Intronic
1159058808 18:63493267-63493289 AAAAGAGGAGGGGGGGCCTCTGG - Intronic
1160256347 18:77251175-77251197 AGATGAGCAGGAGCGGCAGCAGG - Exonic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1160514419 18:79470647-79470669 AGACGAGGAGTGCGGGCGGCTGG - Intronic
1160939676 19:1614419-1614441 AGGTGAGGAGGGGCTGCCACGGG + Intronic
1161299807 19:3537214-3537236 AGAGGAGGTGGAGGGGCCCCAGG + Intronic
1161739397 19:6011374-6011396 ATTTGAGGAGGGAGGTCCGCTGG - Intronic
1161843048 19:6694067-6694089 AGAAGAGGTGGGGGGCCCTCAGG + Intronic
1161843081 19:6694174-6694196 AGAAGAGGTGGGGGGCCCTCAGG + Intronic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162019612 19:7862670-7862692 AGGTCAGGAGGCGGGGCCGCGGG - Intronic
1162019621 19:7862700-7862722 GGATCAGGAGGCGGGGTCGCGGG - Intronic
1162019643 19:7862747-7862769 GGATCAGGAGGCGGGACCGCGGG - Intronic
1162019690 19:7862870-7862892 GAATGAGGAGGCGGGGCCGCGGG - Intronic
1162372298 19:10286925-10286947 AGTCGAGGAGGCGGGGCTGCGGG + Intergenic
1162619427 19:11829383-11829405 AGAGCAGGAGGGGGAGCCCCTGG - Intronic
1162628156 19:11902681-11902703 AGAGCAGGAGGGGGAGCCCCTGG - Intronic
1162792964 19:13072456-13072478 AGGTGAGGTGGGGGAGGCGCAGG + Intronic
1163329635 19:16628137-16628159 AAAGGAGGAGGAGGAGCCGCCGG + Exonic
1163406023 19:17122985-17123007 GGTTGAGGTGGGAGGGCCGCAGG + Intronic
1163582107 19:18145115-18145137 GGATAACGATGGGGGGCCGCAGG - Exonic
1163582951 19:18149227-18149249 AGCTGGGGAGGCGGGGCTGCTGG - Exonic
1163584012 19:18154302-18154324 TGAGGAGGAGGGGAGGCTGCCGG - Intronic
1164443800 19:28300109-28300131 GGATGAGAAGGGGAGGCTGCAGG + Intergenic
1164541051 19:29121861-29121883 ACATGAGGAGGAGTGGCCGGAGG + Intergenic
1164581929 19:29440003-29440025 AGGTGAGGAGGGAGAGGCGCAGG + Intergenic
1165060823 19:33204499-33204521 ACATGAGGAGTGGGGGCAGCCGG + Intronic
1165213693 19:34254613-34254635 AGGTGAGGAGCGGGCGCGGCGGG + Exonic
1165431563 19:35776044-35776066 GGAGGAGGAGGGGGCTCCGCCGG - Intronic
1165433089 19:35783480-35783502 AGAGGATGAGGGAGGGCCCCAGG + Intronic
1166361756 19:42255429-42255451 AGGAGAGGAGGAGGGGCAGCAGG - Intergenic
1166543279 19:43619563-43619585 AGAGCCGGAGCGGGGGCCGCCGG - Exonic
1166694567 19:44845492-44845514 AGACGGGGCGGGGGGGCGGCGGG - Intergenic
1166862359 19:45817762-45817784 AGGTGATGAGGGAGGGCAGCTGG - Intronic
1167266419 19:48485224-48485246 AGGTGAGGAGGGGAGGATGCAGG - Intergenic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167794961 19:51703097-51703119 AGGTGAGGGGGCGGGGCCTCGGG + Intergenic
1168011572 19:53537690-53537712 AGAAGAGGACGCGGGGCCGTCGG - Intronic
1168108879 19:54180930-54180952 AGAAGAGGCGGGCGGGCAGCGGG + Exonic
1168311500 19:55463275-55463297 AGAGGTGGAGGTGGGGCCCCTGG + Intergenic
1168323079 19:55521795-55521817 AGAGGTGGAGGGGGGGCTGTTGG + Intergenic
1168664260 19:58191428-58191450 AGATCAGGAGGCTGGGCCGGGGG - Intronic
1168717599 19:58538549-58538571 TGATGGGGACTGGGGGCCGCGGG - Intronic
925006642 2:448111-448133 AGATGATGACGGGAGGCCCCAGG + Intergenic
925181707 2:1821768-1821790 AGAGGAGCAGGAGGAGCCGCTGG + Intronic
925966013 2:9066800-9066822 AGCTGAGGTGGGGGGTCCACAGG + Intergenic
926304582 2:11628792-11628814 AGAGGAGGAGGAGAGGCAGCCGG + Intronic
927215754 2:20667109-20667131 GGGCCAGGAGGGGGGGCCGCGGG + Exonic
927246130 2:20958371-20958393 AGCTGCGGAGGGTGGGCCGGTGG + Intergenic
927717200 2:25360436-25360458 AGAAGAGAAGGGGGGGCTGGGGG - Intergenic
927809447 2:26173349-26173371 AGATGGGGACCGGGGTCCGCGGG + Intronic
927812475 2:26187677-26187699 AGAGGAGGAGGAGGGGGCGCAGG - Exonic
927956815 2:27212531-27212553 CGAGGAGAAGGGGGAGCCGCTGG - Intronic
928173767 2:29020660-29020682 AGGCGAGGAAGGGGGGCAGCAGG + Intronic
928610270 2:32985736-32985758 AGATGTTGAGGGGTGGCAGCGGG + Intronic
928929644 2:36611171-36611193 AGATTAGGAGGGAGGGCCTGGGG + Intronic
929437724 2:41940934-41940956 GGAGGAGGAGGGGAGGCCGTGGG + Intronic
931047252 2:58369233-58369255 AGGTGAGGCGGGGAGGCAGCGGG - Intergenic
931224475 2:60318014-60318036 AGAAGAGGTGGGGAGGCAGCCGG + Intergenic
931766234 2:65459056-65459078 AAATGAGGAGGAGGGGAGGCTGG - Intergenic
932278023 2:70465855-70465877 AGCTGAGGAGGGTGTGCCCCAGG - Intronic
932425670 2:71633054-71633076 AGATGAGGAGGCTGGACTGCAGG + Intronic
932702947 2:74003293-74003315 AGCTGAGGGGGAGGGGCGGCGGG + Intronic
932733009 2:74233630-74233652 AGTTGAGGAGGTGGGACAGCAGG - Intronic
933701131 2:85256097-85256119 AGGGGAGGAGGGGTGGGCGCAGG + Intronic
933713773 2:85345540-85345562 ATCTGAGGAAGGGAGGCCGCTGG - Intronic
933877536 2:86633549-86633571 AGATGTGGAGAGGGGGTGGCTGG + Intronic
934502773 2:94872705-94872727 AGATGTGGGGTGGGGGCAGCTGG + Intronic
934515802 2:94985699-94985721 AGAGGAGGTGGGGGTCCCGCTGG - Intergenic
934761920 2:96861219-96861241 AGAGGAGCAGGGGGCGCGGCTGG - Exonic
935112297 2:100104747-100104769 AGGGGAGGAGGGGCGGGCGCAGG - Intronic
935620562 2:105126085-105126107 GGATGTGGAGGGGAGGACGCTGG - Intergenic
936523529 2:113227385-113227407 AGATGAGGAGTGGGGGCAGGAGG - Intronic
936574377 2:113641285-113641307 AGGTTTGGAGGGGGGGCCACTGG - Intronic
937904089 2:127043551-127043573 AGACCAGGAGCGGGGGCCGTCGG + Intergenic
938767185 2:134468188-134468210 GTATGAGGAGGTGGGGCCTCTGG + Intronic
938871100 2:135477470-135477492 AGGTAAGGAAGAGGGGCCGCAGG - Intronic
940215063 2:151296000-151296022 AGATGTGGAGGGAGAGGCGCGGG + Intergenic
942169569 2:173276663-173276685 GGCTGAGGAGGGGGGATCGCTGG - Intergenic
943024187 2:182608450-182608472 AGATGTGGAGGGAGAGGCGCAGG + Intergenic
944258320 2:197648154-197648176 AGATGAGGAGGAAGGGCCAGAGG + Intronic
945907929 2:215615256-215615278 AGGTGAGGAGGGAGAGGCGCGGG - Intergenic
946160233 2:217831414-217831436 AGATGGGGAGGGGGGCCAGGGGG - Intronic
946325046 2:218980776-218980798 AGATGGGGAGGGTGGGGTGCGGG + Intergenic
948691942 2:239711669-239711691 AGAGGAGGATGGGAGGCCGGAGG - Intergenic
948805942 2:240453475-240453497 GGAAGAGGAAGGGGGGCCCCGGG - Intronic
948838260 2:240636657-240636679 AGGTGGGGAGAGGGAGCCGCTGG - Intergenic
1170764182 20:19275891-19275913 GGATGAAGAGGGGAGGCAGCAGG - Intronic
1171284171 20:23924030-23924052 AGATGAGGAGATGGGTCAGCTGG + Intergenic
1174414506 20:50358094-50358116 AGATGAGGAGGAGGCGAGGCTGG - Intergenic
1174678596 20:52382142-52382164 AAATGGGGTGGGGGGGCCGTGGG - Intergenic
1175237919 20:57526144-57526166 AGGAGAGGAGGAGGGCCCGCAGG + Intergenic
1175429743 20:58892372-58892394 AGGAGAGGAGGGGGTGACGCTGG + Intronic
1175744467 20:61445544-61445566 AGAGGGGGAGGAGGGGCCGGAGG - Intronic
1175776926 20:61659530-61659552 ACAGGAGGAGGGTGGGCCTCAGG + Intronic
1175777093 20:61660205-61660227 AGACGGGGAGGGGCGGCCTCTGG - Intronic
1175903052 20:62367438-62367460 AGAGGAGGGGGAGGGGCGGCCGG + Intergenic
1175961428 20:62638699-62638721 AGATGCAGAGGGAGGGCGGCAGG + Intergenic
1175981501 20:62741053-62741075 ACAGGAGGAGGGGAGGCCCCTGG - Intronic
1176053836 20:63134540-63134562 GGATGGGGAGGCGGGGCCCCAGG + Intergenic
1176054086 20:63135105-63135127 GGATGGGGAGGCGGGGCCCCAGG + Intergenic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1176549265 21:8214446-8214468 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176557158 21:8258669-8258691 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176568197 21:8397484-8397506 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176576100 21:8441704-8441726 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1177182431 21:17757957-17757979 AGGTGTGGAGGGAGGGGCGCAGG - Intergenic
1178545655 21:33491397-33491419 AGGTGAGGAGGGGGCGGGGCAGG - Exonic
1178909676 21:36664391-36664413 ACATGAGGAGGGGGTGCAGAAGG + Intergenic
1179016000 21:37594956-37594978 AGATGGGGAGGGCGGGGGGCGGG - Intergenic
1179529470 21:42009388-42009410 AGATGTGGCGGGGCTGCCGCGGG + Intronic
1180874382 22:19168378-19168400 AGGTGAGTAGGTGGGGCCGCGGG - Intergenic
1181461594 22:23089085-23089107 AGGTGAGGAGGGAGGGAGGCAGG + Intronic
1181603688 22:23967185-23967207 ACGTGCGGAGGGGGAGCCGCGGG - Intronic
1181604825 22:23974122-23974144 ACGTGCGGAGGGGGAGCCGCGGG + Intronic
1181851452 22:25752821-25752843 AGGTGTGGAGGGAGGGACGCAGG + Intronic
1182030856 22:27158231-27158253 AGATGGGGCGGGGGGGCGGTGGG + Intergenic
1182119396 22:27776900-27776922 AGGAGAGGAGGGGGAGCCGGTGG + Intronic
1182972149 22:34589046-34589068 AGAGGGGGAGGGGGGGTTGCTGG + Intergenic
1183572876 22:38667407-38667429 AGCTGAGGCTGGGGGGTCGCTGG - Intronic
1183587649 22:38762392-38762414 AGCTGAGGAGGGGTGGGGGCTGG - Intronic
1183689725 22:39381928-39381950 AGATGGGGAGGGGCGGGGGCAGG - Exonic
1185092996 22:48786366-48786388 AGATGAGGGAGGGAGGCCTCTGG + Intronic
1185229168 22:49670568-49670590 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
1203254150 22_KI270733v1_random:130762-130784 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203262206 22_KI270733v1_random:175841-175863 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
949315993 3:2756263-2756285 ATATGAGGAGGTGGGGCCTTTGG + Intronic
950523346 3:13509213-13509235 AGGTGAGGAGGGGAGGAGGCCGG - Intergenic
950527357 3:13532385-13532407 GGATGAGCTGGGGGGGCCTCTGG + Intergenic
952898112 3:38092714-38092736 AGAGGAGGAGGGTGGGAGGCGGG + Intronic
953384663 3:42499751-42499773 AGAAGCAGAGGGGGGGCCGACGG - Intronic
953474807 3:43196056-43196078 AGGTGAGGAGGCTGGGCCACAGG + Intergenic
953980364 3:47410379-47410401 AATTGAGGAGGTGGGGCCGAGGG - Exonic
954656156 3:52195434-52195456 AGAAGAGGAGGAGGGGGCGGAGG + Intergenic
954686543 3:52373184-52373206 AGGGGAGGAGGGGGGCCGGCTGG + Intronic
954718301 3:52538237-52538259 AGATGAGGAGTGGAGGCTTCTGG + Intronic
955081206 3:55659418-55659440 ATCTGAGGAGGAGGGGCCACGGG - Intronic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
955997028 3:64688046-64688068 GGCGGAGGCGGGGGGGCCGCGGG + Intergenic
958641724 3:96814361-96814383 TGAAGAGGCGTGGGGGCCGCGGG - Intergenic
961532415 3:127547655-127547677 GGAAGAGGAGGGGGCGCCTCCGG - Intergenic
961651361 3:128418184-128418206 AGGTGAGGAGGGGGTGCTGAGGG - Intergenic
962069103 3:132014329-132014351 AGATGAGGAGTGGGGGTGGGAGG - Intronic
963084748 3:141426514-141426536 AGAGGAGGAGAGGAGGCCGGGGG + Intronic
963108156 3:141664194-141664216 AGATGTGGAGGAGGGGCCGGTGG - Intergenic
963127410 3:141828062-141828084 AGATGGGGAGGTGGGGTGGCAGG - Intergenic
963987892 3:151618060-151618082 TGATGAGGAGGTGGGGCCTTTGG + Intergenic
966594282 3:181712254-181712276 AGAGGAGGAGGGGAGGCGGGCGG - Exonic
967104368 3:186243442-186243464 CGGTGTGGAGTGGGGGCCGCAGG - Intronic
968255883 3:197271163-197271185 AGATGTGGACTGGGGGCCACAGG - Intronic
969058268 4:4415446-4415468 AGATGGGTATGGGGGGCGGCAGG + Intronic
969240213 4:5892542-5892564 AGACGAGGGGGGCGGGCCCCGGG - Intronic
973179665 4:47252089-47252111 GGAGTAGGAGGGGGGGCAGCGGG - Intronic
975611277 4:76206024-76206046 AGATTAGGAGGTGGGGCCTTTGG + Intronic
976600193 4:86931334-86931356 AGATGAGGAGAGGGAGATGCTGG - Intronic
979224148 4:118265539-118265561 AGATGTGGAGGGAGAGGCGCGGG + Intergenic
980367975 4:131831180-131831202 TGATGAGGAAGTGGGGCCTCTGG - Intergenic
980711425 4:136573380-136573402 AGAAGAGCAGGGGAGGCCTCAGG - Intergenic
981841460 4:149117668-149117690 TGATGACAAGGGCGGGCCGCAGG + Intergenic
981903877 4:149896942-149896964 ATATTAGGAGGCGGGGCCTCTGG + Intergenic
982068264 4:151673249-151673271 ACATGGCGGGGGGGGGCCGCGGG + Intronic
983584884 4:169343870-169343892 AGATGAGGATGGGAGGCTGACGG - Intergenic
984805605 4:183748671-183748693 AGCTGAGGAGGTGGGACCTCAGG + Intergenic
984918065 4:184741198-184741220 AGATGTGGAGGGAGAGGCGCAGG + Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985537718 5:474066-474088 AGAGGAGGAAGAGGGGCTGCTGG + Intronic
985628956 5:1005035-1005057 GGAGGAGGAGGTGCGGCCGCAGG - Intergenic
985657134 5:1138009-1138031 AGAAGAGGAGGGGCGGGTGCCGG - Intergenic
986001710 5:3635574-3635596 ATATGAGGAGGTGGGGTCTCTGG + Intergenic
986190790 5:5494714-5494736 AGCTGCGGGGGCGGGGCCGCTGG - Intergenic
986319024 5:6612803-6612825 AGATGAGCAGGGCAGGCAGCAGG + Intronic
987738822 5:21878639-21878661 AGATGAGGTGGGAGGGTCACTGG + Intronic
987851287 5:23358746-23358768 GGATGAGGAGGAGGGGCAGTAGG - Intergenic
991254988 5:64603757-64603779 AGATGATGAGCTGGGGCAGCCGG + Intronic
991639423 5:68738496-68738518 AAATGAGGTGGGTGGGCCCCAGG + Intergenic
992079640 5:73222932-73222954 GGAGGAGGAGGGGGAGCCACTGG + Intergenic
992088695 5:73299437-73299459 TGAAAAGGAGGGCGGGCCGCGGG + Intergenic
992204075 5:74413224-74413246 AGTTGAGGAGGGGTGGCAGTGGG + Intergenic
992861602 5:80916554-80916576 AGATGGGGAGGGGGTGGGGCAGG - Intergenic
994246990 5:97489302-97489324 AGAAGAGGAGGTGAGGCAGCAGG + Intergenic
997232023 5:132252409-132252431 AGAAGAGAAGGAGGGGCCTCAGG + Intronic
997694685 5:135851853-135851875 GGCTGAGGAGGGGGTGCTGCAGG - Intronic
998822943 5:146073253-146073275 AGATGAGGTGGTGAGGCCGTGGG - Intronic
998885647 5:146691154-146691176 AGATGAGGAGGGCCGGCTCCGGG - Exonic
999228945 5:150050224-150050246 AGATGAAGGGTGGGGGGCGCAGG - Intronic
999263775 5:150253453-150253475 AGAGGTGGAGGGGGAGCAGCAGG - Exonic
999300453 5:150486893-150486915 GGGTGAGGAGGGGGCGCCGGTGG + Intronic
999370450 5:151052118-151052140 GGGTGAGGAGTGGGGGCTGCAGG - Intronic
1000940824 5:167357835-167357857 AGATGAGGAGGAGGTGCTGGAGG - Intronic
1001044706 5:168362928-168362950 AGAAGAGGAGGGAGGGCTGGAGG - Intronic
1001334643 5:170787445-170787467 AGCTGAGGAGGCCGGGCCCCTGG + Intronic
1001518946 5:172377117-172377139 AGCAGAGGAGTGGGGGCGGCAGG + Intronic
1002073885 5:176696765-176696787 AGATGACGGGGGGGAGCCCCAGG + Intergenic
1002548921 5:179972589-179972611 AGATGAGGGTGGGGGGTGGCTGG + Intronic
1002641366 5:180632153-180632175 AGTTCAGGAGGGAGGGCCTCAGG - Intronic
1002877033 6:1219873-1219895 AACTGAGGAGGGGGTGCCGCTGG + Intergenic
1003077960 6:2999495-2999517 AGATGGGGAGCGGGAGGCGCAGG + Intronic
1003237095 6:4304521-4304543 ACATGAGGTGGGGGGACTGCAGG + Intergenic
1004248423 6:14002417-14002439 AGATGTGGAGGGAGAGGCGCGGG + Intergenic
1005496856 6:26395348-26395370 AGATGAGGAGGGGCAGGAGCAGG - Intergenic
1005599463 6:27411860-27411882 AAGTGAGGAGGGAGGGCGGCTGG - Intergenic
1006897027 6:37477755-37477777 AGATGAGGTGAGGGGACCGCTGG - Intronic
1007576708 6:42929720-42929742 AGGTGAGGAGGCGGGGCCCGTGG + Exonic
1007609376 6:43139358-43139380 AGACGAGGAATTGGGGCCGCTGG - Intronic
1007694855 6:43725544-43725566 TGATGAGGATGGGGGGCAGGCGG + Intergenic
1007781987 6:44259578-44259600 GGATGGGGTGGGGGGGCTGCTGG + Intronic
1007901914 6:45421392-45421414 AAATGAGGAGGGGGGGTGGAGGG - Intronic
1008446528 6:51598376-51598398 AGGTGTGGAGGGGGCGGCGCTGG + Intergenic
1008572578 6:52829555-52829577 AGGTGTGGAGGGGGAGGCGCAGG - Intergenic
1008821723 6:55640137-55640159 AGAAGAGGAGGAGGGGCAGGTGG + Intergenic
1009414068 6:63396484-63396506 AGATGAGGATGGGCAGCCTCAGG + Intergenic
1013084118 6:106841013-106841035 AGATGAGGAGGTGGGTCTGGGGG + Intergenic
1013639589 6:112060115-112060137 ATATGGGGAGGGGGGACCACAGG + Intronic
1014265242 6:119269496-119269518 AGATGCAGATGGGGGGCCTCAGG + Intronic
1017728878 6:157296734-157296756 AGATGAGGATGGTGGGCCCACGG - Intronic
1018429580 6:163712937-163712959 AGATGAGGAAGGGGGTCGGGGGG - Intergenic
1019156178 6:170040247-170040269 AGGTGGGGAAGGGTGGCCGCCGG + Intergenic
1019158870 6:170056497-170056519 AGATGTGGAGGGTGGGGCTCAGG + Intergenic
1019183520 6:170207811-170207833 ACATGAGAAAGGGAGGCCGCCGG - Intergenic
1019409126 7:899012-899034 AGGTGAGGGGGGCGGGCGGCCGG - Exonic
1019600672 7:1882128-1882150 AGATGAGGAGGGGCAGCCTTGGG + Intronic
1020666272 7:11047799-11047821 AGAAGAGGAGGGAGGGCAGGAGG + Intronic
1020756666 7:12211506-12211528 TGACAAGGAGGGGAGGCCGCTGG + Intronic
1022289346 7:28986171-28986193 AGCTGGGGAGCGGGGGCCACAGG - Intergenic
1022315401 7:29240701-29240723 AGATGAGGGTGGGGGGCGGTGGG + Intronic
1022417250 7:30188932-30188954 GGAGGAGGAGGGAGGGCTGCTGG + Intergenic
1022459959 7:30595333-30595355 AGAGGAGGACGGAGGTCCGCGGG - Intronic
1025258077 7:57398982-57399004 AGATGAGGCTGTGGGGCAGCAGG + Intergenic
1025610561 7:63072712-63072734 AGATGAGGCTGTGGGGCAGCAGG - Intergenic
1026858502 7:73770097-73770119 AGACGAGGGGCCGGGGCCGCTGG + Exonic
1027151806 7:75738780-75738802 AGGTGAGGACGGGGGACCCCGGG - Exonic
1027228228 7:76258192-76258214 AGATGAGCAGGGGGGGCCCCTGG + Intronic
1029221843 7:98996070-98996092 ACATGAGGATGAGGGGACGCAGG - Intronic
1029316220 7:99716996-99717018 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1029321880 7:99769587-99769609 CGATGAGGAGGTGGGGCAGCTGG - Intronic
1030771936 7:113485776-113485798 ATATCAGGAGGTGGGGCCTCTGG + Intergenic
1033657489 7:143383054-143383076 AGATGAGGCTGGGGGCCCTCGGG - Exonic
1034842470 7:154412177-154412199 AGATTAGGAGGTGGGGCCTTTGG - Intronic
1035230597 7:157463649-157463671 AGATGAGGATGGGGGGAGGATGG - Intergenic
1035538003 8:407036-407058 AGGTGAAGACTGGGGGCCGCAGG + Exonic
1035715637 8:1752297-1752319 AGAGGAGGAGGGTGGGCAGCAGG + Intergenic
1036033410 8:4994807-4994829 AGATGCGGGGAGGGGGGCGCGGG + Exonic
1036701575 8:11016675-11016697 AGAGGCGGAGGCGGGGCCGGGGG - Intronic
1038336533 8:26650201-26650223 AGATGAGGAGGTGGAGGCTCAGG + Intronic
1038422120 8:27440114-27440136 GGAGGAGGAGGAGGGACCGCAGG + Intronic
1040071931 8:43195638-43195660 AGAGGAGGAGGAGGGGCTGGAGG + Intronic
1040495292 8:47960485-47960507 AGCTGAGGCGGGGGGATCGCAGG + Intronic
1042183430 8:66113840-66113862 TGAGGAGGTGGGGGGTCCGCGGG + Intergenic
1042333507 8:67607138-67607160 AGAAGAGGAGGGGGGGGAGGAGG - Intronic
1043102262 8:76060775-76060797 AGGTGTGGAGGGAGGGGCGCGGG - Intergenic
1045413763 8:101945944-101945966 AGATGAGGTGGGAGGGCTTCTGG - Intronic
1047212449 8:122850886-122850908 AGGTGAGGATGTGGGGCCTCAGG - Intronic
1049187832 8:141267819-141267841 AGGTGAGGATGTGGGGCAGCAGG + Intronic
1049290570 8:141799621-141799643 AGGCAAGGAGGGGTGGCCGCAGG - Intergenic
1049521766 8:143095050-143095072 AGATGAGGGGGGCGGGCATCAGG - Intergenic
1049783604 8:144440084-144440106 AGATGAGGAGGAGGAGGCGGAGG - Exonic
1053739238 9:41123563-41123585 AGACGAGGAGGCCGGGACGCGGG - Intergenic
1056032181 9:82564573-82564595 TGATGAGGAGGGTGGGGTGCAGG - Intergenic
1056034217 9:82586354-82586376 AGATAAAGTGGGAGGGCCGCAGG - Intergenic
1057182238 9:93036423-93036445 AGATGGGGAGGGTGGGGTGCAGG + Intergenic
1057448677 9:95137461-95137483 AGATGAGGAACGGGGCCTGCCGG - Intronic
1057869205 9:98706133-98706155 GGAGGAGGAGGGGAGGCAGCAGG + Intronic
1059388827 9:113986049-113986071 ACATGAGGAGGAGGCGCCCCTGG + Intronic
1059791195 9:117643097-117643119 AGATGTGGAGGGAGAGGCGCGGG - Intergenic
1060347290 9:122828235-122828257 AGCAGAGGAGGCGGGGCCCCCGG + Intronic
1060519739 9:124287415-124287437 AGATGAGGAGATGGGGGCTCAGG - Intronic
1060827585 9:126695623-126695645 AGATGAGGAGGGGAGGACTCTGG + Intronic
1060827618 9:126695759-126695781 AGATCAGAAGGGGAGGCTGCTGG + Intronic
1060895722 9:127215853-127215875 AGAGGAGGAGCGGGGGAAGCAGG + Intronic
1060972873 9:127748832-127748854 GGATGAGGAGGGGTGGCATCAGG + Intronic
1061108881 9:128552804-128552826 AGGTGAGCCGGGCGGGCCGCGGG + Intronic
1061257316 9:129460343-129460365 AGAGGAGGAGGGAGGGAGGCTGG - Intergenic
1061506774 9:131036129-131036151 AGAGGAGGAAGGGGACCCGCAGG - Intronic
1061585176 9:131562256-131562278 TGATGAGGATGGGGAGCCGCTGG - Intergenic
1061967617 9:134025194-134025216 GGATGAGGAGGAGGGGCTGGAGG - Intergenic
1061967656 9:134025306-134025328 AGAGGAGGAGGAGGGGCTGGAGG - Intergenic
1062033473 9:134372386-134372408 TGGTGTGGAGTGGGGGCCGCAGG + Intronic
1062113332 9:134794738-134794760 AGATGAGGAGGAGGGGAAGGAGG + Intronic
1062317246 9:135974017-135974039 TGAGGAGGAGGGGGGCCCTCAGG - Intergenic
1062530881 9:136999434-136999456 AGATGCACAGGGAGGGCCGCAGG + Intergenic
1203470551 Un_GL000220v1:113906-113928 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203478372 Un_GL000220v1:157878-157900 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203563667 Un_KI270744v1:76575-76597 AGATGTGGGGTGGGGGCAGCTGG + Intergenic
1185499200 X:584548-584570 AGAGGAGGAGGGGGAGAAGCAGG + Intergenic
1185645208 X:1610831-1610853 AGAGGAGGGGAGGGGGCCGATGG - Intergenic
1185662024 X:1735577-1735599 AGAAGAGGAGGGGGAGACGAAGG - Intergenic
1185677039 X:1857542-1857564 ATATGAGGAGGTGGGGCCCTTGG - Intergenic
1185716977 X:2350569-2350591 AGATGAGGAGAGAGGGACGTAGG + Intronic
1188269291 X:28118867-28118889 AAAGGAGGAGGGGGGGCTGAGGG - Intergenic
1188881769 X:35499266-35499288 AGGTGAGGAGGGAGAGGCGCGGG + Intergenic
1189279155 X:39809090-39809112 AAATGAGGAAGGAGGCCCGCAGG + Intergenic
1189323228 X:40098335-40098357 AGCTGGGGAGGGGAGGCCGGGGG - Intronic
1190329393 X:49226428-49226450 GGATGAGGAGGAGGGGGCTCTGG - Exonic
1191105049 X:56767482-56767504 AGGTGTGGAGGGAGAGCCGCGGG + Intergenic
1194077685 X:89417118-89417140 AGGTGTGGAGGGGGAGGCGCAGG + Intergenic
1195339298 X:103889916-103889938 AGGTGTGGAGGGGGGGTGGCAGG + Intergenic
1199767050 X:150948899-150948921 AGATGAGGAGGGGCTGCCCACGG + Intergenic
1199831819 X:151555521-151555543 AGATGTGGAGGGAGAGGCGCGGG - Intergenic
1199976868 X:152899327-152899349 AGATGAGGAGCGGAGGCCCTGGG - Intergenic
1200003681 X:153074322-153074344 AGAGGAGGAGAGGAGGCCCCGGG - Exonic
1200004042 X:153075687-153075709 AGAGGAGGAGAGGAGGCCCCGGG + Intergenic
1200091671 X:153638890-153638912 AGAGGAGGAGAGAGGGCAGCAGG - Intergenic
1200754050 Y:6973231-6973253 AGATGATGAGGAGGGGCAGAGGG - Intronic