ID: 903174678

View in Genome Browser
Species Human (GRCh38)
Location 1:21573838-21573860
Sequence ACACGGCCCTGGTGTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903174673_903174678 6 Left 903174673 1:21573809-21573831 CCGGGTCTGCTGAGAGGGGGCTG 0: 1
1: 0
2: 2
3: 33
4: 280
Right 903174678 1:21573838-21573860 ACACGGCCCTGGTGTCAGGATGG 0: 1
1: 0
2: 0
3: 16
4: 186
903174672_903174678 7 Left 903174672 1:21573808-21573830 CCCGGGTCTGCTGAGAGGGGGCT 0: 1
1: 0
2: 0
3: 27
4: 271
Right 903174678 1:21573838-21573860 ACACGGCCCTGGTGTCAGGATGG 0: 1
1: 0
2: 0
3: 16
4: 186
903174671_903174678 8 Left 903174671 1:21573807-21573829 CCCCGGGTCTGCTGAGAGGGGGC 0: 1
1: 0
2: 0
3: 14
4: 148
Right 903174678 1:21573838-21573860 ACACGGCCCTGGTGTCAGGATGG 0: 1
1: 0
2: 0
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903174678 Original CRISPR ACACGGCCCTGGTGTCAGGA TGG Intronic