ID: 903176706

View in Genome Browser
Species Human (GRCh38)
Location 1:21585851-21585873
Sequence CTGTGGAAATGGAGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903176695_903176706 17 Left 903176695 1:21585811-21585833 CCAGACACTGCTATAATAGACCA No data
Right 903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG No data
903176694_903176706 18 Left 903176694 1:21585810-21585832 CCCAGACACTGCTATAATAGACC No data
Right 903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG No data
903176699_903176706 -3 Left 903176699 1:21585831-21585853 CCAGGCAGGAGAAACTGGAGCTG No data
Right 903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG No data
903176693_903176706 21 Left 903176693 1:21585807-21585829 CCGCCCAGACACTGCTATAATAG No data
Right 903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG No data
903176691_903176706 30 Left 903176691 1:21585798-21585820 CCAGGAGACCCGCCCAGACACTG No data
Right 903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG No data
903176692_903176706 22 Left 903176692 1:21585806-21585828 CCCGCCCAGACACTGCTATAATA No data
Right 903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903176706 Original CRISPR CTGTGGAAATGGAGAGGGGA GGG Intergenic
No off target data available for this crispr