ID: 903178353

View in Genome Browser
Species Human (GRCh38)
Location 1:21593461-21593483
Sequence GGACCTCCATGGCCAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903178353_903178362 1 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178362 1:21593485-21593507 AGAACACCCCAGCTGGGGGTGGG No data
903178353_903178358 -4 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178358 1:21593480-21593502 GTCCAAGAACACCCCAGCTGGGG No data
903178353_903178363 5 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178363 1:21593489-21593511 CACCCCAGCTGGGGGTGGGTAGG No data
903178353_903178369 10 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178369 1:21593494-21593516 CAGCTGGGGGTGGGTAGGGGAGG No data
903178353_903178361 0 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178361 1:21593484-21593506 AAGAACACCCCAGCTGGGGGTGG No data
903178353_903178356 -6 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178356 1:21593478-21593500 AGGTCCAAGAACACCCCAGCTGG No data
903178353_903178370 25 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178370 1:21593509-21593531 AGGGGAGGACCCCCTTGTATTGG No data
903178353_903178371 26 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178371 1:21593510-21593532 GGGGAGGACCCCCTTGTATTGGG No data
903178353_903178366 7 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178366 1:21593491-21593513 CCCCAGCTGGGGGTGGGTAGGGG No data
903178353_903178364 6 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178364 1:21593490-21593512 ACCCCAGCTGGGGGTGGGTAGGG No data
903178353_903178359 -3 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178359 1:21593481-21593503 TCCAAGAACACCCCAGCTGGGGG No data
903178353_903178357 -5 Left 903178353 1:21593461-21593483 CCCAGGGTTGGCCATGGAGGTCC No data
Right 903178357 1:21593479-21593501 GGTCCAAGAACACCCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903178353 Original CRISPR GGACCTCCATGGCCAACCCT GGG (reversed) Intergenic
No off target data available for this crispr