ID: 903178403

View in Genome Browser
Species Human (GRCh38)
Location 1:21593653-21593675
Sequence AGGCCCCTGCTGTGAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903178392_903178403 23 Left 903178392 1:21593607-21593629 CCTTGTCCTCATTCTCCAGGTAA No data
Right 903178403 1:21593653-21593675 AGGCCCCTGCTGTGAGGTAGGGG No data
903178394_903178403 17 Left 903178394 1:21593613-21593635 CCTCATTCTCCAGGTAAGGAAAC No data
Right 903178403 1:21593653-21593675 AGGCCCCTGCTGTGAGGTAGGGG No data
903178395_903178403 8 Left 903178395 1:21593622-21593644 CCAGGTAAGGAAACAGACTCCTG No data
Right 903178403 1:21593653-21593675 AGGCCCCTGCTGTGAGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903178403 Original CRISPR AGGCCCCTGCTGTGAGGTAG GGG Intergenic
No off target data available for this crispr