ID: 903179171

View in Genome Browser
Species Human (GRCh38)
Location 1:21596945-21596967
Sequence CTCTGGACTCAGAGGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 323}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903179171_903179181 -1 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179181 1:21596967-21596989 GGGATGCTCAGGGGTGATGGAGG 0: 1
1: 0
2: 5
3: 53
4: 403
903179171_903179182 5 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179182 1:21596973-21596995 CTCAGGGGTGATGGAGGCCCAGG 0: 1
1: 0
2: 1
3: 45
4: 356
903179171_903179185 10 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179185 1:21596978-21597000 GGGTGATGGAGGCCCAGGGAGGG 0: 1
1: 1
2: 4
3: 107
4: 866
903179171_903179187 12 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179187 1:21596980-21597002 GTGATGGAGGCCCAGGGAGGGGG 0: 1
1: 1
2: 12
3: 94
4: 968
903179171_903179178 -10 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179178 1:21596958-21596980 GAGTCCAGAGGGATGCTCAGGGG 0: 1
1: 0
2: 2
3: 24
4: 205
903179171_903179183 6 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179183 1:21596974-21596996 TCAGGGGTGATGGAGGCCCAGGG 0: 1
1: 0
2: 6
3: 40
4: 408
903179171_903179180 -4 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179180 1:21596964-21596986 AGAGGGATGCTCAGGGGTGATGG 0: 1
1: 0
2: 3
3: 29
4: 389
903179171_903179186 11 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179186 1:21596979-21597001 GGTGATGGAGGCCCAGGGAGGGG 0: 1
1: 0
2: 7
3: 93
4: 849
903179171_903179184 9 Left 903179171 1:21596945-21596967 CCTTGTTCCCTCTGAGTCCAGAG 0: 1
1: 0
2: 3
3: 36
4: 323
Right 903179184 1:21596977-21596999 GGGGTGATGGAGGCCCAGGGAGG 0: 2
1: 0
2: 5
3: 120
4: 869

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903179171 Original CRISPR CTCTGGACTCAGAGGGAACA AGG (reversed) Intronic
900084076 1:878840-878862 CTCTGGAATCAGATGGAGGAAGG - Intergenic
900103892 1:974119-974141 CTTGGGACTCTGAGGGAGCAGGG + Intronic
900114748 1:1023711-1023733 CTCTAGGGTCAGAGGGCACATGG + Intronic
900266428 1:1759561-1759583 CTCTGGACTATCAGGGAAGACGG + Intronic
900707480 1:4089682-4089704 TTCTGGATCCAGAGGGACCAGGG - Intergenic
901263133 1:7888391-7888413 ACCTGGACTCTGGGGGAACAGGG - Intergenic
901359080 1:8680283-8680305 ACCTGGACTCAGAGGGCAGAAGG - Intronic
901758008 1:11453146-11453168 CTCTGGAGTCAGATGAACCAGGG - Intergenic
901830021 1:11886594-11886616 CTCTGGCCTCAGAGGAAGCTGGG - Intergenic
903082381 1:20820689-20820711 CCCTGGACTCAGCCAGAACAGGG + Intronic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
904305128 1:29583950-29583972 CTCTGAACGCAGTGGAAACAGGG + Intergenic
904675899 1:32199138-32199160 CCCAGGACCCAGAGAGAACAGGG - Intergenic
904980957 1:34501140-34501162 TTCTGAAATCAGAGAGAACACGG - Intergenic
905464732 1:38144327-38144349 CTGTGGCCTCAGAGGGCTCAGGG - Intergenic
905916020 1:41684899-41684921 CTCTGGAATCAGACAGAACCAGG - Intronic
907333149 1:53684391-53684413 CCCAGGAGTCAGAGGGAGCAGGG - Intronic
907454334 1:54565468-54565490 CTCTGGAGTCAGAAGGACCCAGG + Intronic
907619381 1:55961000-55961022 CTTTTGACTCAGAGGGACCTGGG - Intergenic
907746868 1:57222449-57222471 CTCAGGACTCCAAGAGAACAGGG + Intronic
907987883 1:59550824-59550846 CTTTGGAGTCAGACAGAACAAGG + Intronic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908871524 1:68618552-68618574 CTCTGGAATGAGAGGGTAGAAGG - Intergenic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
911578869 1:99612104-99612126 ACCTGAAATCAGAGGGAACAAGG + Intergenic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
915019125 1:152763125-152763147 CTCTGGTTCCAGAGGCAACAGGG - Intronic
917313813 1:173704167-173704189 CTCTAGGCTCAGAGGGTTCAGGG + Intergenic
917504216 1:175613567-175613589 CTCTGGAATCAGAGGGCAGGAGG - Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
919805509 1:201379010-201379032 CACTGGACTCAGAGGCCACAGGG - Intronic
920251874 1:204627413-204627435 CTCTGGAATGAGAGGGGTCAGGG + Intronic
920862825 1:209724445-209724467 CTGTGCACTTACAGGGAACATGG - Intronic
921539771 1:216399247-216399269 CTCTGGTGTCAGTGGGACCAAGG + Intronic
922504816 1:226120438-226120460 CTCTGGACACAGAGGGATGGAGG - Intergenic
924616929 1:245619520-245619542 CTCAGGAGTCAGAGGTTACAGGG + Intronic
1062763170 10:43096-43118 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1062939106 10:1408769-1408791 CTGTGGACTGAGAGAGACCACGG + Intronic
1063298182 10:4826728-4826750 CGCTGGACTCGGCCGGAACAGGG + Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065552198 10:26879201-26879223 CTCTGGAAACAGTGGGAAAAGGG - Intergenic
1068547655 10:58367267-58367289 ATCTGAAATAAGAGGGAACAAGG - Intronic
1070586504 10:77770807-77770829 TTCTGGCCTCAAAGGGAAGAAGG - Intergenic
1070789120 10:79179269-79179291 CTGTGGACTCCTAGAGAACAGGG + Intronic
1070931136 10:80261345-80261367 TTCTGGGGTCAGGGGGAACAAGG - Intergenic
1071601302 10:86959862-86959884 CCCTGGAGTCAGAGGGAGCAGGG + Intronic
1071973777 10:90934531-90934553 CTCTGAACTCTGAGGGAATGCGG + Intergenic
1074866748 10:117548389-117548411 CTCTGGACAGCGAGGGCACAGGG + Exonic
1075096165 10:119472994-119473016 CTCTGGACCCAGAGAGACCTGGG + Intergenic
1075674548 10:124287309-124287331 CCCTGGTCTCAGAAGGAACCAGG + Intergenic
1076182188 10:128418944-128418966 CTCTGGGATCAGAGGGAATGAGG + Intergenic
1078520842 11:12061696-12061718 CTCAGGGTTCAGAGGGAGCATGG + Intergenic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080859151 11:36138167-36138189 CTCTGGATTCAGAGAGATCTGGG + Intronic
1080890722 11:36406872-36406894 TTCTGGATTCAGAGAGACCAGGG + Intronic
1081192352 11:40119489-40119511 CTGTGGACTCTGTGAGAACAGGG + Intronic
1081682797 11:45020297-45020319 TTCTAGAAACAGAGGGAACATGG + Intergenic
1084320195 11:68369284-68369306 CACTGGAGTTAGAGGGAGCAGGG + Intronic
1085499375 11:77005561-77005583 AACTGGTCTCAGAGGGAGCATGG - Intronic
1089302834 11:117508833-117508855 CTCTGGCCTCAATGGAAACATGG - Intronic
1089342225 11:117765833-117765855 CTCTGGCCTCAGAGGGAACTGGG - Intronic
1089857689 11:121561121-121561143 TTCTGGACTAAGTGGTAACATGG - Intronic
1090264393 11:125344876-125344898 TTCAGGACACAGAGTGAACAAGG + Intronic
1091174278 11:133545781-133545803 CTCTGATCTCAGAGTGAAAAGGG + Intergenic
1091641149 12:2238647-2238669 CTCTGGGAGCAGAGGGAACCTGG + Intronic
1095550647 12:43434896-43434918 TTCTGGAGGCAGAGGGAAAAAGG - Intronic
1095790421 12:46161347-46161369 CTCTGGACTCAGACTGACCTTGG - Intergenic
1100339425 12:93664185-93664207 CTCAGGGCTCCAAGGGAACAAGG - Intergenic
1101724372 12:107376909-107376931 CTCTGGACTCAGACGGGCCTGGG - Intronic
1101741125 12:107500816-107500838 ATCTGGGCACAGAGTGAACAAGG - Intronic
1102797977 12:115705883-115705905 CTCTGGAGTTAGATGGAACTGGG - Intergenic
1102817040 12:115874926-115874948 CTCTGGACTCTAAAGGAAGATGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103190741 12:118999756-118999778 CTCTGGAATCAGATGGGACTGGG - Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1107401037 13:40069328-40069350 CTCTGGACACTGAGGGGTCATGG + Intergenic
1107423123 13:40268230-40268252 CTTTGGACTCAGACAGACCAAGG - Intergenic
1109336155 13:60997210-60997232 CCCTGGACCCAGAGAGCACAAGG - Intergenic
1109962185 13:69645198-69645220 CTCTGGATGGATAGGGAACATGG + Intergenic
1110473658 13:75888440-75888462 CTCTGGAATCAGAGAGACCAGGG - Intergenic
1112117712 13:96375159-96375181 GTCTGGAGTGAGAAGGAACAAGG - Intronic
1112153488 13:96791435-96791457 ATCTGGGCTCAGAGGGACCAGGG - Intronic
1113311544 13:109138119-109138141 CTTTGGAATCAGAGGGATCTGGG - Intronic
1113375009 13:109757019-109757041 CGCTGTGCTCAGAGGGGACAGGG + Intronic
1114370130 14:22077342-22077364 CACTGGAATCTGAGGGAAGAAGG + Intergenic
1114584892 14:23802168-23802190 CTCTAGACTAAGCAGGAACAGGG + Intergenic
1114715345 14:24818420-24818442 CTCTGGATTCAGGGGCAGCAGGG + Intronic
1114798152 14:25740116-25740138 CTATGGCTTCAGAGGGTACAAGG - Intergenic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115495306 14:33998329-33998351 CTCAGGCATTAGAGGGAACAAGG + Intronic
1115962760 14:38854112-38854134 CTCATGCCTCAGAGGCAACAGGG - Intergenic
1117896083 14:60488414-60488436 CACTGGAGTGAGAGGGAATAGGG - Intronic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1121255947 14:92530665-92530687 CTCTGGACTCAGAGAAACCTGGG - Intronic
1121684638 14:95826422-95826444 CTCTGGACTCCGAGAGATCCAGG + Intergenic
1121947264 14:98135555-98135577 GTCAGGACTCAGAGGGATTAGGG + Intergenic
1124700134 15:31905404-31905426 CTCTGCGGCCAGAGGGAACATGG - Intergenic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1125211965 15:37227271-37227293 CTCTGGTCTCATGGGGAAGAGGG - Intergenic
1125884248 15:43216519-43216541 TTCTGGAGTCAGAGAGACCAGGG + Intronic
1127613677 15:60661830-60661852 TTCTGGTCCCAGAGGGAACAGGG + Intronic
1127846331 15:62874809-62874831 CTCTGGAGGCAGAGAGAGCAGGG - Intergenic
1128099347 15:64985702-64985724 CTCTGGACTGGCAAGGAACAGGG + Intronic
1128378417 15:67093643-67093665 CTCTGGACTCTGAGGCAAAGTGG - Intronic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1129274350 15:74435243-74435265 CTCAGGACTCTGAGGGAAGAAGG - Intergenic
1130087477 15:80789955-80789977 CTCTGAGCTCAGGGGGAACGAGG + Intronic
1132687976 16:1170226-1170248 CTCTGCACTGAGTGGGAACAGGG - Intronic
1133403280 16:5504237-5504259 CTCTGGGCTCTCAGGGATCAGGG - Intergenic
1135252000 16:20908112-20908134 CATTGGAGTCAGAGGGGACAGGG + Intronic
1136671648 16:31863963-31863985 TTGTGGACTCTGATGGAACATGG + Intergenic
1138120593 16:54398033-54398055 CTTTGGATCCAGTGGGAACAGGG + Intergenic
1138183662 16:54960458-54960480 GCCTGGACTCAAAGAGAACAAGG - Intergenic
1139274683 16:65716596-65716618 CTAAAGACTCAGTGGGAACAAGG + Intergenic
1139350757 16:66333838-66333860 CTCTGAACTGTGAGAGAACAGGG + Intergenic
1139642328 16:68301217-68301239 CTCTGGACTCAGAGCCCTCAAGG + Exonic
1139917464 16:70437583-70437605 CTCAGGATTTAGAGGGAACGAGG - Intronic
1140896695 16:79331027-79331049 CTCTGGGCTCAGATGGGAAATGG + Intergenic
1140947548 16:79784061-79784083 CTTTGGACCCAGAGGGACCAGGG - Intergenic
1141673933 16:85507627-85507649 ACCTGCACCCAGAGGGAACACGG - Intergenic
1142030906 16:87838053-87838075 CTCTGGCCACAGTGGGAACCAGG + Intronic
1142621018 17:1165873-1165895 CCCTGGACTCAGAGAGACCATGG - Intronic
1144719781 17:17461054-17461076 TTCTGGACTCAGTGGGAATGTGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147238134 17:39072534-39072556 ATCTGGACTCAGAGTGACAAAGG - Intronic
1147324173 17:39662540-39662562 CTCAGGACTCAGAGGTAAGAAGG - Intronic
1147869215 17:43575758-43575780 CTCATGACTCAGAGGAACCAGGG - Intronic
1148846756 17:50534182-50534204 CTCTGGAGTTTGAGGGGACAAGG - Intronic
1148855432 17:50576400-50576422 GTCTGGAGTCAGAGGGACCAGGG + Intronic
1149537109 17:57441495-57441517 CTCTGCACTCAGCTGGAACTGGG + Intronic
1150814027 17:68378588-68378610 CTGTGGACTCAGAGACAGCAGGG - Intronic
1151376264 17:73691047-73691069 CTCCGGCCTCAGAGAGGACATGG + Intergenic
1152956079 18:43427-43449 CTCTGGAATCAGATGGAGGAAGG + Intergenic
1153063558 18:1019397-1019419 CTGTGGCCTCAGAGGAAATATGG + Intergenic
1153486825 18:5607227-5607249 CTCTGGAGTCAGATAGAAGATGG + Intronic
1153931364 18:9882497-9882519 CTCTGGGCTCAGAGGGAGTTGGG + Intergenic
1154383112 18:13870139-13870161 CCCTGCACTCAGTGGGCACAAGG + Intergenic
1155162736 18:23208782-23208804 CCTGGGGCTCAGAGGGAACATGG - Intronic
1155238893 18:23847096-23847118 CTCTGGACGCACAGGGTACTGGG + Intronic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1157505056 18:48220165-48220187 CTCTGCCTTCAGAGGGAACTGGG - Intronic
1157883789 18:51346736-51346758 CTCTGGACTCAGAGTCAAAGCGG + Intergenic
1159440244 18:68469425-68469447 CTATGGAAGCAAAGGGAACAGGG + Intergenic
1161002601 19:1918306-1918328 GTCTGCACCCAGAGGGAACCAGG + Intronic
1161873269 19:6887002-6887024 CTCTGGAATCAGAGGGTCCTGGG + Intergenic
1162087926 19:8259706-8259728 CTGTGGCCTCAGAGGAGACATGG + Intronic
1164596303 19:29532675-29532697 CTCTGACCTCAGAGGGAGCTTGG + Intronic
1164812868 19:31171847-31171869 CTCTGGCCTCTGAGGGGAAAGGG - Intergenic
1165064279 19:33219983-33220005 CTCAGGTCTCAGAGGAAAGATGG - Intronic
1165318045 19:35068645-35068667 CTGGGGACTCTGAGAGAACATGG + Intergenic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166189636 19:41167498-41167520 CTCTGGATTCAGAGAGACCCAGG + Intergenic
1167435369 19:49475720-49475742 CTCGGGACTCAGTGGGACCCAGG + Exonic
1168121415 19:54254327-54254349 CTCTGGGCTCGGAGGGAGCGTGG - Intronic
1168121847 19:54256143-54256165 CACGGGACCCACAGGGAACAGGG + Exonic
1168132954 19:54332479-54332501 CTCTGGGCTCAGAGGGAGGGTGG - Intergenic
1168238640 19:55078599-55078621 CTCCTGAGTCAGAGGGAAGAGGG + Intronic
925285297 2:2711856-2711878 CTCTGGAATCAGAAGGAATCAGG + Intergenic
925568450 2:5282951-5282973 CTCTGGCCTCAGATGGGGCATGG + Intergenic
925773042 2:7302231-7302253 CTCTGGACTCAGACAGAATGAGG - Intergenic
925923483 2:8653920-8653942 TTCTGGACTCAGAGGCAAGCAGG - Intergenic
926953647 2:18271439-18271461 CCCTGGGCTCAGCGGGAGCAGGG - Intronic
927423130 2:22953741-22953763 CTCTGGAGTCAGAGAGACCATGG + Intergenic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930350078 2:50240641-50240663 CTCTAGACTCAGAGAGATCTGGG + Intronic
933252065 2:80039577-80039599 CACTGGAGTCAGACGGAAGATGG - Intronic
933648467 2:84830787-84830809 CTCTGGGGTGAGGGGGAACAGGG + Intronic
933769285 2:85733069-85733091 CTCTGAGCCCAGAGGGAGCAGGG - Intergenic
935627224 2:105181215-105181237 GTCATGACTCAGAGGGAAGATGG + Intergenic
935927328 2:108083718-108083740 CTCCAGACCCAGAGAGAACATGG + Intergenic
936273452 2:111070025-111070047 CTCAGGACTCAGAAGCAGCAGGG + Intronic
937235617 2:120430361-120430383 CTCTGGAGTCAGACAGACCAAGG - Intergenic
938571146 2:132563082-132563104 CCCTGGAATCAGAGTGGACATGG - Intronic
941585241 2:167350570-167350592 CGCTGGATGCAGAGGGAACAGGG - Intergenic
942295000 2:174508364-174508386 CTCTGGACCCACCGGGAACAAGG + Intergenic
944540046 2:200746023-200746045 CACAGCACTCAGAGGGAACCAGG - Intergenic
946345460 2:219106543-219106565 CCTTGGACTCAGAGAAAACAAGG + Intronic
948987856 2:241536336-241536358 CTCAGATCCCAGAGGGAACAGGG + Intergenic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1168884470 20:1237321-1237343 CTCTGGAGTCAGAGAGAGCTGGG + Intronic
1169142909 20:3236170-3236192 CTCAGGACACTGGGGGAACAGGG - Intronic
1170001702 20:11621790-11621812 CTCTGGGGTCAGGGGGAAAATGG - Intergenic
1170100654 20:12695914-12695936 CTCTAGACTCAGAGGGACTTGGG - Intergenic
1171099297 20:22367702-22367724 GTCTGGAAACAGAGGGCACATGG - Intergenic
1171190328 20:23154432-23154454 CTCTGGACTCAGCTCTAACAAGG + Intergenic
1172484516 20:35290373-35290395 CTCTGGAGTCAGAAAGAACTGGG + Intronic
1172884273 20:38220998-38221020 CTCTGCCTTCAGAGGGAAAATGG + Intronic
1173062880 20:39679091-39679113 CTCTGGAGTCAGACTGAACCAGG + Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173842619 20:46168045-46168067 CCATGCACCCAGAGGGAACATGG + Intergenic
1174437202 20:50517693-50517715 ATATGGACTCAGAGTAAACATGG + Intronic
1175984266 20:62756097-62756119 CCCTGCACTCTGGGGGAACAGGG + Intronic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1178701713 21:34839454-34839476 CTGTGAACTCAAAGCGAACAGGG + Intronic
1179567216 21:42256691-42256713 CTCTGCATTCAGAGGGATCTGGG + Intronic
1180988289 22:19918405-19918427 CTTTGGACTCACAGAAAACAGGG + Intronic
1181116777 22:20636469-20636491 CTCTGTCCTCAGAGTGGACATGG - Intergenic
1181675533 22:24449117-24449139 CTCTGTACTTCGAGGGCACAAGG + Intergenic
1181805226 22:25370544-25370566 CCCTGGAGTTAGAGGGAGCAGGG - Intronic
1181986882 22:26806146-26806168 CTCTGAAATCACAGGGAACTAGG - Intergenic
1182002125 22:26928093-26928115 CCCTGGACTCACAGGGAGCCTGG - Intergenic
1182447660 22:30398797-30398819 CTCTGGACTCAGACAGACCCGGG + Intronic
1182550683 22:31099281-31099303 GTGTGGCCTCACAGGGAACATGG + Intronic
1182717015 22:32364935-32364957 ATCTGGAGTCAGAGGGAAAGGGG - Intronic
1182792664 22:32966084-32966106 CTCTGGGCTCATTGGGAACAGGG - Intronic
1183058912 22:35323480-35323502 CCCAGGACTGAGAGGGGACAAGG - Exonic
1183405467 22:37628449-37628471 GTCTGGACTCAGACAGAGCATGG - Intronic
1183420429 22:37708792-37708814 CTCTGGCCTCAGATGGACCTCGG - Intronic
1185128662 22:49025458-49025480 CTCTGGAGTCACACGAAACAAGG + Intergenic
949373364 3:3359933-3359955 CTCTAGACTCAGAGAGACCTGGG + Intergenic
949435214 3:4021769-4021791 CTCTGGAGTCAGAGAGACCTAGG + Intronic
950128921 3:10528370-10528392 CTCTGGACTAAGGGGAAAAAAGG + Intronic
950810831 3:15648371-15648393 CTCTGGCCTGAGAAGGAACATGG - Intergenic
951423085 3:22510652-22510674 CCCTGGGCTAAAAGGGAACATGG + Intergenic
953947931 3:47164584-47164606 CTCTGGGCTCTGAGGTAACGCGG + Intergenic
954133222 3:48570464-48570486 CTCTGGACTCAAAGGAGACAAGG - Exonic
955267278 3:57457336-57457358 CCCTGGAATCAGAGAGAACTGGG - Intronic
955503489 3:59607828-59607850 CTTTGGAATCAGAGTGAACTTGG + Intergenic
955672654 3:61418214-61418236 CTTTGGAGTCAGAGAGATCAGGG - Intergenic
956276456 3:67506946-67506968 CGCTGGACTCAGAGGGACATGGG + Intronic
957071041 3:75568107-75568129 GTCTGGGCTCAGAGTGAACAGGG + Intergenic
958515834 3:95114252-95114274 CTCTGGAGACAGAGAGCACAGGG - Intergenic
961469922 3:127105226-127105248 GTCTGGACTCTGAGGGATGAAGG + Intergenic
962291824 3:134144037-134144059 CTCTGGACCCAGAGGTCACAGGG - Intronic
962714073 3:138112259-138112281 CTCTGGAGTCAGATAGAACTTGG - Intronic
963706845 3:148698316-148698338 TTCTGGAATGGGAGGGAACAAGG + Intronic
965541554 3:169876929-169876951 GTCTGCACTCAGCGGTAACAAGG - Intergenic
967037250 3:185657206-185657228 CCTGGGACTGAGAGGGAACAAGG + Intronic
968939262 4:3629637-3629659 CTCTGGACTCAGAGGGAGCCAGG - Intergenic
969014640 4:4095805-4095827 GTCTGGGCTCAGAGTGAACAGGG + Intergenic
969664344 4:8548468-8548490 CTATGGGTGCAGAGGGAACAAGG + Intergenic
969739300 4:9012636-9012658 GTCTGGGCTCAGAGTGAACAGGG - Intergenic
969798481 4:9544149-9544171 GTCTGGGCTCAGAGTAAACAGGG - Intergenic
969859211 4:10022518-10022540 CTCTGGCGTCTGAGGCAACATGG - Intronic
971213942 4:24646372-24646394 CTCTGGAGTGAGAGGGAGCCTGG + Intergenic
975591655 4:76006515-76006537 CTTTGGACTCAGAGAGATCTGGG - Intronic
977698795 4:99997489-99997511 CTCAGGACTCAGAGACAATAAGG + Intergenic
977942578 4:102874929-102874951 CTCTGGTATCAGATGGAAGATGG - Intronic
978750007 4:112235695-112235717 CTCTGAATTCAGAGGGACCTGGG - Intronic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
984671598 4:182495371-182495393 TTCAGGACTCACAGGGAAAATGG + Intronic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
985440186 4:189978252-189978274 CTCTGGAATCAGATGGAGGAAGG + Intergenic
985603033 5:844675-844697 CTCTGCACCCAAAGGGAACTCGG + Intronic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986352484 5:6893483-6893505 CTCTGGAGTCAGATAGAACTGGG + Intergenic
987549862 5:19365598-19365620 TTCTGGACTCAGAGGCCAAAGGG - Intergenic
988731466 5:33976887-33976909 AGCTGGACTCAGCGGCAACAAGG + Intronic
988913512 5:35869800-35869822 CCCTGGACTTAGAGGGAAGCAGG - Intronic
989379518 5:40799012-40799034 CACTGGACTGAGAGAGAACAAGG + Intergenic
994343982 5:98663646-98663668 CTCTGGACCCACAGGGGCCATGG + Intergenic
997301384 5:132808296-132808318 CTCTGGCCTCACTGGCAACAGGG + Intergenic
997485764 5:134229261-134229283 CTCTGGAGTCAGATGGAACTGGG + Intergenic
997637968 5:135428680-135428702 CTCTGGACTCAAATGAAAAATGG + Intergenic
997689258 5:135814621-135814643 CTCCGGAGTCAGAGGGACCTGGG + Intergenic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
997997083 5:138595654-138595676 CTCTGCAGCCAGAGGGGACAGGG + Intergenic
998042643 5:138962366-138962388 CTCTGGAGTCAGAGAGACCTAGG + Intronic
998251924 5:140559165-140559187 CTCTGCAATCAGAGAGAACTAGG - Intronic
999333262 5:150692865-150692887 CTCTGGGCTAAGAAGGAAGATGG + Intronic
999390434 5:151185792-151185814 TTCTGGATTCAGAGAGAACTAGG - Intronic
999983051 5:156976248-156976270 CTCTGGACTGAGAGAGAAACAGG - Intergenic
1001111971 5:168904093-168904115 CGCTGGACACAGGGGCAACAGGG - Intronic
1001277350 5:170360306-170360328 CTCTGGACCCAGAGGGACCTGGG + Intronic
1001905147 5:175465907-175465929 CTATGCCCTCAGAGAGAACAAGG - Intergenic
1002062918 5:176637067-176637089 CTCAGAAGTCAGAGGGAGCAGGG - Intronic
1002818625 6:701653-701675 CTCTTTATTCAGTGGGAACAAGG + Intergenic
1003235759 6:4294237-4294259 CCCAGGACCCAGGGGGAACAGGG - Intergenic
1006067508 6:31472686-31472708 CTCTGCACTAGGAGGGAAGATGG - Intergenic
1006239569 6:32665357-32665379 CTCTGCACTTAGAGGGATCAGGG + Intronic
1007291138 6:40787753-40787775 CTTTGGAGTCAGACAGAACAGGG + Intergenic
1008057692 6:46962231-46962253 CACTGGTCACAGAGAGAACAGGG - Intergenic
1009294120 6:61922581-61922603 CACTGCACTCACAGGGAACCAGG + Intronic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1009789737 6:68386195-68386217 CTCTGGGAGCAGAGGGAACTAGG - Intergenic
1013779807 6:113716827-113716849 GTCTGGAGTCACAGGGCACATGG + Intergenic
1013894783 6:115073644-115073666 CTCTGGAGTCAGTTGGAAGATGG + Intergenic
1014081638 6:117293189-117293211 CTCTGGACTCCCACAGAACATGG + Intronic
1014103108 6:117533360-117533382 CTCTTGCATCAGAAGGAACATGG + Intronic
1015865606 6:137723536-137723558 CTCTGGACTCAGACAGACCTGGG + Intergenic
1016912569 6:149213719-149213741 GGCTGGAGTCAGAGTGAACAAGG - Intergenic
1017084822 6:150704335-150704357 CTCTGAACTCAGAGACAAAAGGG + Intronic
1018736651 6:166691571-166691593 CCCTGGACTCTGAGGGAGGAGGG - Intronic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1018947243 6:168356447-168356469 GTCTGGACTCAGGGAGACCAGGG + Intergenic
1019220517 6:170469320-170469342 CTCTGGCCTCAGGGGGCCCACGG + Intergenic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1019896918 7:3989959-3989981 CTCTGGAGTCAGACAGCACAGGG - Intronic
1020188493 7:5976365-5976387 CTCGGGACACAGAGGTAACAAGG - Intronic
1020294422 7:6748405-6748427 CTCGGGACACAGAGGTAACAAGG + Intergenic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1022741210 7:33123265-33123287 CAGTGGACTCAGGGGGCACATGG - Intergenic
1023682029 7:42696968-42696990 CTCTGAAACCAGAGGGAGCATGG + Intergenic
1023861631 7:44220498-44220520 CCCTGGGCACAGAGGGGACAGGG + Intronic
1024969039 7:55052007-55052029 TTCTGGACTCAGTGGGCACATGG - Intronic
1026732848 7:72926089-72926111 CTCTGGCCTTAGATGGAATAAGG + Intronic
1028736022 7:94213336-94213358 CTCTGAGCTCAGAGGAAACATGG - Intergenic
1028933999 7:96445336-96445358 TTCTGAACTCAGGGGGAAGAAGG + Intergenic
1029805927 7:102996108-102996130 CTCAGGACTCAGGGAGAACTGGG - Intronic
1033305530 7:140222827-140222849 CCCTGTTCGCAGAGGGAACACGG + Intergenic
1034426193 7:151015486-151015508 GTCTGCACCCAGAGGGAATAAGG - Intronic
1035706031 8:1675581-1675603 CTCTTGCCTCACAGGGGACAGGG + Intronic
1036085193 8:5605972-5605994 CTCTGCACTGAGAGTGAAAAGGG - Intergenic
1036165498 8:6429243-6429265 CTCTGGACTCAAAGGACACCAGG - Intronic
1036256372 8:7209883-7209905 GTCTGGGCTCAGAGTAAACAGGG + Intergenic
1036308422 8:7668468-7668490 GTCTGGGCTCAGAGTAAACAGGG + Intergenic
1036361114 8:8077609-8077631 GTCTGGGCTCAGAGTAAACAGGG - Intergenic
1036415568 8:8544602-8544624 CACTGGAATCAGAAGGAACAGGG - Intergenic
1036889855 8:12589392-12589414 GTCTGGGCTCAGAGTAAACAGGG + Intergenic
1038022612 8:23562823-23562845 CTTTGGAATCAGAGAGAACTGGG - Intronic
1043127788 8:76421546-76421568 CTCTGGAGACAGAGGGGACCAGG + Intergenic
1044050926 8:87502911-87502933 TTCTGAACTGAGAGGGAGCAGGG - Intronic
1044273393 8:90272841-90272863 CTCTGAAGTCAGATGGCACAAGG - Intergenic
1045379116 8:101605350-101605372 CTCTGGACTCATAGGGCCCTGGG - Intronic
1048210401 8:132449939-132449961 CTCTGGACACAGTGGGAAGAGGG - Intronic
1048237213 8:132702810-132702832 CTCTGGAGTCAGAGGAGACCTGG - Intronic
1048289554 8:133170132-133170154 CTTTGGACTCAGACAGAACTGGG + Intergenic
1049130198 8:140832680-140832702 CTGTGGACAAAGAGGCAACAGGG + Intronic
1049913863 9:297317-297339 CTCTAGAGTCAGAAGGAACTGGG - Intronic
1050099326 9:2101332-2101354 CTCTAGACTCTCAGGTAACAGGG - Intronic
1050514716 9:6430790-6430812 GTCAGGAGGCAGAGGGAACAGGG - Intronic
1053445981 9:38153576-38153598 CTCAGGGCTCAGAGGCCACACGG - Intergenic
1053785583 9:41650452-41650474 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054174302 9:61864418-61864440 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054449160 9:65393463-65393485 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054451492 9:65405684-65405706 CTCTGGACTCAGAGGGAGCCAGG + Intergenic
1054663236 9:67716373-67716395 CTCTGTACCCAGAGGGAATTAGG - Intergenic
1056551555 9:87657330-87657352 CCTTGGACTCAGAGTGGACACGG + Intronic
1057040231 9:91842691-91842713 CTCTGGAATCAGAGGGCAGCAGG + Intronic
1058824350 9:108761464-108761486 CTCTGGACTGGAAGGGAACATGG + Intergenic
1058926284 9:109667155-109667177 CTCTGGAATCAGAGGGAGAGTGG + Intronic
1059458092 9:114412384-114412406 CTCTGGCCTCAGTGGGTACAGGG - Intronic
1059974701 9:119702947-119702969 CTCTGGAGTCAGAGAGAACTGGG - Intergenic
1060040551 9:120296500-120296522 CTCTGGAGTCAGACAGATCAGGG + Intergenic
1060276412 9:122186324-122186346 CTCTGGTGTCAGAGGGACCTGGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060723084 9:125990956-125990978 GTGTGGTCTCAGAGGGGACAGGG - Intergenic
1060858029 9:126931072-126931094 CTTTGGACTTAGAAGGAACCTGG - Intronic
1061010964 9:127954429-127954451 CTCTGGAGTCAGGAGGAACCAGG - Intronic
1061414327 9:130438224-130438246 CTCTGGAGTCAGATGGACCTGGG - Intergenic
1061681469 9:132244599-132244621 CTCTGGCCTTAGAGGGCTCAGGG - Intergenic
1061848070 9:133399326-133399348 CTCGGGCCTCAGAGGTGACAAGG + Intronic
1062043991 9:134416830-134416852 CTATGGACTCAGGGAGAACCAGG - Intronic
1062430555 9:136525229-136525251 GTCTGGGCTCAGAGAGAACAAGG + Intronic
1062604930 9:137342385-137342407 CCCAGGAGTCAGAGGAAACAGGG + Intronic
1186149184 X:6656134-6656156 CTCTGGAGGCATAGGGAATAGGG - Intergenic
1186499432 X:10039267-10039289 CTATGGACCCAGAAGCAACAAGG - Intronic
1187255515 X:17638252-17638274 CCCTGCATTCAGAGGGAGCAAGG + Intronic
1187399861 X:18950132-18950154 CTCTGGCTTCAATGGGAACAAGG + Intronic
1188424234 X:30028065-30028087 CGCTGGACACAGAGTGATCAGGG + Intergenic
1189294032 X:39906145-39906167 CACATGACTCAGAGGGGACATGG + Intergenic
1190522644 X:51295922-51295944 ATCTGGACTCAGACAGACCAGGG + Intergenic
1190525876 X:51329100-51329122 ATCTGGACTCAGACAGACCAGGG + Intergenic
1192996401 X:76517234-76517256 CTCTTGACTTAGAGGTAAGAGGG - Intergenic
1193738147 X:85185425-85185447 CTCTGGACCCACAGGGGCCAGGG - Intergenic
1197779114 X:130142008-130142030 CTTTGGAGTCAGAGAGAATAGGG + Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1199222585 X:145334503-145334525 CTCTGCACCCAGAGTGAACCTGG - Intergenic
1200472529 Y:3602975-3602997 ATCTAGGCTCTGAGGGAACAGGG + Intergenic
1201730254 Y:17194220-17194242 CTCAGAATTCAGAGGGAGCAAGG + Intergenic