ID: 903179491

View in Genome Browser
Species Human (GRCh38)
Location 1:21598088-21598110
Sequence CCACCTCACTGGCCGCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903179485_903179491 1 Left 903179485 1:21598064-21598086 CCTGGGGAGGGGGGCAGGAGGGA 0: 1
1: 1
2: 20
3: 217
4: 1457
Right 903179491 1:21598088-21598110 CCACCTCACTGGCCGCGGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903179491 Original CRISPR CCACCTCACTGGCCGCGGGG AGG Intronic
900176091 1:1292061-1292083 TCAGCTCACCGGGCGCGGGGCGG - Intergenic
900247330 1:1642970-1642992 CCACCTCACTCCCCGCTGGCAGG + Intronic
900258554 1:1710102-1710124 CCACCTCACTCCCCGCTGGCAGG + Intronic
900305351 1:2003980-2004002 CCAGGCCACAGGCCGCGGGGCGG + Intergenic
901014980 1:6223748-6223770 GCTCCTCACAGGCCGCGTGGTGG + Exonic
901065119 1:6490701-6490723 CCACCTCCCTGGCTCCGGCGCGG - Intronic
901361328 1:8703289-8703311 CCGCCTCCCTAGCCGCGGGCGGG - Intronic
901475938 1:9489293-9489315 CCACCTCCCTGGCCGAATGGCGG + Intergenic
901725703 1:11240351-11240373 CCACATCGCTGGCCTCAGGGAGG + Exonic
903031321 1:20466249-20466271 GCACCTCACCGGCCATGGGGTGG - Intergenic
903179491 1:21598088-21598110 CCACCTCACTGGCCGCGGGGAGG + Intronic
904024991 1:27497112-27497134 CCCCCACACTGGGAGCGGGGAGG - Intergenic
904276324 1:29386988-29387010 CCACCTCACATGCAGCGGGAAGG + Intergenic
910610117 1:89132608-89132630 CCATCTCACTGGAGGTGGGGAGG + Intronic
913254609 1:116942327-116942349 CCACCTCACTGGGCATAGGGTGG - Intronic
920747570 1:208643473-208643495 CCACCTCACTGGCTGCCAAGAGG - Intergenic
922570372 1:226631194-226631216 CCTCCTAACTGGCAGTGGGGGGG - Intergenic
1067849822 10:49747371-49747393 CCTCCTCACTGGCCTGAGGGAGG + Intronic
1067935926 10:50612009-50612031 CCACCCCACTGGCAGGGGGCTGG - Intronic
1068135657 10:52949631-52949653 CCACGTCACTGCCTCCGGGGAGG - Intergenic
1069564117 10:69451745-69451767 CCCCCTCACTGGCCCGGGGTTGG + Intronic
1072990289 10:100186089-100186111 CCGTCTCACTAGCCGCGGGCCGG - Exonic
1075672105 10:124269896-124269918 CCACCTCACTGCCCGCTGTGGGG + Intergenic
1077385564 11:2268044-2268066 CCACCTCAACGGCCTCTGGGAGG - Intergenic
1090411299 11:126511729-126511751 TCACCCCACTGGCTGCCGGGGGG + Intronic
1091571643 12:1691532-1691554 CCAGCTCCCTGCCCGCGGAGAGG + Intronic
1092053872 12:5493010-5493032 CCACCTCACTGGCTCCCAGGGGG - Intronic
1096377416 12:51124682-51124704 CCAACTCACTGGCCACCGCGGGG - Intronic
1096493330 12:52024903-52024925 CCACTTCACAGGCAGCGGTGAGG + Intronic
1098541546 12:71663420-71663442 CCTCCTCACTCGGCCCGGGGCGG - Exonic
1100293385 12:93237831-93237853 CCAGCTCACTGGCCTCATGGGGG + Intergenic
1102961966 12:117099046-117099068 CCACCTCGCGGGCTGCGGCGAGG - Intronic
1103239722 12:119403248-119403270 CCACCTCCCTGGCTGCAGGGAGG - Intronic
1103595911 12:122024066-122024088 CCACCCCGCGGGCCCCGGGGCGG + Intronic
1104391769 12:128397111-128397133 CAGCCTCACTGGCCCCAGGGTGG + Intronic
1112019486 13:95359388-95359410 CCACCACACTGGCAGGGGAGAGG - Intergenic
1112374357 13:98825048-98825070 CCACCCCAGAGGCCCCGGGGTGG + Intronic
1113310530 13:109127519-109127541 CCGCTTCCCTGGCCGCGGAGAGG - Exonic
1113425644 13:110206237-110206259 CCAGCTGACTGGCAGTGGGGTGG + Intronic
1118289034 14:64503901-64503923 CCGCCTCAGTGGCCGGGCGGGGG + Intronic
1118955632 14:70477787-70477809 CCACCTCCCTCCCGGCGGGGCGG - Intergenic
1120768178 14:88350778-88350800 CCACCTATCTGGCTGAGGGGAGG + Intergenic
1122375022 14:101251707-101251729 CCACCCCACTGGCCTTGGGCCGG + Intergenic
1122389071 14:101368017-101368039 CCATCACACTGGACGCGGGGCGG + Intergenic
1124623903 15:31297380-31297402 CCACATCACTGGCAGGGAGGAGG + Intergenic
1124640230 15:31392347-31392369 CCACCTCTTTGGCCGCGGGCTGG + Intronic
1126048098 15:44663285-44663307 CCACCTCTATGGCTGCAGGGAGG + Intronic
1129014202 15:72451347-72451369 CCACCTCACTGGCCACTGTGGGG + Intergenic
1129220885 15:74131079-74131101 CCACCTCTCTGGCTGCAGGTTGG - Intronic
1130416028 15:83695474-83695496 CCACCTCACTGACCTAGGAGGGG + Intronic
1131536901 15:93245212-93245234 CCCCCACACTGCCTGCGGGGTGG + Intergenic
1133292739 16:4733887-4733909 GTAGCTCACTGGCCCCGGGGCGG + Intronic
1133463808 16:6010330-6010352 CCAGCTCCCTTGCCCCGGGGTGG + Intergenic
1134313267 16:13095450-13095472 CCACCTCACTGGGCTAGGGAAGG + Intronic
1144736923 17:17560554-17560576 TCACCACACCGGCCCCGGGGAGG + Intronic
1145231658 17:21177622-21177644 CAACCTCACTGGCTGGGGAGGGG - Intronic
1148391390 17:47275636-47275658 CAACCTCCCTGGCCGCCTGGGGG + Intronic
1149772666 17:59333049-59333071 CCGCCTCACTGGCTCTGGGGTGG + Intronic
1151473683 17:74333104-74333126 CCACCTCACTGCCCCCAGGCAGG - Intronic
1151542324 17:74770897-74770919 GCACCTGACTGGCCACGCGGGGG - Exonic
1151780163 17:76240310-76240332 CCCCCGCACCGGGCGCGGGGCGG - Exonic
1152568339 17:81110190-81110212 CCACGTCCCAGGCCACGGGGAGG - Intronic
1152614040 17:81329781-81329803 CCCCCACACAGGCCTCGGGGAGG + Intronic
1152790943 17:82279175-82279197 ACACCTCTCTGGCTGCGGTGGGG - Intergenic
1159511234 18:69400779-69400801 CCACCCCACGGGCCAGGGGGAGG + Intergenic
1160498048 18:79386627-79386649 ACACCTCCCTGGCCTCGGGTGGG + Intergenic
1161275264 19:3412810-3412832 CCACCTCAGTGGCCCCAGGTGGG + Intronic
1161729050 19:5947733-5947755 CCACGTCCCTGCCGGCGGGGTGG + Intronic
1163851902 19:19669039-19669061 CCCCCACAGTCGCCGCGGGGAGG - Intronic
1166733109 19:45069625-45069647 CCACCTCACAGGCTGTTGGGAGG + Intronic
925407476 2:3615732-3615754 CCACCGCCCTGTCCGCGAGGTGG - Intronic
937920798 2:127128695-127128717 CCTCCACACTGGCAGCAGGGTGG - Intergenic
937955452 2:127419644-127419666 CCACCCCACTGTCCCCAGGGAGG + Intronic
938766383 2:134462932-134462954 CCACCTCACTGACCGCAGTTGGG - Intronic
940485010 2:154287283-154287305 CCAACTCACTGGCCATGGCGGGG + Intronic
1174206722 20:48845792-48845814 CCACCTCACTGGCCTCCTCGCGG - Intergenic
1174814860 20:53677887-53677909 CCACCTGCCTGGCCCCGGGAAGG + Intergenic
1175272747 20:57746426-57746448 CCACCTCACAGGCTGCTGCGGGG + Intergenic
1175994717 20:62806964-62806986 ACGCCTCACTGGCCACGGTGAGG - Intronic
1176247079 20:64102433-64102455 CCTCCCGGCTGGCCGCGGGGCGG + Intergenic
1179393044 21:41011228-41011250 CCTCCTCAGTGGTCACGGGGTGG - Intergenic
1180053179 21:45342988-45343010 CCACTTCACTGACCGCTGTGTGG - Intergenic
1180053205 21:45343116-45343138 CCACTTCACTGACCGCTGTGTGG - Intergenic
1180136224 21:45863591-45863613 CCACCCCATTGGCCTCGGGCGGG - Intronic
1180558166 22:16593951-16593973 CTACCTCCCTGACCGCTGGGAGG - Intergenic
1182092931 22:27608396-27608418 CCAGCTCACTTGCCCCGGGGTGG - Intergenic
1182353345 22:29711008-29711030 CCACCTCCCTGACCGAGGGCAGG - Intergenic
1183700244 22:39447005-39447027 CCACATCACTGACCACGGGCTGG - Intergenic
1183788270 22:40044730-40044752 CCACTCCATTGGCCGCAGGGAGG - Intergenic
1184286832 22:43476742-43476764 GGACCTCACTGGCTGCAGGGAGG - Intronic
1184287061 22:43477736-43477758 GGACCTCACTGGCTGCAGGGAGG - Intronic
1185057204 22:48587279-48587301 TCATCTCACGGGCCTCGGGGTGG + Intronic
1185095427 22:48803709-48803731 CCAGCACACTGGCCGCTGGCCGG + Intronic
1185229905 22:49673870-49673892 TCACTTCACTGGCCGAGGGGAGG - Intergenic
950386413 3:12663873-12663895 CTCCCTCACCCGCCGCGGGGAGG - Exonic
950754674 3:15162768-15162790 CCACCTCCCTGCCCGGGCGGGGG + Intergenic
950788840 3:15456364-15456386 CCACCCCACTGGGCCTGGGGAGG - Intronic
954660762 3:52225692-52225714 CCTCCTCACTGGGGGCAGGGTGG - Exonic
956637688 3:71382475-71382497 CCATCTCCCTGGCCACAGGGAGG + Intronic
960592814 3:119381698-119381720 CCACCACACAGGCCGCCTGGAGG - Intronic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968457168 4:705740-705762 CCACGCCCCTTGCCGCGGGGTGG + Intronic
968850209 4:3073710-3073732 CCAGCTCACTGGGGGTGGGGTGG + Intergenic
969716827 4:8871867-8871889 CGGCCTCACTGGGGGCGGGGAGG + Intergenic
975710892 4:77158348-77158370 ACACCTCCCTGGCCGTGGTGGGG + Intronic
979822554 4:125192059-125192081 GCCCCTCACTGGCCGGGCGGTGG - Intergenic
982784271 4:159523434-159523456 GCCCCTCACTGGCCGGGCGGGGG - Intergenic
985605484 5:855615-855637 CCAGCTCACTGTCCTCGGTGGGG - Intronic
990557522 5:56951496-56951518 GCACCTCCCGGGCTGCGGGGTGG + Intronic
991351311 5:65722535-65722557 CCACCTTGCAAGCCGCGGGGAGG - Intronic
1001904619 5:175461454-175461476 CCAGCGCACAAGCCGCGGGGTGG + Intergenic
1006256825 6:32838644-32838666 CCAACTCACCAGCCGCGGCGGGG + Exonic
1007167560 6:39839751-39839773 TCCCCTCACTGGCCTCTGGGAGG - Intronic
1011734315 6:90296544-90296566 CCACCTCGCCGGCTGCCGGGAGG - Exonic
1013575693 6:111482518-111482540 CCACCTCCCTGCCCGGGGGTGGG + Intronic
1018743061 6:166744759-166744781 CCACGTCCCTGGCGGCGGTGGGG + Intronic
1019577842 7:1746093-1746115 CCACCTCGCCGGCCGCAGGCAGG - Exonic
1022923367 7:35037524-35037546 CCGCCTCCCGGCCCGCGGGGAGG - Intronic
1025102965 7:56150781-56150803 GCCCCTCACTGGCCGGGCGGGGG - Intergenic
1030218072 7:107067062-107067084 CCACATCACTGGCAGGGAGGGGG - Intronic
1034498469 7:151435638-151435660 CCACCACCCTGGCCTCTGGGAGG - Intronic
1034619147 7:152444046-152444068 CTACCTCCCTGACCGCTGGGAGG + Intergenic
1034733502 7:153408973-153408995 CCACCTCACTGGCTGTTGGTGGG - Intergenic
1035661727 8:1353088-1353110 CCAGATCACTGACCTCGGGGGGG - Intergenic
1036652479 8:10654189-10654211 GCACTTGACTGGCCGCTGGGGGG + Intronic
1039461862 8:37751757-37751779 CCAACCCACTGGCCACAGGGCGG - Intronic
1048439898 8:134452197-134452219 CCACCTCACTGGCCCTGGCTGGG - Intergenic
1048484052 8:134831673-134831695 CCACTTCACGAGCCCCGGGGAGG + Intergenic
1048970799 8:139643931-139643953 CCAGCTCTCTGGTCCCGGGGTGG + Intronic
1049194095 8:141306168-141306190 CCACCTCCCGGGCCTCGTGGGGG - Intronic
1056685026 9:88752282-88752304 CCACCTCACAGGCCGAGGACTGG + Intergenic
1056970431 9:91196461-91196483 CCACCACCCTGGCCACAGGGAGG + Intergenic
1057557684 9:96100584-96100606 CCACCTCACTGCCCACGTGCTGG - Intergenic
1060419171 9:123455268-123455290 CCACCTCACTGCCTGCTGGCTGG + Intronic
1061122765 9:128654278-128654300 AAACCTCACTGGCCTTGGGGAGG + Intronic
1061326825 9:129869256-129869278 CCACCTGCCTGGCCGGGGCGAGG - Intronic
1061627383 9:131849004-131849026 AAACCTCACTGCCCACGGGGAGG + Intergenic
1062319211 9:135982216-135982238 CCACCTTGCTGGCCTCTGGGAGG - Intergenic
1062681154 9:137781965-137781987 CCGCCTCACTGGGCCTGGGGCGG + Intronic
1187873402 X:23783109-23783131 CCACCTCACGGCCCGAGGCGGGG + Intergenic
1193049266 X:77083604-77083626 CCACCTCTCTGGCTGGGTGGAGG + Intergenic
1198437384 X:136630489-136630511 CCACATCACTGGGCTCTGGGGGG - Intergenic