ID: 903179730

View in Genome Browser
Species Human (GRCh38)
Location 1:21599109-21599131
Sequence CAAAGAAAGGAGGAGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903179730 Original CRISPR CAAAGAAAGGAGGAGGCGGC AGG Intronic
900284372 1:1891950-1891972 GAAAGACAGCAGGAGGCGGTGGG - Intergenic
900309524 1:2026855-2026877 AAAAGAAATCAGGAGGCAGCCGG + Intronic
900351920 1:2239047-2239069 CCAGGAAAGGCGGAGGCAGCAGG - Intronic
900384047 1:2401300-2401322 GGAAGGAGGGAGGAGGCGGCAGG - Intronic
900881170 1:5382385-5382407 CAAAGAAAGGATGGGGCGTCTGG + Intergenic
901122261 1:6905489-6905511 TAAAGAAAGGAGGAGCAGGCCGG - Intronic
901506318 1:9688044-9688066 GAATGAAAGGACCAGGCGGCCGG - Intronic
901735669 1:11310597-11310619 CAAAGAAAGCAGCAAGGGGCAGG - Intergenic
902830762 1:19010774-19010796 AAAAGAAAGGAGGAGTGGGCAGG + Intergenic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903334419 1:22615433-22615455 CAAAGAAATATGGAGGCGGCTGG - Intergenic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904256557 1:29258479-29258501 GAAAGAGAGGAGGAAGAGGCAGG - Intronic
904395693 1:30220020-30220042 CAAATAAAGGAGGAGCAGCCAGG + Intergenic
905052324 1:35062270-35062292 GAAAGAAAAGAGGAAGAGGCTGG - Intronic
905639790 1:39581212-39581234 CTAAGAAAGGAGGCGGAGGCCGG + Intergenic
906088574 1:43157403-43157425 CAAGGAAGGGAGGGGGCGGAAGG + Intergenic
906346684 1:45019919-45019941 CTAAGAAAGGATGGGGCTGCTGG - Intronic
907037277 1:51227693-51227715 CAAAGAAAGGTCCAGGCTGCTGG - Intergenic
907296316 1:53457998-53458020 CAAAGAAGGGAGGAGAGGGGAGG + Intergenic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907848600 1:58232572-58232594 CAAAGAAAGAAGGAGGGAGAAGG + Intronic
908372318 1:63495576-63495598 CAAAGAAAGTAGGATGGGGCAGG + Intronic
908757952 1:67486191-67486213 TCAAGAAAGGAGGACACGGCTGG + Intergenic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
909877286 1:80823868-80823890 TAAAGAAAGGGATAGGCGGCCGG + Intergenic
910241637 1:85093040-85093062 AAAATAAAGGAGGAGGAGACAGG + Intronic
912623763 1:111191200-111191222 CTAAGGAAGGATGAGGGGGCCGG + Intronic
912972458 1:114296664-114296686 GAAAGAAAAGAGCAGGCGGGAGG + Intergenic
913701380 1:121377514-121377536 CAAAGAAACGAGGCTGAGGCAGG - Intronic
914041936 1:144057975-144057997 CAAAGAAACGAGGCTGAGGCAGG - Intergenic
914136153 1:144902512-144902534 CAAAGAAACGAGGCTGAGGCAGG + Intronic
914960132 1:152197623-152197645 GAAAGAAAGGAGGAGGGGGGAGG - Intergenic
915112375 1:153572291-153572313 AAAAGAAAGAAGGATGTGGCCGG + Intergenic
915450218 1:155999688-155999710 AAAAGAAAGAAGGAGGCAGGAGG + Intronic
915488147 1:156236245-156236267 CAAGGAATGAAGGAGGCGGAAGG - Intronic
915657309 1:157371898-157371920 TAAAGAAAACAGCAGGCGGCTGG - Intergenic
916473098 1:165142798-165142820 CAAAGAAAGGAAGAGAGGGAGGG - Intergenic
916920331 1:169459922-169459944 AAAAAAAAGGAGGAGGCGGAGGG + Intronic
920169744 1:204064386-204064408 AAAAGAAAGGAGGGGGAGGGAGG - Intergenic
920430929 1:205918472-205918494 GAAAGAGATGAGGAGGAGGCAGG + Intronic
920488804 1:206396228-206396250 CAAAGAAACGAGGCTGAGGCAGG - Intronic
921178966 1:212616674-212616696 CACAGAAAGGAGGCCGTGGCAGG + Intronic
921377257 1:214487257-214487279 TGAAGGAAGGAGGAGGAGGCAGG + Intronic
923901213 1:238327658-238327680 CAAAGAAAGAAAGAGGGGGAGGG + Intergenic
924680341 1:246224626-246224648 GAAAGGAAGGAGGAGGAGGAAGG + Intronic
1062830412 10:601772-601794 CAAGGCCAGGAGGAAGCGGCTGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063659574 10:8024928-8024950 AAAAGAAAGAAAGAGGGGGCAGG + Intergenic
1064142547 10:12802814-12802836 CAAAGAAATGAAGAGCAGGCCGG - Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065458741 10:25934294-25934316 TAAAGAAATAAGGAGGCGCCCGG + Exonic
1065689115 10:28315266-28315288 AAAAGAAAGAAGGAGGGGGGAGG + Intronic
1066242976 10:33555783-33555805 GAAAGCAAGGAGGAGGTGCCAGG - Intergenic
1066631498 10:37463022-37463044 TAAAACAAGCAGGAGGCGGCTGG - Intergenic
1067440431 10:46306314-46306336 CAAGGAAAGCAGGTGGGGGCAGG - Intronic
1067656129 10:48192985-48193007 AAAAGAAAGGAGGAGGAGAGCGG - Intronic
1067746428 10:48939832-48939854 CAATGAAATGAGGAGGGGGATGG + Intronic
1068329686 10:55546885-55546907 GAAAGGAAGCAGGAGGCAGCAGG + Intronic
1069059717 10:63882855-63882877 TAAAGAATGGAGGGGTCGGCTGG + Intergenic
1069476503 10:68738116-68738138 CTAAGAAAGTATGAGGAGGCTGG + Intronic
1070433390 10:76363659-76363681 GAAAGAAAGGAGGTGGGGGAGGG - Intronic
1070717653 10:78734211-78734233 GAAAGAGAAGAGGAGGAGGCAGG + Intergenic
1071031730 10:81193020-81193042 AAAATAAAGGAGGACTCGGCCGG + Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071888304 10:89974567-89974589 CAAAGAAATAATGAGGAGGCTGG + Intergenic
1072206821 10:93212214-93212236 CAAAGGCATGGGGAGGCGGCAGG - Intergenic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1073136878 10:101225047-101225069 CAGAGAAGGAAGGAGACGGCAGG - Intergenic
1073308478 10:102522427-102522449 GAGAGAAAGGAGGAGGCGTGTGG - Intronic
1073577635 10:104639615-104639637 TTAAGAAAGGAGGAGGCAGGAGG - Intergenic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075224390 10:120613293-120613315 CAAAAAAAGGAGGAGGGAGAGGG - Intergenic
1076930030 10:133525949-133525971 GAAAGAGAGGAGGAGGCGGCAGG + Intronic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1078001860 11:7503254-7503276 CAAAGAAAAGAGGAGGCCTGAGG + Intronic
1078272672 11:9811156-9811178 CAAAGAAAGGAATAGACGCCTGG + Intronic
1079285471 11:19126644-19126666 CAAAGAAAGGAACAGCAGGCTGG - Intronic
1079739829 11:24044053-24044075 GAAACAAAGGAGGGGGCGGGGGG - Intergenic
1080320056 11:30997996-30998018 AAAAGAAAGGGGGTGGGGGCAGG + Intronic
1080609042 11:33888021-33888043 TGAAGAAAGGAGGTGGGGGCAGG + Intronic
1081686922 11:45049342-45049364 CACAGACAGGAGGTGGAGGCAGG + Intergenic
1082045646 11:47724224-47724246 CAAAAAAAGGAGGTGGGAGCGGG - Intronic
1083213602 11:61204594-61204616 CAATGAAAGGAACAGGCAGCAGG + Intronic
1083372157 11:62190681-62190703 CAGAGATAGGAGGAGGCGCGGGG - Intronic
1083451782 11:62751102-62751124 CAAAGAAAAGGGTAGGAGGCTGG + Exonic
1083825433 11:65200637-65200659 CAAAAAAAGAACAAGGCGGCCGG - Intronic
1084379341 11:68801110-68801132 AAAAAAAAGGGGGAGGGGGCAGG + Intronic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1085068842 11:73523050-73523072 CAATGAGAGGAGGGGGCTGCTGG + Intronic
1085306464 11:75488724-75488746 CACAAAAAGGAGGAGGCAGTGGG - Intronic
1085322289 11:75582643-75582665 CAAAGACAGGATGAGGCTCCAGG + Intergenic
1086157341 11:83682178-83682200 CAAAGCAGGGAGGAGGCAGGAGG + Intronic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087036946 11:93765527-93765549 AAAAGAAAGGCAGAGGCGGGTGG - Intronic
1088098887 11:106132187-106132209 CAAAGAATGGAGCAGGCCGCAGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088415952 11:109589212-109589234 TAAAGGAGAGAGGAGGCGGCAGG + Intergenic
1089179965 11:116576709-116576731 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1089315026 11:117585759-117585781 CACAGAGAGGAGGAGTCGCCAGG + Intronic
1089536436 11:119163276-119163298 CAACGAATGGAGGAGGAGCCAGG + Intergenic
1090367303 11:126217620-126217642 TAAAGGCAGGAGGAGGGGGCAGG - Intronic
1090466780 11:126942079-126942101 CAAAGAAAGGTGGGGGCAGGTGG + Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1091224859 11:133951158-133951180 CCCAGAAAGGACGAGGCGGCGGG + Intronic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091841044 12:3621033-3621055 GGAAGAAAGGAGGAGGAAGCAGG + Intronic
1092481104 12:8859861-8859883 AAAAGAAAGTAGGAAGAGGCTGG - Intronic
1092861851 12:12725340-12725362 CACAGAAAGAAGGAGGGGGTGGG - Intergenic
1094740870 12:33287027-33287049 CAAAGAAAGGAGGAAGAGTCTGG - Intergenic
1095054346 12:37582050-37582072 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1095526474 12:43131755-43131777 GAAAGAAAGCAGGAGGGAGCTGG - Intergenic
1096085644 12:48863412-48863434 CAAAGGAGGGAGGAGGTGGGGGG + Intronic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1097282646 12:57854205-57854227 AAAACAGAGGAGGAGGGGGCGGG + Intergenic
1097533921 12:60840902-60840924 GAAAGAAAAGAGGAGGGGACAGG + Intergenic
1097607731 12:61776508-61776530 TAAAGAAAGAAGGAGGGGTCAGG + Intronic
1097994493 12:65872717-65872739 CAAAGAAAAGTAGAGGCGGCAGG - Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099956088 12:89353635-89353657 CAAAGGGAGGAGGCGGCGGCAGG - Intergenic
1100237086 12:92672061-92672083 GAAAAAAAAGAGGAGGTGGCCGG - Intergenic
1100572711 12:95858347-95858369 AAAAGAAAGGTGGGGCCGGCAGG + Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1102275756 12:111580782-111580804 GGAAGACAGGAGGAGGCAGCGGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1102810286 12:115818473-115818495 ATAAGAAATGAGGAGGCAGCTGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103367015 12:120390772-120390794 GAAAGGAAGGAGGAGGAGGAAGG + Intergenic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1104003980 12:124879406-124879428 CAAAGAAAAGGGGAGAAGGCTGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104891817 12:132143888-132143910 GAAAGCAACGAGGAGGCGCCAGG - Exonic
1104925603 12:132312646-132312668 CAAAGACAGGAGGAGACCTCAGG + Intronic
1104928683 12:132327195-132327217 GAAAGAAAGGAGGAAGGGGGAGG + Intronic
1105902621 13:24769130-24769152 AAAGGAAAGGAGCAGGCAGCTGG + Intronic
1106558369 13:30829078-30829100 AGAAGAAAGCAGGAGGCGGCCGG - Intergenic
1107584565 13:41830891-41830913 AAAAGAAAAGAGGAGGAGGAAGG + Intronic
1107763360 13:43706363-43706385 AAAAGAAAGAAAGAGGCGGAAGG + Intronic
1108071560 13:46634319-46634341 CACAGAAAGGAGGATTCGCCAGG - Intronic
1108770370 13:53693481-53693503 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1109249876 13:60006712-60006734 AAAAGAAAAGAGGAGGAGACTGG + Intronic
1110018029 13:70433558-70433580 GAAGGAAAGGAGGAAGAGGCAGG + Intergenic
1110045210 13:70819354-70819376 GAAAGAAAGGCTGAGGCGGGAGG + Intergenic
1110267721 13:73557476-73557498 CAGAGAAAGGCTGAGGCGGGGGG - Intergenic
1110479995 13:75962762-75962784 CAAAGAAAGGAGGAAGTGTCAGG - Intergenic
1110567450 13:76970504-76970526 CAAAAAAAGGAGGTGGGGGGGGG + Intergenic
1110952419 13:81513669-81513691 CAAAGAAAGGAGGATGAGAGTGG - Intergenic
1112819188 13:103311003-103311025 GAAAGAAAGGGGGAGGGGGAGGG + Intergenic
1113852925 13:113428423-113428445 CTAAGAGGGGAGGGGGCGGCAGG - Intronic
1113890138 13:113731336-113731358 GAGAGAAGGTAGGAGGCGGCCGG + Exonic
1113946588 13:114048017-114048039 CAAAGAACGGAGGTCTCGGCCGG + Intronic
1114259280 14:21025528-21025550 TTAAGAAAGGAGGAGGTGGGCGG + Intronic
1114483016 14:23047142-23047164 AAAGGAAAGGGGGAGGCGGCTGG - Exonic
1114823771 14:26052867-26052889 GAAAGAAAGGAGGAGGTGCCAGG - Intergenic
1115770534 14:36661312-36661334 CAAAGAAACCAGGAGGTTGCGGG - Intronic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1118563736 14:67116388-67116410 CAAGGAAAGGAGGGGAGGGCAGG + Intronic
1118789170 14:69073489-69073511 TAAAGAAAGCAGCAGGGGGCTGG + Intronic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1120767264 14:88339981-88340003 AAAAGAGAGGAGGAGACGGAGGG + Intergenic
1120825233 14:88948933-88948955 CAAAGCCAGGAGGAGGCTCCTGG + Intergenic
1120866502 14:89299732-89299754 CAAAGGAAGGAGGGAGTGGCTGG - Intronic
1121098460 14:91233869-91233891 CGAGGGAAGCAGGAGGCGGCAGG + Exonic
1121488693 14:94342323-94342345 GAAAGAAAGGAGGTGGTGGTTGG + Intergenic
1121581507 14:95035643-95035665 CCAAGGAAGGAGGAGGAGGCTGG + Intergenic
1122193577 14:100067796-100067818 CACAGAAATGAGGAGGCGACTGG + Intronic
1122556945 14:102585616-102585638 TAAAGAAAGGGCGGGGCGGCTGG + Intergenic
1122561115 14:102615130-102615152 CAAAAAAAGGTGGGGGCGGGGGG - Intronic
1122722105 14:103727952-103727974 CACAGACACGAGGAGCCGGCTGG - Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1124431001 15:29608503-29608525 TAAAGAAGGCAGGAGGAGGCAGG - Intergenic
1125126740 15:36232368-36232390 CCAAGAAAGAAGTAGGAGGCAGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1126133304 15:45365548-45365570 GACAGAAAGTAGGAGGCTGCAGG + Intronic
1128743080 15:70096629-70096651 CACACAAAGGGGGATGCGGCCGG - Intronic
1128874219 15:71188997-71189019 GGAAGAAAGGAGGAAGAGGCAGG - Intronic
1128913859 15:71541920-71541942 ACAAGACAGGAGGAGGAGGCTGG + Intronic
1128981855 15:72194015-72194037 GAAAGGAAGGAGGAGGGGGAGGG - Intronic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129359113 15:75013247-75013269 CAAAGAGAGGAGGATTCAGCTGG + Intronic
1129483072 15:75843265-75843287 CAAGGCGAGGAGGGGGCGGCCGG + Exonic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1130508813 15:84571128-84571150 CAAAGCCAGGAGGGGGCAGCCGG - Intergenic
1130519974 15:84654748-84654770 CAGAGAAGAGAGGAAGCGGCCGG + Intergenic
1131364597 15:91827596-91827618 CAATGAAAGGAGGAAGGGGAGGG + Intergenic
1131550412 15:93352232-93352254 CAAAGAAAAGAGGAGAAGGCTGG - Intergenic
1131852120 15:96554629-96554651 AAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1131972309 15:97904688-97904710 GAAAGAGAGGAGGAGGAGGAGGG + Intergenic
1132185049 15:99796873-99796895 CAAAGAAAGGAGGCGGGGATGGG + Intergenic
1132216039 15:100062307-100062329 CCAAGCTAGGAGGAGGTGGCAGG + Intronic
1132468789 16:90252-90274 CAAAGAAGAGAGGAGGCAGAGGG - Intronic
1132484355 16:182592-182614 AAAAAAAAAGAGGAGGGGGCGGG + Intergenic
1132619083 16:855916-855938 CAAAGCCAGGAGGAGCCGGGTGG - Intronic
1132778690 16:1611209-1611231 CCAAGAAAGCAGCTGGCGGCCGG + Intronic
1132924361 16:2420794-2420816 CTAAGAAAGGAGGAAGGGGAAGG - Intergenic
1132942661 16:2515648-2515670 CAAAGAACAGAGGAGGCTGGGGG - Intronic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133066751 16:3213374-3213396 GAAAGAAAGAAAGAGGCGCCAGG + Intergenic
1133141994 16:3751948-3751970 CAATGAAAGGAACAGGGGGCAGG + Intronic
1133166201 16:3949419-3949441 CAAACAGAGAAGGAGGCGGTGGG - Intergenic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133385924 16:5370449-5370471 AAAAAAAAAGAGGAGGAGGCTGG - Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133392662 16:5422469-5422491 GGAAGAAAGGAGGAGGGAGCGGG + Intergenic
1134269519 16:12721454-12721476 CAAAAAAAGGAGGCCGGGGCTGG + Intronic
1134610262 16:15602604-15602626 AGAAGAAAGGAGGAGGAGGAAGG + Intronic
1134646763 16:15874838-15874860 GAAAGCAAGGAGGAAGCTGCAGG - Intronic
1134902909 16:17954642-17954664 GAAAGAAAGGAGGAAGGGGAAGG + Intergenic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136060140 16:27720848-27720870 GAAAGCCAAGAGGAGGCGGCTGG + Intronic
1137385591 16:48039593-48039615 CAAAGAAATGAAGAGGCAGCCGG - Intergenic
1138091169 16:54175801-54175823 AAAAGAAAGAAAGAGGGGGCGGG - Intergenic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139297748 16:65917968-65917990 CCAAGTAAAGAGGAGGAGGCAGG + Intergenic
1140203746 16:72916176-72916198 AAAAGAAAGGCGGAGGAGGGGGG - Intronic
1140685077 16:77425744-77425766 CAAAAAGAGGAGGAGTGGGCCGG + Intronic
1140944904 16:79758709-79758731 GAGAGAAAGGAGGACGGGGCAGG + Intergenic
1141430774 16:83969214-83969236 GATGGAGAGGAGGAGGCGGCTGG - Intronic
1141683159 16:85555669-85555691 AAAAGGAAGGGGGGGGCGGCGGG - Intergenic
1141845219 16:86603888-86603910 GAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1141941187 16:87277214-87277236 AAAAGAAAGGAGCAGAAGGCCGG + Intronic
1144496252 17:15747478-15747500 TAAAGATAGGTGGAGGAGGCTGG + Intronic
1144499133 17:15770186-15770208 CTAAGAAAGGATGCGGCTGCTGG - Intergenic
1145162515 17:20585222-20585244 CTAAGAAAGGATGCGGCTGCTGG - Intergenic
1145285543 17:21503588-21503610 TAAAGAGAGAAGGAGGAGGCAGG + Intergenic
1145391984 17:22462149-22462171 TAAAGAGAGAAGGAGGAGGCAGG - Intergenic
1146514961 17:33481977-33481999 TAAAGAAAGGAGAGGGCAGCAGG - Intronic
1146607220 17:34271032-34271054 GAAAGAAAGGAAGAGGTGGAGGG - Intronic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148140023 17:45321674-45321696 CAAAGAATGGAGGTGAGGGCTGG + Intergenic
1148262967 17:46200400-46200422 CAAAGAGAAAAGGAGGCAGCAGG + Intronic
1148386102 17:47236329-47236351 CAAAGAAAGGACCAGGGGACAGG - Intergenic
1148852322 17:50561177-50561199 CAAAGTGAGGGGGAGCCGGCCGG + Intronic
1149068225 17:52506086-52506108 CAAAGAAATGAGGTGGTAGCTGG - Intergenic
1149993838 17:61396912-61396934 CACACAGAGGAGGAAGCGGCGGG + Intergenic
1150239015 17:63617180-63617202 GAAAGAATGGAGGTGGGGGCTGG + Intergenic
1150615979 17:66771888-66771910 TAAAGAAATAAGGAAGCGGCGGG - Intronic
1152181336 17:78823544-78823566 GCAAGAATGGAGGAGGGGGCAGG + Intronic
1152192673 17:78898013-78898035 CAAGGAGAGCTGGAGGCGGCAGG - Intronic
1152730685 17:81968129-81968151 CAAAGAGGGGCGGCGGCGGCGGG + Intergenic
1153671806 18:7418985-7419007 TAAAGAAAGCAGTAGGGGGCTGG - Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154072248 18:11163144-11163166 CAATGAGAGGAGGAGGGGGAGGG - Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1158311597 18:56165548-56165570 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
1158835414 18:61326521-61326543 CAAAGAATGGAGGTGGCCTCTGG - Intergenic
1159335816 18:67064215-67064237 AAAAGCAAGGAGGAAGTGGCGGG + Intergenic
1159594802 18:70372321-70372343 CAAGGAAGAGAGGAGGCTGCAGG + Intergenic
1160023439 18:75199535-75199557 CAAACAAAGGAGGGGGGAGCAGG - Exonic
1160340330 18:78084099-78084121 CCACGGAAGGTGGAGGCGGCTGG - Intergenic
1161007041 19:1941961-1941983 CCAAGACAGGAGGAGGCGATGGG - Intronic
1161095548 19:2388391-2388413 CAAACAAAAAAGGAGGCGGGAGG + Intergenic
1161214188 19:3085110-3085132 CAAGGAAGGGAGGAGGCCGTGGG + Intergenic
1161403856 19:4081077-4081099 AAAAGAGGGGAGGAGGGGGCCGG + Intergenic
1162788605 19:13051654-13051676 CCAAGAAGGGAGGAGGAGGAGGG - Intronic
1162996340 19:14338241-14338263 AAAAGAAAGAAGGAGGCACCTGG + Intergenic
1163260299 19:16185596-16185618 AAAAGACATGAGGAGGCGGCGGG - Intronic
1163776939 19:19224455-19224477 CAAAGAGAGGCGGAGGGGCCGGG - Intronic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1165016086 19:32880970-32880992 CAAAGAAAGGAGGGGTGGGTGGG + Intronic
1165573026 19:36791484-36791506 CAAATTACGGAGGAGGGGGCAGG - Intergenic
1165632347 19:37312502-37312524 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1165694034 19:37886730-37886752 GAAAGGAAGGAGGAGGAGGAAGG - Exonic
1166197820 19:41218599-41218621 CAGAGACAGGAGGACACGGCTGG - Intergenic
1166850587 19:45758723-45758745 CACAGAAATGAAGAGGCAGCCGG - Intronic
1167038273 19:47007212-47007234 CAAAGAAGGGAGGAACAGGCCGG - Intergenic
1167129374 19:47573967-47573989 CAAAGAAGGGAGGAATAGGCTGG - Intergenic
1167346986 19:48952496-48952518 AAAAGAAAGGAGGGGGGGCCGGG - Intergenic
1167424182 19:49421439-49421461 AAGAGAAAGGAGCAGGCGTCAGG - Intergenic
1167424307 19:49422173-49422195 GAATGAAAGGAGGGGGCGGGGGG + Intergenic
1167473885 19:49689454-49689476 CCAAGAAAAGGGGTGGCGGCGGG - Exonic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168106529 19:54168757-54168779 GAAAGAAAGGAAGGCGCGGCTGG - Intronic
1168236745 19:55068537-55068559 CAAAAAAAGAAAGAGGAGGCCGG + Intronic
1168276935 19:55284019-55284041 GAGAGAAAGGACGAGGTGGCGGG + Intronic
925207044 2:2015697-2015719 CAAGGGAAGGAGGGGGCGGGAGG + Intronic
925307158 2:2856537-2856559 CAAGGAGAGGAGGAGGCTGTAGG - Intergenic
925326194 2:3023810-3023832 CAAAAGATGGAGGAGGCAGCGGG + Intergenic
926210356 2:10864676-10864698 CAAAGAAATGAAGAGACGGCTGG - Intergenic
926235505 2:11040223-11040245 CAAGGAAAGAAGGATGGGGCAGG - Intergenic
927194432 2:20538051-20538073 GAAAGAAGGCTGGAGGCGGCCGG - Intergenic
927584102 2:24282961-24282983 AAAAGAAAGGAGGAGGCAGGGGG - Intronic
927616470 2:24601930-24601952 TAAAGAAAGGACGAAGTGGCTGG - Intronic
929315827 2:40477419-40477441 CAAAGAAATAGGGAGGGGGCTGG - Intronic
929418159 2:41764946-41764968 CAAAGAAATGGGGTGGCAGCTGG + Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930106309 2:47642668-47642690 CAAAGAAGAGAGGAGTCGGCTGG - Intergenic
930152345 2:48071270-48071292 CAAAGGAAGGATGATGCGGCAGG - Intergenic
931232119 2:60383719-60383741 GGAAGAAAGCAGGCGGCGGCAGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932806768 2:74791379-74791401 TTAAGAAAGTGGGAGGCGGCTGG + Intergenic
932848857 2:75164029-75164051 CTAAGAAAGCAGGAGTGGGCCGG + Intronic
933035625 2:77393753-77393775 TAAATAAAGGAGGTGGAGGCAGG + Intronic
933833369 2:86227702-86227724 CAAAGAGAGGAGGAGGCTTTGGG - Intronic
933982951 2:87568480-87568502 AAAGGAAAAGAGGAGGGGGCAGG - Intergenic
934509795 2:94928464-94928486 CAAGTAAAAGAGGAGGCGGACGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
936310890 2:111382315-111382337 AAAGGAAAAGAGGAGGGGGCAGG + Intergenic
936547969 2:113409180-113409202 CAATGAAAAGAAGAGGAGGCAGG + Intergenic
937102632 2:119283384-119283406 CAAAGCAGGAAGGAGGAGGCAGG - Intergenic
937292827 2:120792133-120792155 CAAAGAAACCAGGTGGCGGGAGG + Intronic
938399987 2:130982599-130982621 AGAAGAAAGGAGGAGGAGGAGGG - Intronic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
938947754 2:136228415-136228437 GAAAAAAAGGAGGAGGCGTGAGG + Intergenic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
942026080 2:171912296-171912318 GAAAGCAAGGGAGAGGCGGCTGG + Intronic
942044824 2:172094445-172094467 AAAAGAAAGGAGGAGGTGGCAGG - Intergenic
942081298 2:172401742-172401764 GTAAGAAAGTAGGAGGCAGCTGG - Intergenic
943464909 2:188217549-188217571 GAAAGAAAGGAGGAGAGGGAAGG - Intergenic
944401283 2:199328978-199329000 CAAACAAAGGAGGAGAGGGGTGG - Intronic
944553932 2:200869537-200869559 CCAAAAAAGGAGGAAGGGGCAGG + Intergenic
944701651 2:202251239-202251261 AAAAAAAAGGAGGAAGAGGCCGG + Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
947220718 2:227789479-227789501 GAAAGAGAGGAGGAGGAGGAAGG - Intergenic
947947687 2:234120570-234120592 CAAAGGAAGGGGGAGGCTGCTGG + Intergenic
948064247 2:235064749-235064771 TTAAGAAAGAAGGAGTCGGCTGG - Intergenic
948570874 2:238916452-238916474 GAAAGAAAGAAGGAGGAGGAAGG + Intergenic
948570880 2:238916475-238916497 GAAAGAAAGAAGGAGGAGGGAGG + Intergenic
948890182 2:240903613-240903635 AAAAGAAACGAGGATGCGTCCGG + Intergenic
948897158 2:240932881-240932903 CATAGAGAGGCGGTGGCGGCGGG + Intronic
1169477134 20:5941793-5941815 TAAAGAAAGGAGGCTGAGGCTGG - Intronic
1169878300 20:10321392-10321414 GAAAGAAAGGAGGAAGCCACAGG - Intergenic
1170040838 20:12037477-12037499 AAAGGAAAGGTGGAGGAGGCAGG - Intergenic
1171527913 20:25830297-25830319 CAAATTATGGAGGAGGGGGCAGG - Intronic
1171548913 20:26025583-26025605 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172367946 20:34363868-34363890 CAATGGAAGGAGGAGGCGAGTGG - Intronic
1172793895 20:37524123-37524145 CAAAGAAATGAGTAGTGGGCAGG + Intronic
1173564080 20:44026906-44026928 CAAGGTGGGGAGGAGGCGGCAGG - Intronic
1173594629 20:44250785-44250807 CCCACAAAGGAGGAGGAGGCTGG - Intronic
1173656056 20:44701043-44701065 CAAAGAAAGGAGTGAGAGGCTGG - Intergenic
1173664635 20:44755462-44755484 AAAGGAAAGGAGGAGGTGCCGGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173975798 20:47185660-47185682 CAAAGAAAGGAGGGCTTGGCCGG + Intronic
1174003324 20:47390637-47390659 AAAAAAAAACAGGAGGCGGCCGG - Intergenic
1174182350 20:48682823-48682845 CAATGAAAGCAGGTGGCAGCTGG + Intronic
1174555369 20:51391456-51391478 AAAAGAAAAGAGGAGGGGGGGGG + Intronic
1174740084 20:53004482-53004504 AAAAGACAGGAAGAGGTGGCGGG - Intronic
1174814835 20:53677829-53677851 CAATCAAAGGGGGAGGGGGCAGG - Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1176022946 20:62971331-62971353 GAAAGCCAGGAGGAGGCAGCAGG + Intergenic
1177180431 21:17739086-17739108 CTAGGAAAGGGGGAGGTGGCAGG - Intergenic
1178103998 21:29298837-29298859 CGCAGAAGGGAGGGGGCGGCTGG + Intronic
1178285347 21:31321131-31321153 CACAGAAAGAAGGGGGCGGGGGG + Intronic
1178476350 21:32940630-32940652 TCAAGAGAGGAGGAGGCGACTGG + Intergenic
1178937895 21:36880294-36880316 GAAAGAAGGGAAGAGGAGGCAGG + Intronic
1179613369 21:42566353-42566375 CAAAGCTGGGAGGAGGTGGCTGG - Intronic
1180140324 21:45889559-45889581 AGAAGAAGGGAGGAGGAGGCTGG - Intronic
1180628342 22:17209539-17209561 GAAAGAAAAGATGATGCGGCTGG - Exonic
1181289993 22:21784363-21784385 GAAAGAAAGGAGGAGAAGGGAGG + Intronic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1182018863 22:27064042-27064064 AGAAGAAAGAAGGAGGAGGCTGG + Intergenic
1182696615 22:32203019-32203041 CAAGAACAGGAGGAGGTGGCCGG + Exonic
1183037648 22:35152263-35152285 GAAAGAAAGGAGGAGCCAGAAGG + Intergenic
1183077279 22:35435160-35435182 AAAAGGAATGAGGAGGAGGCTGG + Intergenic
1183184137 22:36282210-36282232 CAAAGAAAGGAGGAGGAGTGGGG + Exonic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1203289236 22_KI270735v1_random:17720-17742 CAAAGAGACGAGGCGGCGGCAGG + Intergenic
949584534 3:5424965-5424987 CAAAACAAAGAGGAGGCAGCTGG - Intergenic
949747616 3:7312905-7312927 AAAAAAAAGGAGGAGAAGGCAGG - Intronic
949953366 3:9247859-9247881 CAGAGAAAGGAGGAGCCTGCTGG + Intronic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951490953 3:23270138-23270160 AAAAAAAAGGAGGAGGGGGGTGG - Intronic
952010648 3:28897164-28897186 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
952684407 3:36132180-36132202 CAAAGAAAGGAGGGGAGGCCTGG - Intergenic
952882074 3:37991431-37991453 CCAGGAAAGGAGGAGGTGCCTGG + Intronic
953597293 3:44329492-44329514 AAAAGCAAGGAGGAAGCTGCAGG + Intronic
953601964 3:44375415-44375437 AAAAGAGAGGAGGAGGCGCCAGG + Intronic
954167836 3:48774835-48774857 CAAAGAAAGGAAGAGAGGGAGGG - Intronic
954217545 3:49132912-49132934 CAAAGCAAGGAGGAGGGCTCGGG - Intronic
954526341 3:51275082-51275104 CACAGGAAGCAGGATGCGGCGGG - Exonic
954916074 3:54149555-54149577 CAAAGAGAGGAGGAGTCTGTGGG - Intronic
954932391 3:54295541-54295563 CAAAGTGAGGAGGAGGCTTCCGG + Intronic
954987622 3:54809612-54809634 GAAAGAAAGAAGGAAGGGGCCGG - Intronic
955291231 3:57693963-57693985 CTAAGAAAGGAGGAGGTGGTAGG - Intergenic
955678534 3:61475397-61475419 GAAAGGAAGGAGGAGGAAGCAGG - Intergenic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
960319807 3:116220856-116220878 CTAAGAAAAGGGGAAGCGGCTGG + Intronic
960663213 3:120083407-120083429 AAAAGAAAGGGGCAGGAGGCAGG + Intronic
960987563 3:123290667-123290689 CAAAGGAAGGAGGAGTCCTCAGG - Intronic
960991046 3:123311611-123311633 CCAGGAGAGGAGGCGGCGGCAGG + Intronic
961699077 3:128727435-128727457 GAAAGAAAGGAGGTGGTGGGAGG - Intronic
961796036 3:129409529-129409551 CTAAGATAGGAGGAGGCTGGCGG + Intronic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
964894656 3:161581149-161581171 CACAGAGAGAAGGAGGCGGGAGG - Intergenic
965420017 3:168446390-168446412 AAAAGAAAGGAGGAGGAGAGAGG - Intergenic
965503751 3:169487775-169487797 CAAAAAAGGGAGGGGGCGGGAGG + Intronic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
967728073 3:192880456-192880478 TAAAGGAAGGAGGAGGAAGCAGG + Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968648210 4:1750175-1750197 CAGAGAGAGGAGGGGGCGGGGGG + Intergenic
969364224 4:6684761-6684783 CAAGGGAAGGAGGAGGCAGGGGG + Intergenic
969652016 4:8473645-8473667 GTAAGGAGGGAGGAGGCGGCAGG + Intronic
969938662 4:10708096-10708118 CAATGACAGGAGGAAGTGGCAGG + Intergenic
971471147 4:27028408-27028430 CAATGAAAGGATGAAGCGGGTGG - Intergenic
972101411 4:35423745-35423767 AAAAGAAAACAGGAGGCGTCAGG + Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
974994031 4:69130636-69130658 TAAAGAAATGAGGACGAGGCAGG - Intronic
975572898 4:75836209-75836231 CACAGAAAGATGGAGGCGCCGGG + Intergenic
976197883 4:82550811-82550833 GAAAGAAAGGAAGAGCTGGCAGG + Intronic
977900241 4:102414122-102414144 CAAGCAAAAGAGGAGGGGGCAGG - Intronic
977911929 4:102547293-102547315 GAAAGAAAGGATGAGCTGGCAGG + Intronic
978028873 4:103913387-103913409 AAATGAAAGAAGGAGGCTGCTGG - Intergenic
978543632 4:109846482-109846504 AGAAGAAAGGAGGAGGCTTCAGG - Intergenic
978736104 4:112086322-112086344 CAAAGAAAGGAGGCATAGGCTGG + Intergenic
979666893 4:123321593-123321615 CAAAGAAAGCAGGTGGCCTCTGG + Intergenic
980387687 4:132107592-132107614 CAAAAAAAGTAGGAGGTGGCGGG + Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
981839676 4:149096398-149096420 CAAAGAGAAGAGGAGGAGTCTGG - Intergenic
982871889 4:160590042-160590064 GAAAGAGAGGAGGAGGTGCCAGG + Intergenic
982890063 4:160836009-160836031 CACACAGAAGAGGAGGCGGCAGG - Intergenic
983533309 4:168832698-168832720 CAAAGAAAGGAGGATGGGCTTGG - Intronic
984994957 4:185421509-185421531 AAAAGAGAGGAGGAGGTGCCAGG - Intronic
985421327 4:189787949-189787971 CAAAAAAAGGGGGAGGCAGGAGG + Intergenic
985548791 5:523047-523069 CGGAGAAGGGAGGAGGCGGGAGG + Intronic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986516633 5:8571409-8571431 CATATCAAGGAGGAGGCTGCTGG - Intergenic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
988771659 5:34438901-34438923 AAAAGAAAGGCTGAGGCGGGTGG + Intergenic
991649281 5:68835308-68835330 CAAAATAAGGAGGGGGCGACGGG + Intergenic
991650286 5:68845635-68845657 CAAAGCAAGGAGGAGAGGGAAGG + Intergenic
992121561 5:73598855-73598877 CAAAGAAAGGAGTCAGTGGCTGG + Intergenic
992948259 5:81830802-81830824 CCAAGAAATGAGGAAGTGGCTGG + Intergenic
993498526 5:88637151-88637173 CAAAGAATGAAGGAGGGGGTTGG - Intergenic
994357502 5:98810436-98810458 CAAAGAAAGTCGCAGGAGGCTGG + Intergenic
995784831 5:115816750-115816772 CCAAGAAAGGTGGCGGAGGCGGG + Exonic
995866550 5:116697864-116697886 CATAGAAAAGAGGAGAAGGCCGG + Intergenic
995975862 5:118034097-118034119 CACAGAAAGGGGGATGCGGGTGG - Intergenic
996270182 5:121595538-121595560 CAAAGAAAGTAGGAGGCAATTGG - Intergenic
996544101 5:124659452-124659474 CAAAGGAAGGAGGAGCAGGCAGG + Intronic
996791937 5:127302791-127302813 AAAGGAAAGGAGGAGGAAGCAGG + Intronic
997444072 5:133928608-133928630 AAAAAAAAGGGGGAGGGGGCGGG + Intergenic
997525062 5:134547726-134547748 CAACCAAAGAAGGAGGTGGCTGG + Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997736187 5:136214201-136214223 TTATGGAAGGAGGAGGCGGCAGG - Intronic
998583742 5:143404697-143404719 TAAGGAAAGCAGGGGGCGGCAGG + Intronic
999496375 5:152102890-152102912 AAAAGAAAGAAGGAGGAAGCAGG - Intergenic
999637581 5:153638932-153638954 GAAAGAAAGCAGGAGGCAGGAGG + Intronic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001196762 5:169679965-169679987 CAAAGAAGGTAGGAGGAGGTGGG - Intronic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1001947962 5:175796515-175796537 CCGAGAAAGGAGGCGGGGGCTGG - Exonic
1002107323 5:176886630-176886652 CAAAGAAAGGAGGAGGAGAGAGG + Intronic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002430048 5:179198207-179198229 CAACGCAAGGTGGAGGCTGCAGG + Intronic
1002776594 6:333185-333207 CAGAGACAGGAGGAGGCAACTGG + Intronic
1002899534 6:1399407-1399429 GGAAGAAAGGAGGAGGAGGAAGG + Intergenic
1003334093 6:5154518-5154540 AAAAGAAAGGCGGATTCGGCCGG + Intronic
1004305726 6:14500344-14500366 CAAAGAAAGGGAGAAGAGGCTGG + Intergenic
1004321578 6:14635458-14635480 CAAAGAAGGTAGGAGGTGGAAGG + Intergenic
1004751596 6:18567516-18567538 GAAGGAAAGGAGGAGGAGGAAGG - Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005425173 6:25695381-25695403 CAAAAAAAGGTGGAGGGGGGTGG - Intronic
1005744495 6:28823587-28823609 GAAAGAAAAGACGAGACGGCCGG + Intergenic
1006016416 6:31084749-31084771 AAAAAAAAAGAGGAGGAGGCAGG - Intergenic
1006440442 6:34050465-34050487 GAAAGAGAGGAGGAGGAGCCAGG - Intronic
1006807967 6:36800832-36800854 CAAGGAAAGGATGAGGCCCCAGG + Intronic
1006903113 6:37515757-37515779 GAAAGAAGGGAGGATGCTGCCGG - Intergenic
1006934176 6:37705781-37705803 CCAAGACAGGAGTTGGCGGCGGG - Intergenic
1007359253 6:41343283-41343305 TATAGATAGGAGGAGGAGGCAGG - Intronic
1007431918 6:41781389-41781411 GCAAGAAAGGAGGGGGCGTCTGG - Exonic
1007691549 6:43704933-43704955 CAAAGAAAGGGGGAGGGTGTGGG - Intergenic
1007741399 6:44012003-44012025 CAAAGAAAGAGGGAGGAGGAAGG - Intergenic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1008189742 6:48439721-48439743 GAAAGAAAGGAGGAGGTGTTAGG - Intergenic
1008198733 6:48559850-48559872 CAAAGAAAGCAGGAGGAAGTGGG - Intergenic
1008413627 6:51213866-51213888 CGAAGAAAGGAGGGGGCGGGGGG + Intergenic
1008908880 6:56711793-56711815 TAAAAATAGGAGGAGGTGGCCGG + Intronic
1009303282 6:62054575-62054597 AAAAGAAAGAAGGAGGCAGCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011157673 6:84351405-84351427 CAAGGAATGGAGCAGGCTGCTGG + Intergenic
1011261264 6:85472162-85472184 CAAGGAAAGGAAGAAGAGGCTGG + Intronic
1012499374 6:99871792-99871814 CAAAGAAAGGGGGAGGGAGATGG - Intergenic
1013120419 6:107135839-107135861 AAAAGAAAGGGGGAAGAGGCTGG + Intergenic
1013236102 6:108198898-108198920 CCAAGATAGGAGCAGGCGCCAGG + Intergenic
1013484740 6:110585922-110585944 AAGAGAGAGGAGGAGGCGCCAGG - Intergenic
1014605395 6:123467543-123467565 AAAAGAAAGGAGAAGCCAGCTGG + Intronic
1014768254 6:125432217-125432239 CAAAGGAAGGAGGATGTGGGGGG - Intergenic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1015113368 6:129619292-129619314 GAAAGAAAGAAGGAGGGGGAGGG + Intronic
1015477514 6:133670355-133670377 ACAAGAAAGGAGGAGGAGGAGGG - Intergenic
1015935575 6:138403983-138404005 GAAAGGCAGGAGGTGGCGGCTGG - Intronic
1016087259 6:139929292-139929314 TAAAGAAAGGAGGACCCGGCCGG + Intergenic
1016485085 6:144528825-144528847 CATAGAGAGGATTAGGCGGCAGG + Intronic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016830115 6:148425728-148425750 AAAAAAAAGGAGGAGGGGGAGGG - Intronic
1017516070 6:155156774-155156796 CAAAGAAAGGAGCAGAAGGGTGG - Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018372287 6:163179253-163179275 GACAGAAAGGAGGCGGCAGCTGG + Intronic
1018509678 6:164511618-164511640 CAAAGAGTGGAGGAGGCAGATGG + Intergenic
1019074306 6:169375206-169375228 CAAAGATATGAGGAAGCGGTAGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019824234 7:3270278-3270300 CAAAGAAAGGCTGAGGTGGGAGG - Intergenic
1020152788 7:5696523-5696545 CACAGGAAGGAGGAGCAGGCCGG + Intronic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1021503360 7:21354194-21354216 GAAAGAATGGATGAGGCGGCAGG - Intergenic
1021567153 7:22027043-22027065 CAAGGAGAGGAGGAGGCTGGGGG + Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022052107 7:26686353-26686375 AAGAGAAAGGAGGAGGCAGTGGG + Intronic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023187543 7:37547871-37547893 AAAAAAAAGGAAGAGGAGGCAGG + Intergenic
1024570867 7:50722034-50722056 CAAAGACAGGCTGAGGAGGCTGG + Intronic
1025215388 7:57051679-57051701 GAAAGAGAGGAGGAGGTGCCAGG - Intergenic
1025297730 7:57789586-57789608 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1025736156 7:64148739-64148761 AAAAAAAAGGAGGCGGCGGGGGG + Intronic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026885812 7:73943812-73943834 AATAGAGAGGAGGAGGTGGCAGG + Intergenic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1027189066 7:75987543-75987565 CAAAGAAAAGAAAAGGCAGCAGG + Exonic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027588467 7:80087880-80087902 CTAGGAAAAGAGGAGGCAGCAGG + Intergenic
1027591495 7:80124764-80124786 AAAAGAAAGAAGGAGGAGACTGG + Intergenic
1027940219 7:84669046-84669068 CAAATAAAGGAGGGGGCAGGAGG - Intergenic
1028060417 7:86306969-86306991 CAAAGAAAGGATTAGGCTGTTGG + Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028465489 7:91146850-91146872 CAAAGAAAAAAGGAGGCAGATGG - Intronic
1029152507 7:98490963-98490985 CAAAGAAATGGGGTGGTGGCGGG + Intergenic
1029789826 7:102830626-102830648 AATAAAAAGGAGGAGGCAGCAGG - Intronic
1031511322 7:122653868-122653890 GAAAGAAATGAGGAAGTGGCTGG - Intronic
1031743337 7:125462760-125462782 AAAAGAAAAGAGGAGGGGGGAGG - Intergenic
1032131642 7:129233996-129234018 AAAAGAAAGGAGGAGGAAGGGGG - Intronic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1033282686 7:140017257-140017279 CCAAGGAAGCAGGTGGCGGCTGG + Intronic
1034029428 7:147743832-147743854 CAAAGACAGGAGGAGACAGTGGG - Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034533799 7:151714286-151714308 CAAGGTATGGGGGAGGCGGCAGG + Intronic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035125975 7:156607879-156607901 CAAGTAAAGGGGGAGGCGCCCGG - Intergenic
1035593476 8:836216-836238 CACTGGAAGCAGGAGGCGGCCGG - Intergenic
1038169998 8:25122377-25122399 TAAAGAAATGATGATGCGGCCGG - Intergenic
1039434020 8:37547297-37547319 CAAGCCAAGGAGGAGGGGGCTGG - Intergenic
1039897457 8:41726129-41726151 CAGAGAAAGGAAGTGGAGGCAGG - Intronic
1040491891 8:47931302-47931324 CCAACAAGGGAGGAGGAGGCTGG + Intronic
1041051746 8:53941037-53941059 CAGAGAAAGGAGGGAGCGGAAGG - Intronic
1041891159 8:62870064-62870086 CAAAGAAAGGGGGCTGGGGCTGG - Intronic
1041935905 8:63331511-63331533 CAAAGAAAGCATGAGAGGGCTGG - Intergenic
1042380278 8:68105254-68105276 CTAAGAGAGGAGGAGGCAGCAGG - Intronic
1042859162 8:73295500-73295522 CAAAGCAACGAGGAGACGGCTGG + Exonic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043169289 8:76944534-76944556 CAAAGAAAGGAGGATGATGTTGG - Intergenic
1043455577 8:80408864-80408886 AAAAGCGAGGAGGAGGAGGCAGG - Intergenic
1043961944 8:86426861-86426883 CAAAGAAAGAAGGAGAGGCCGGG + Intronic
1044602598 8:94020600-94020622 CAAAGAGATGAGGTGGCGCCAGG - Intergenic
1045042191 8:98236564-98236586 GAAAGAAAGAAGGATGGGGCAGG + Intronic
1045089625 8:98728067-98728089 CTAGGAGAGGAGGAGGGGGCAGG - Intronic
1045474733 8:102543111-102543133 AAAAGAAAGAAGGAGGGGCCAGG - Intergenic
1045656501 8:104392418-104392440 GAAAGAAACTAGGAGGTGGCTGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047484123 8:125313265-125313287 AAAAGAAAGGATGAGAAGGCAGG + Intronic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1049326299 8:142023245-142023267 CAGACAAAGAAGGAGGCTGCTGG - Intergenic
1049584658 8:143427300-143427322 AAAGCAAAGGGGGAGGCGGCAGG + Intronic
1049980838 9:902328-902350 AAAAGAAAGGTGGAGGAGGAGGG - Intronic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050192611 9:3044077-3044099 CAAAGGATGGAGGAGAAGGCAGG - Intergenic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051897676 9:22005832-22005854 CACAGGAAGGAGGAGCCGACCGG - Exonic
1053343471 9:37360371-37360393 CAACAAAAGGAGGATGCTGCTGG + Intergenic
1053795877 9:41726445-41726467 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054149302 9:61588428-61588450 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054184284 9:61938516-61938538 CAAATTATGGAGGAGGGGGCAGG - Intergenic
1054469064 9:65519539-65519561 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1054654222 9:67649979-67650001 CAAATTATGGAGGAGGGGGCAGG + Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058872686 9:109216206-109216228 TTAAGAAAGGAGGTGGAGGCGGG + Intronic
1059438955 9:114292034-114292056 CTAAGGCAGGAGGAGGCGGAGGG - Intronic
1060838811 9:126778286-126778308 CAAAGAAAAGAAGAGGGGGAGGG - Intergenic
1061013945 9:127971343-127971365 AATGGAAAGGAGGAGGGGGCTGG - Intronic
1061118081 9:128627255-128627277 CAAAGATGAGAGGAGGAGGCTGG - Intronic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061844729 9:133380861-133380883 CCAAGAGAGGAGGAGGCTGTGGG - Intronic
1061869233 9:133511376-133511398 CATGGAAAGTTGGAGGCGGCAGG - Intergenic
1062051075 9:134447420-134447442 CAGAGGGAGGAGGATGCGGCTGG + Intergenic
1062606692 9:137351695-137351717 CACAGAAAGCAGGGGGCAGCTGG - Intronic
1203490327 Un_GL000224v1:98557-98579 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1203502950 Un_KI270741v1:40438-40460 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1186069965 X:5808815-5808837 AAAAGGAAGGAGGAAGCAGCAGG - Intergenic
1186168248 X:6849735-6849757 CATAGAAAGGAGGAAGCGGATGG + Intergenic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187025670 X:15433572-15433594 GAAAGAAATGAGGAGGAGGAAGG + Intronic
1187196969 X:17096361-17096383 GAAAGAAAAGAGGAAGAGGCCGG + Intronic
1187707902 X:22025621-22025643 CAAAGAGAGGAGGAGGCAAGCGG - Intergenic
1187815365 X:23225692-23225714 TAAAGAAAGGCGGAGGCTGAGGG - Intergenic
1189322140 X:40093393-40093415 TAAAGAAAGGAAGAGGAGGGAGG + Intronic
1189511973 X:41671997-41672019 CAAAGAAAAGAGGACTGGGCAGG - Intronic
1189722540 X:43934763-43934785 AAAAGAAAAGAGAAGGCTGCAGG - Intergenic
1189763430 X:44345037-44345059 CAAATACAGATGGAGGCGGCAGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190794525 X:53728704-53728726 GAAAGACAGGAGTAGGCGTCAGG + Intergenic
1191171469 X:57451818-57451840 CAAAGAAAGCAGGATGGGGCAGG - Intronic
1191841593 X:65517112-65517134 CAAAGCTAGGAAGAGGCTGCAGG - Intronic
1192217954 X:69177116-69177138 GAAGGGAAGGAGGAGGTGGCAGG - Intergenic
1192533642 X:71910791-71910813 AAAAGAGAGGAGGAGGAGGGGGG + Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1194793521 X:98181186-98181208 AAAAGAAAGGAGGAGGATGGAGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1197875169 X:131095269-131095291 CAAAGAATGGAACAGGAGGCAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199294516 X:146141968-146141990 TAAAGAAAGAAGGAGGCAGGAGG + Intergenic
1200377255 X:155796252-155796274 CTCAGAAAGGGGGAGGGGGCAGG - Intergenic