ID: 903180371

View in Genome Browser
Species Human (GRCh38)
Location 1:21602175-21602197
Sequence TGGAGCCCTCTCAGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903180363_903180371 -10 Left 903180363 1:21602162-21602184 CCCACTCCCGTCCTGGAGCCCTC 0: 1
1: 0
2: 0
3: 19
4: 227
Right 903180371 1:21602175-21602197 TGGAGCCCTCTCAGGGGACCTGG 0: 1
1: 0
2: 0
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903180371 Original CRISPR TGGAGCCCTCTCAGGGGACC TGG Intronic
900400118 1:2469593-2469615 TGGGGCCCTCTCAGGGACCCAGG + Intronic
900466867 1:2830027-2830049 GGGAGCCCTCCAGGGGGACCAGG - Intergenic
900637411 1:3672758-3672780 TGGGGCCCTGTCAGGGAACTGGG - Intronic
900643543 1:3698526-3698548 AGGAGGCCTCTCAGGGGAGGTGG + Intronic
900806859 1:4773269-4773291 GGGAGCCCTTTCTGGGGGCCTGG - Intronic
901082619 1:6592074-6592096 GGCAGCCCTGTCAGGGGTCCTGG + Exonic
901231280 1:7642834-7642856 TCCAGCCATCTCAGGGGGCCCGG + Intronic
903180371 1:21602175-21602197 TGGAGCCCTCTCAGGGGACCTGG + Intronic
905854297 1:41297480-41297502 TGGTGCCCTCTCAGAGGCCAGGG + Intergenic
912848932 1:113104340-113104362 TGGGGATCTCTCAGGGGACTTGG + Intronic
918388611 1:184036447-184036469 CGGAGCGCTCGCAGGAGACCAGG + Intronic
919110947 1:193217784-193217806 TGGAGCCCTAGCCAGGGACCAGG + Intronic
919129381 1:193434064-193434086 TGGGTCCCTCTCAGGACACCTGG + Intergenic
920077451 1:203347726-203347748 TGGAGCTCTCTCAGGGATCGAGG + Exonic
920218291 1:204377297-204377319 TGGAGGCCTCGCATGTGACCAGG + Intronic
922480448 1:225936971-225936993 TAGCACCCTCTCAGGGGAACAGG + Exonic
923001513 1:230009848-230009870 TGCACCCTTCTCAGAGGACCTGG - Intergenic
1066330685 10:34418748-34418770 TAAAGCTCTCTCAGGGGACAAGG - Intronic
1067313013 10:45132935-45132957 TGGAGCCCTCTCTGATGTCCTGG - Intergenic
1068523847 10:58106099-58106121 TGGTGCCCACTCAGGGGGACCGG - Intergenic
1070156553 10:73839248-73839270 TGCAGCCCTCCCAGGGCATCGGG + Intronic
1070822880 10:79372999-79373021 TGGCGCTCTCTGAGGGCACCTGG - Intergenic
1070961724 10:80504334-80504356 TGGGAACCTCTGAGGGGACCTGG + Intronic
1071143351 10:82539001-82539023 TGAAGCCCTCTCAGGGTATTAGG - Intronic
1071689267 10:87798119-87798141 TTGAGCCCTCTCAGAGGTCATGG + Intronic
1075167862 10:120085407-120085429 TGGTGGCCTCTCAAGTGACCGGG + Intergenic
1076992795 11:284485-284507 TGGAGCCCTCGCTGGGGGTCAGG - Exonic
1077295729 11:1825464-1825486 TGGAGCCAACTCAGGGGAGCTGG + Intergenic
1077300228 11:1843302-1843324 TGGACCCCTTGCAGGGGACATGG + Intergenic
1077338547 11:2016068-2016090 TGGAGGTCTCTCAAGGGGCCTGG + Intergenic
1077445912 11:2590768-2590790 TGGAGCCCTCCCATGGGGCATGG - Intronic
1077529372 11:3088012-3088034 TGGGCCCCTCTCAGGGGCACTGG - Exonic
1077968277 11:7159503-7159525 TGAAGCTCTCTTAAGGGACCTGG - Intergenic
1078987141 11:16607336-16607358 TGGAGCCCGCCCAGGTAACCGGG - Intronic
1079019542 11:16897858-16897880 TGCAAGCCTCTCAGGGGACAAGG + Intronic
1079185406 11:18231709-18231731 TGGAGCTGTCTCAGGTGAGCAGG - Intronic
1083493261 11:63028482-63028504 TAGAGCCCTCTCAGGTAACCAGG + Intergenic
1083619610 11:64042393-64042415 TGGACCCCTCTCTGGGGAATGGG + Intronic
1083931591 11:65849337-65849359 AGGACCCCTCTCTGGTGACCTGG + Intronic
1084696131 11:70756583-70756605 TGCTGCCCTCTCTGGGGTCCAGG + Intronic
1085383436 11:76141071-76141093 AGAAGCCCTCTCCGGGCACCGGG + Exonic
1085387856 11:76167495-76167517 TCGACGCCTCTCAGGGGTCCTGG - Intergenic
1085430768 11:76445628-76445650 CGGAGCCCGCTCGGGGAACCAGG - Intronic
1088835372 11:113574196-113574218 TCCAGCCCTCTATGGGGACCTGG - Intergenic
1089182138 11:116590422-116590444 TGGAGCCCTCTCAGGAGGTGGGG - Intergenic
1090966288 11:131600155-131600177 AGCAGCCCTCTCTGGGGATCTGG + Intronic
1202821531 11_KI270721v1_random:71250-71272 TGGAGGTCTCTCAAGGGGCCTGG + Intergenic
1091796008 12:3297857-3297879 TGCAGGCATCCCAGGGGACCCGG + Intergenic
1093198251 12:16155140-16155162 AGGAGCCCTCTCAGAGGACTTGG - Intergenic
1096472615 12:51888883-51888905 TGAACCCCTCTCAGGGAGCCAGG - Intronic
1097794392 12:63845989-63846011 TGGAGTCCTGTGAGAGGACCTGG + Intronic
1102006954 12:109595214-109595236 TGGACCCCTCTTAGGAGCCCAGG - Intronic
1103560894 12:121793003-121793025 TGGAGGCCGCTCAGGGGCGCTGG - Intronic
1106480276 13:30132670-30132692 AGGAGCCCTCTCAAAGGAGCCGG - Intergenic
1107181584 13:37467325-37467347 TGGAATCTTCTCAGAGGACCTGG + Intergenic
1110355496 13:74562183-74562205 TGGGACCCTCTCCTGGGACCAGG + Intergenic
1110371312 13:74743569-74743591 TAGAGCCTTCCCTGGGGACCAGG - Intergenic
1113208187 13:107941752-107941774 TGGAGCCTGCTCAGGGGAAGAGG - Intergenic
1113295506 13:108955124-108955146 TGGTGCCATCTCAGGGGAGCAGG - Intronic
1113454036 13:110434804-110434826 TGGAGCCATCTCAGGGACCAGGG + Intronic
1113542387 13:111119040-111119062 TGGAGCCTTCTGAGGGCACGAGG - Intronic
1113801811 13:113090608-113090630 TGGAGCTCTCGCAGGTGAGCAGG - Intronic
1114699772 14:24665273-24665295 AGGAGGCCTCTAAGGGGACCAGG - Intergenic
1116523747 14:45880130-45880152 TGGATCCCTCACCAGGGACCCGG - Intergenic
1119139980 14:72258091-72258113 TGGAGCACTCTCTGGGGATTTGG + Intronic
1119388675 14:74275619-74275641 TGGTGCTGTCCCAGGGGACCTGG - Intergenic
1119480770 14:74956228-74956250 AGGAAACCTCTCAGGGCACCTGG + Intergenic
1119552414 14:75524506-75524528 TGTAGCACTCTCAGATGACCAGG + Intronic
1121336626 14:93081766-93081788 TAAAGCCCTCTCAGGGGGCGGGG + Intronic
1122722184 14:103728294-103728316 TTGAGCCATCTCTGGGGACCTGG + Intronic
1123921584 15:25073731-25073753 TGACGCCCTCCCAGGGTACCCGG + Intergenic
1124966516 15:34436680-34436702 TGGAGCCCTGCTTGGGGACCGGG + Intronic
1129867840 15:78922789-78922811 TGCAGCCCTCACAGGGCCCCAGG - Intronic
1131631447 15:94181195-94181217 TGGAGACCACACAGGGAACCTGG + Intergenic
1132226253 15:100144012-100144034 TGGAGCCTTCTCAGGGTATGTGG + Intronic
1132326358 15:100973533-100973555 TGGAGCCCTTCCAGGGCACCGGG - Intronic
1132852985 16:2033158-2033180 TGGAGCCTTCGCAGGGGAGCGGG + Intronic
1132958396 16:2608758-2608780 TGGAGCCCTCTCAGGAGCAGGGG - Intergenic
1132971008 16:2688854-2688876 TGGAGCCCTCTCAGGAGCAGGGG - Intronic
1134025983 16:10954311-10954333 TGAAGCCCTCGCAGAGAACCAGG + Intronic
1136108934 16:28052616-28052638 TGGTGACCTCACTGGGGACCTGG - Intronic
1138344544 16:56311945-56311967 TGGTGCCCACCCAGGGGAACCGG - Intronic
1139594259 16:67948896-67948918 TGGAGCCTGCTCAGGGGTACAGG + Intronic
1141391667 16:83669645-83669667 CTGAGGCCTCTCAGGGGACAGGG - Intronic
1142050892 16:87957472-87957494 TGGAGTCCTGTCAGGAGACCTGG + Intronic
1142218716 16:88842390-88842412 TGGCTCCGTCTCAGGGTACCTGG - Intronic
1142253688 16:89003739-89003761 TGGAGCCCTCAGAGGGGGCTGGG + Intergenic
1142266593 16:89066815-89066837 TGGAGCACTCTGAGAGGACGGGG - Intergenic
1142624072 17:1180977-1180999 TGGGGCCCACCCAGGGGGCCCGG + Intronic
1144045293 17:11449732-11449754 TGGAGCCCTCAGAAGGAACCAGG - Intronic
1145279302 17:21456242-21456264 TGGAGCCCTCACGGGGCAGCGGG + Intergenic
1147447053 17:40480820-40480842 TGGACCCCTCTCACAGGAACAGG + Intronic
1148104538 17:45112370-45112392 TGGGGCCATCTCAGGGCCCCAGG + Exonic
1149480498 17:56999553-56999575 GGGAGCTTTCTCAGGGGACATGG + Intronic
1150609537 17:66722979-66723001 TGAAGCCCTCTAAGGGGTCTGGG - Intronic
1151315088 17:73316971-73316993 TGGAGCCCTTTCATGGGGCTGGG + Intergenic
1151364966 17:73611390-73611412 TGGAGGCCTCTGAGTGGCCCTGG - Intronic
1152019210 17:77771718-77771740 AGGGGCCCTCTCAGGGGCCTGGG + Intergenic
1152617530 17:81344952-81344974 AGGAGCCCGCTCAGGCCACCCGG + Intergenic
1152702403 17:81825535-81825557 TGCAGCCCTCACAGAGGGCCAGG + Exonic
1157338768 18:46759912-46759934 TGGAGCCCTTACAAGGGACTGGG + Intergenic
1160530363 18:79558914-79558936 TGGAGCCCTCCCTGAGCACCAGG + Intergenic
1161396258 19:4046261-4046283 GGAAGCCATCGCAGGGGACCTGG - Exonic
1161606315 19:5216734-5216756 AGGAGCCCCCTCAGGGAGCCGGG - Exonic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1163617020 19:18335410-18335432 TGGAGCCCTAGCCAGGGACCAGG - Intergenic
1163699687 19:18781084-18781106 TGGAGCCGTCTCAGAGGCCGAGG + Exonic
1163863500 19:19754650-19754672 TGGAGGCTTGTCAGGGGACCAGG - Intergenic
1165191238 19:34065633-34065655 TGGAGCCCTCTTTGTGGAACTGG + Intergenic
1166198284 19:41220439-41220461 GGGAGCCCTCCCAAGGGACTGGG - Intronic
1167349226 19:48964467-48964489 TGGAGCTCTTTCAGGGGCCCAGG - Intergenic
1167584432 19:50365613-50365635 TGGAGACATCGCTGGGGACCTGG + Exonic
1167752500 19:51389225-51389247 AGGAGGCCTCCCAGGGGACGCGG - Exonic
927249939 2:20988465-20988487 AGGAGGTTTCTCAGGGGACCAGG - Intergenic
927847733 2:26480046-26480068 TTGAGGCCTCTCAGGGGAAAGGG + Intronic
932378211 2:71257018-71257040 TGAAGCTCTCTCAGGGGGTCTGG + Intergenic
932667280 2:73708013-73708035 TGGAGCCCTCTCCTGGGAACCGG + Intergenic
933229379 2:79788588-79788610 TGGAGTCCTCTCACGGAAGCAGG - Intronic
933236806 2:79873547-79873569 TGGAGCCCTGTCAGGTGAAAGGG + Intronic
934337519 2:92210685-92210707 TGGAGCGCTCTCAGGACTCCCGG + Intergenic
935203220 2:100876398-100876420 TGAAGCCCTCTTAGGAGACGTGG - Intronic
935205571 2:100893949-100893971 TGAGGCCCTCTCTGGAGACCTGG + Intronic
937292023 2:120787529-120787551 TGAAGGCCTCTCAGGGGCCCAGG - Intronic
938993385 2:136652681-136652703 TGGAGGCCTGTTAGGAGACCGGG + Intergenic
940610220 2:155980527-155980549 TGGAGCCCTCACTGTGAACCAGG + Intergenic
944525855 2:200618933-200618955 TGGAGCACTTTCACTGGACCAGG + Intronic
944571288 2:201047172-201047194 TAGAGCCCTCTCAGTGCAGCCGG + Intronic
947154955 2:227153189-227153211 TGGGTCCCTCTCAGGAGACTTGG + Intronic
948319534 2:237058443-237058465 TGCACCGCTCTTAGGGGACCTGG + Intergenic
948609372 2:239157059-239157081 TGGAGCCATCTGAGAGGACAGGG - Intronic
948702894 2:239771621-239771643 TGAAGCTCCCTCAGGGGACCAGG - Intronic
948890586 2:240905280-240905302 TGGAGCCAGCCCAGGAGACCGGG - Intergenic
1170820070 20:19750062-19750084 AAGAGCCCTCTCTTGGGACCTGG + Intergenic
1171440903 20:25162109-25162131 TGGAGCCCCGTCTGGGGACATGG - Intergenic
1172511901 20:35506560-35506582 TGGGGCCCAGTCAAGGGACCAGG - Intronic
1172589919 20:36110448-36110470 AGAAGCCCTCTCTGGGGACTGGG - Intronic
1172704534 20:36873161-36873183 TGGCCCCCTCTCTGGGGATCAGG + Intergenic
1172837364 20:37881709-37881731 TGCAGCCCTCTCTGGGAAACAGG + Intergenic
1172843018 20:37913450-37913472 TGCAGCCCTCTCATGCGAGCTGG + Intronic
1174100218 20:48121533-48121555 TGGAGCCCTAGCGGGGAACCCGG - Intergenic
1175667697 20:60874183-60874205 TGAAGCCATCTCAGGGAACAGGG + Intergenic
1176261900 20:64186244-64186266 GGGACCCCTCTCTAGGGACCCGG - Intronic
1178812354 21:35895741-35895763 TGGCACCTTCACAGGGGACCTGG + Intronic
1179156867 21:38858608-38858630 TGAGGCCCTGTCAAGGGACCAGG + Intergenic
1180072579 21:45443682-45443704 CGGAGGCCTCCCTGGGGACCCGG - Intronic
1180219245 21:46347570-46347592 AGGAGCGTTCTCATGGGACCTGG - Intronic
1180225289 21:46388528-46388550 TGGAGCCCACTCAGGGACACGGG - Intronic
1180784517 22:18539380-18539402 AGAAGCCCTCTGAGGGGGCCAGG + Intergenic
1181128094 22:20713433-20713455 AGAAGCCCTCTGAGGGGGCCAGG + Intronic
1181241420 22:21478737-21478759 AGAAGCCCTCTGAGGGGGCCAGG + Intergenic
1182768494 22:32776077-32776099 TGGTGCCCTCACAGAGGACGAGG + Intronic
1182776786 22:32837303-32837325 TGGAGCACTCTCAGGGGATAGGG + Intronic
1183172906 22:36201307-36201329 TGGAACCCCATCAGGGGGCCCGG - Intronic
1183180368 22:36255672-36255694 TGGAACCCCATCAGGGGGCCCGG + Intronic
1183734470 22:39636227-39636249 TGGGGCCATCTCATGGGGCCTGG - Intronic
1184129956 22:42511895-42511917 TGGAGGCCTCCCAGGGGTCTAGG - Exonic
1184140132 22:42573713-42573735 TGGAGGCCTCCCAGGGGTCTAGG - Intronic
1184419551 22:44371730-44371752 AAGAGCCCTCTCAGTGGAACTGG + Intergenic
1184886910 22:47352084-47352106 TGGTGACCTCTCTGGGCACCTGG + Intergenic
1185133908 22:49057730-49057752 TTGATGCCTTTCAGGGGACCAGG + Intergenic
950399696 3:12760437-12760459 GGGAGCCCACCCAGGGGAACTGG - Intronic
950553094 3:13679402-13679424 TGAAGCGCTCTCTGGGGAGCTGG + Intergenic
950963889 3:17132691-17132713 TGAAGCCCTCACAGGGGATTAGG + Intergenic
951033590 3:17908683-17908705 TGTTGCCATCTCAAGGGACCAGG - Intronic
951662806 3:25088525-25088547 TGGAGCATTCTCAAGGGAACCGG + Intergenic
952828681 3:37545183-37545205 TGGAGCTTTCTCAGTGGAGCTGG + Intronic
953099595 3:39811062-39811084 TGGAGCCACCTCAAAGGACCTGG - Intronic
953418452 3:42736277-42736299 TGGATCCCTGGCAGGGGTCCAGG - Intronic
954706872 3:52485619-52485641 TGGAGCCCACTCTGGGACCCTGG - Intronic
956210584 3:66798063-66798085 GGGAGCCCTGTGAGGGGGCCAGG + Intergenic
959068110 3:101677918-101677940 TGCAGCGCTCACAGGGGCCCAGG + Intergenic
959116321 3:102182977-102182999 TGGAGGCCTCTCAGGGGGTTGGG + Intronic
961084805 3:124057658-124057680 TGGAGCCCAGTGAGAGGACCTGG + Intergenic
961101364 3:124201956-124201978 TGGAGCCCTGTGATGGGGCCAGG + Intronic
961493786 3:127275887-127275909 GGGAGGCATCTCAGGAGACCAGG + Intergenic
965168411 3:165227363-165227385 TGCTGCCCACTCAGGGGAGCAGG - Intergenic
967270075 3:187725822-187725844 TGCATACCTCGCAGGGGACCAGG + Intronic
977467042 4:97395796-97395818 TGGAGTCCTTTCAGTGGATCTGG + Intronic
977694492 4:99950636-99950658 TAGAGCCCTGCTAGGGGACCCGG - Intergenic
980081915 4:128353194-128353216 TGGAGCCATTTTAGAGGACCAGG - Intergenic
981114287 4:140971672-140971694 TGGAGCACTCTCAAGGGAAAAGG - Intronic
982026855 4:151259658-151259680 TGGAGACCCATCAGGGCACCTGG + Intronic
985025140 4:185733018-185733040 TGGAGCCTTCACAGGCAACCCGG + Intronic
987371675 5:17199337-17199359 TGGAGGCTTCTCTGGAGACCAGG - Intronic
988427034 5:31075678-31075700 TGCAGGCCTCTCAGAGGACAAGG - Intergenic
989491380 5:42059928-42059950 TGGAGCCCTCTCCAGGGATTCGG - Intergenic
992973383 5:82085476-82085498 TGGAGGCCTGTCATGGGATCGGG + Intronic
996974070 5:129409262-129409284 TGGGGCCCTCTGATGGGGCCAGG - Intergenic
997243189 5:132323560-132323582 TGGAACCCTGTCTGAGGACCGGG + Intronic
998797517 5:145835487-145835509 TGGAGCGCTCCCAGAGCACCCGG + Intergenic
1001364475 5:171122900-171122922 TGAAGCCCTCTGAGTGGACATGG - Intronic
1002585892 5:180247833-180247855 TGTATCCTTCACAGGGGACCCGG - Intronic
1003053929 6:2802619-2802641 TGTAGCCCTCCCAGGCAACCTGG - Intergenic
1003567099 6:7230871-7230893 TGGAGCAGTCATAGGGGACCAGG - Exonic
1005340858 6:24842510-24842532 AGGATCCCTCTCAGGGGGTCGGG - Intronic
1005501217 6:26430694-26430716 CTGAGACCTCTCAGGGCACCAGG + Intergenic
1007512418 6:42383712-42383734 TGTAGCCCACTCTGGGGACTGGG - Intronic
1013152957 6:107464205-107464227 TGGAGCCTTCTCAGGGTATGTGG - Intergenic
1015244436 6:131062101-131062123 TGGAGCCCTCCCTACGGACCCGG - Intronic
1015852583 6:137589251-137589273 CAGAGCCAGCTCAGGGGACCAGG - Intergenic
1016119404 6:140328494-140328516 TGGAGCCCTCTCAGAGCAGAGGG + Intergenic
1018669897 6:166169095-166169117 GGGTGCCCGCTCAGGAGACCGGG - Intergenic
1018710734 6:166496745-166496767 AGGAGCCCTTTCAGGGAGCCTGG + Intronic
1018779212 6:167046744-167046766 TGGAGCCCCCTGAGAGGGCCTGG - Exonic
1018834741 6:167474416-167474438 TGGAGGCATCTCAGGGCACCAGG - Intergenic
1020101755 7:5397737-5397759 TGGAGGCTTCTCTGGGGCCCAGG - Intronic
1024662994 7:51517047-51517069 TGCTGCTCTCTCAGAGGACCAGG - Intergenic
1026898150 7:74022268-74022290 TAGAGCCAGCTCAGGGGAGCAGG + Intergenic
1028491326 7:91415167-91415189 TGGAGCCCTTTCTGTGCACCTGG - Intergenic
1029235159 7:99109375-99109397 GGGAGCCCTCTCAGTTGACTTGG + Intronic
1031977354 7:128102530-128102552 AGGAGCCCTCTGTGGGAACCAGG - Intergenic
1032195520 7:129786218-129786240 CGGAGCCTGCCCAGGGGACCAGG - Intergenic
1032478866 7:132230617-132230639 TGGAGTCCTCGCAGAGGAGCTGG - Intronic
1032995369 7:137440100-137440122 TGGAGCCATCTCCTGGGCCCAGG - Intronic
1034119137 7:148611200-148611222 TGGAGCCCTCACCAGGGACCTGG - Intronic
1034216110 7:149406919-149406941 TTGGGCCCTCTCAGGGCACTTGG - Intergenic
1034699446 7:153083651-153083673 TGGAGCCGTCTCTGGGCACTCGG + Intergenic
1036101598 8:5792872-5792894 AAGAGCCCTCTCTTGGGACCTGG + Intergenic
1036651431 8:10646535-10646557 TGGAGCCCACACTGGGGACCTGG - Intronic
1037551139 8:19972817-19972839 TGGAGCCCTGTCAGCGGAATGGG - Intergenic
1037918238 8:22785729-22785751 AGGTGGCCTCTCCGGGGACCTGG - Intronic
1038248522 8:25881617-25881639 TGGAGCCCTAGCCAGGGACCAGG - Intronic
1042203023 8:66300127-66300149 TGGAGGTCTCTCAAGTGACCTGG - Intergenic
1044321249 8:90803910-90803932 TGGGGCCCTGTCAAGGGAACTGG - Intronic
1044946932 8:97398039-97398061 TTGAGCCAACTCAGGGGGCCTGG + Intergenic
1046654056 8:116874221-116874243 ACGAGCCCGCTCTGGGGACCGGG - Intronic
1047182866 8:122605831-122605853 GAGAGAACTCTCAGGGGACCTGG + Intergenic
1047643589 8:126846550-126846572 TGGGGCCCTCCCAGGGGCCATGG + Intergenic
1049495180 8:142926863-142926885 TGGAGGATTCTCAAGGGACCAGG - Intergenic
1049598805 8:143497767-143497789 CGGAGACCACTGAGGGGACCTGG - Intronic
1049605276 8:143526427-143526449 AGGAGACCCCTCAGGGAACCAGG + Intronic
1049686069 8:143939791-143939813 TGCAGCCCCCTAGGGGGACCTGG + Intronic
1050248669 9:3719845-3719867 TGGAGCCCTGAAAGTGGACCTGG + Intergenic
1053800231 9:41759409-41759431 TGGAGACGTTTCAGGAGACCTGG - Intergenic
1054144963 9:61555426-61555448 TGGAGACGTTTCAGGAGACCTGG + Intergenic
1054188659 9:61971561-61971583 TGGAGACGTTTCAGGAGACCTGG - Intergenic
1054464658 9:65486383-65486405 TGGAGACGTTTCAGGAGACCTGG + Intergenic
1054649862 9:67617056-67617078 TGGAGACGTTTCAGGAGACCTGG + Intergenic
1054932900 9:70654449-70654471 TTGAGCCCTCTCAGAGGTCATGG + Intronic
1057037026 9:91818523-91818545 TGGAGACCCCTCAGGTGACATGG + Intronic
1058671592 9:107364952-107364974 TGGAGCCCTTCCAGGTGACCCGG + Intergenic
1061327878 9:129875127-129875149 TGGAGCCTTCTCCAGGGCCCTGG + Intronic
1061618088 9:131793170-131793192 TGCAGCCTTCTCAGGAGAACTGG + Intergenic
1061804851 9:133132206-133132228 TGGTCCCCTCTCCCGGGACCGGG - Intronic
1061919343 9:133774197-133774219 TGAAGGCCTCACAGAGGACCAGG - Intronic
1062079944 9:134618552-134618574 TGGTTCCCTCTCTGGTGACCAGG + Intergenic
1062278600 9:135742132-135742154 CTGATGCCTCTCAGGGGACCTGG - Intronic
1062367657 9:136218895-136218917 AGGAGCCCTCCCAGGGGCCCTGG - Intronic
1187648302 X:21374049-21374071 GTGAGGCCTCTGAGGGGACCCGG - Intergenic
1191590076 X:62872897-62872919 TTGAGGCCTCTCAGGGGCCTTGG + Intergenic
1192098602 X:68239490-68239512 TGGAGCCCTAGCCAGGGACCGGG + Intronic
1195048844 X:101079029-101079051 TGTGGCCCTCTCAGTGGCCCTGG + Exonic
1195509376 X:105696742-105696764 TGGTTTCCTCTCCGGGGACCAGG + Intronic
1196208717 X:112970815-112970837 TGGATCTCTCTCAGGGGAAAGGG + Intergenic
1197944970 X:131828686-131828708 TGGAGGACTCCCAGGGAACCTGG - Intergenic
1199142689 X:144331794-144331816 TGGAGCCCTAGCCAGGGACCAGG + Intergenic
1199858436 X:151779000-151779022 TGGCTTCCTCTCAGGGGTCCAGG + Intergenic