ID: 903182136

View in Genome Browser
Species Human (GRCh38)
Location 1:21610106-21610128
Sequence CTCTACAAGGTGGGCGCTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182136_903182155 29 Left 903182136 1:21610106-21610128 CCAAGAGCGCCCACCTTGTAGAG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182136_903182153 21 Left 903182136 1:21610106-21610128 CCAAGAGCGCCCACCTTGTAGAG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182136_903182145 -10 Left 903182136 1:21610106-21610128 CCAAGAGCGCCCACCTTGTAGAG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 903182145 1:21610119-21610141 CCTTGTAGAGGGGGCCATCAGGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182136 Original CRISPR CTCTACAAGGTGGGCGCTCT TGG (reversed) Exonic