ID: 903182136 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:21610106-21610128 |
| Sequence | CTCTACAAGGTGGGCGCTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 87 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 9, 4: 77} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 903182136_903182155 | 29 | Left | 903182136 | 1:21610106-21610128 | CCAAGAGCGCCCACCTTGTAGAG | 0: 1 1: 0 2: 0 3: 9 4: 77 |
||
| Right | 903182155 | 1:21610158-21610180 | GCACCACGACGTAGGCATGCAGG | 0: 1 1: 0 2: 0 3: 0 4: 28 |
||||
| 903182136_903182153 | 21 | Left | 903182136 | 1:21610106-21610128 | CCAAGAGCGCCCACCTTGTAGAG | 0: 1 1: 0 2: 0 3: 9 4: 77 |
||
| Right | 903182153 | 1:21610150-21610172 | CTCAGCCTGCACCACGACGTAGG | 0: 1 1: 0 2: 1 3: 7 4: 68 |
||||
| 903182136_903182145 | -10 | Left | 903182136 | 1:21610106-21610128 | CCAAGAGCGCCCACCTTGTAGAG | 0: 1 1: 0 2: 0 3: 9 4: 77 |
||
| Right | 903182145 | 1:21610119-21610141 | CCTTGTAGAGGGGGCCATCAGGG | 0: 1 1: 0 2: 0 3: 6 4: 62 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 903182136 | Original CRISPR | CTCTACAAGGTGGGCGCTCT TGG (reversed) | Exonic | ||