ID: 903182141

View in Genome Browser
Species Human (GRCh38)
Location 1:21610115-21610137
Sequence GATGGCCCCCTCTACAAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182141_903182157 27 Left 903182141 1:21610115-21610137 CCCACCTTGTAGAGGGGGCCATC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 903182157 1:21610165-21610187 GACGTAGGCATGCAGGAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 147
903182141_903182153 12 Left 903182141 1:21610115-21610137 CCCACCTTGTAGAGGGGGCCATC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182141_903182155 20 Left 903182141 1:21610115-21610137 CCCACCTTGTAGAGGGGGCCATC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182141 Original CRISPR GATGGCCCCCTCTACAAGGT GGG (reversed) Exonic