ID: 903182142

View in Genome Browser
Species Human (GRCh38)
Location 1:21610116-21610138
Sequence TGATGGCCCCCTCTACAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182142_903182153 11 Left 903182142 1:21610116-21610138 CCACCTTGTAGAGGGGGCCATCA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182142_903182157 26 Left 903182142 1:21610116-21610138 CCACCTTGTAGAGGGGGCCATCA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903182157 1:21610165-21610187 GACGTAGGCATGCAGGAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 147
903182142_903182155 19 Left 903182142 1:21610116-21610138 CCACCTTGTAGAGGGGGCCATCA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182142 Original CRISPR TGATGGCCCCCTCTACAAGG TGG (reversed) Exonic