ID: 903182142 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:21610116-21610138 |
Sequence | TGATGGCCCCCTCTACAAGG TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 85 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 81} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
903182142_903182153 | 11 | Left | 903182142 | 1:21610116-21610138 | CCACCTTGTAGAGGGGGCCATCA | 0: 1 1: 0 2: 0 3: 3 4: 81 |
||
Right | 903182153 | 1:21610150-21610172 | CTCAGCCTGCACCACGACGTAGG | 0: 1 1: 0 2: 1 3: 7 4: 68 |
||||
903182142_903182157 | 26 | Left | 903182142 | 1:21610116-21610138 | CCACCTTGTAGAGGGGGCCATCA | 0: 1 1: 0 2: 0 3: 3 4: 81 |
||
Right | 903182157 | 1:21610165-21610187 | GACGTAGGCATGCAGGAAGTTGG | 0: 1 1: 0 2: 0 3: 7 4: 147 |
||||
903182142_903182155 | 19 | Left | 903182142 | 1:21610116-21610138 | CCACCTTGTAGAGGGGGCCATCA | 0: 1 1: 0 2: 0 3: 3 4: 81 |
||
Right | 903182155 | 1:21610158-21610180 | GCACCACGACGTAGGCATGCAGG | 0: 1 1: 0 2: 0 3: 0 4: 28 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
903182142 | Original CRISPR | TGATGGCCCCCTCTACAAGG TGG (reversed) | Exonic | ||