ID: 903182144

View in Genome Browser
Species Human (GRCh38)
Location 1:21610119-21610141
Sequence CCCTGATGGCCCCCTCTACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182144_903182155 16 Left 903182144 1:21610119-21610141 CCTTGTAGAGGGGGCCATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182144_903182153 8 Left 903182144 1:21610119-21610141 CCTTGTAGAGGGGGCCATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182144_903182157 23 Left 903182144 1:21610119-21610141 CCTTGTAGAGGGGGCCATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 903182157 1:21610165-21610187 GACGTAGGCATGCAGGAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182144 Original CRISPR CCCTGATGGCCCCCTCTACA AGG (reversed) Exonic