ID: 903182146

View in Genome Browser
Species Human (GRCh38)
Location 1:21610133-21610155
Sequence GCTGAGGGCGGGGGCCCTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 416}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182146_903182159 25 Left 903182146 1:21610133-21610155 CCATCAGGGCCCCCGCCCTCAGC 0: 1
1: 0
2: 1
3: 39
4: 416
Right 903182159 1:21610181-21610203 AAGTTGGACGCGATCATGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 24
903182146_903182157 9 Left 903182146 1:21610133-21610155 CCATCAGGGCCCCCGCCCTCAGC 0: 1
1: 0
2: 1
3: 39
4: 416
Right 903182157 1:21610165-21610187 GACGTAGGCATGCAGGAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 147
903182146_903182153 -6 Left 903182146 1:21610133-21610155 CCATCAGGGCCCCCGCCCTCAGC 0: 1
1: 0
2: 1
3: 39
4: 416
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182146_903182158 24 Left 903182146 1:21610133-21610155 CCATCAGGGCCCCCGCCCTCAGC 0: 1
1: 0
2: 1
3: 39
4: 416
Right 903182158 1:21610180-21610202 GAAGTTGGACGCGATCATGTCGG 0: 1
1: 0
2: 0
3: 4
4: 36
903182146_903182155 2 Left 903182146 1:21610133-21610155 CCATCAGGGCCCCCGCCCTCAGC 0: 1
1: 0
2: 1
3: 39
4: 416
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182146 Original CRISPR GCTGAGGGCGGGGGCCCTGA TGG (reversed) Exonic