ID: 903182153

View in Genome Browser
Species Human (GRCh38)
Location 1:21610150-21610172
Sequence CTCAGCCTGCACCACGACGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182146_903182153 -6 Left 903182146 1:21610133-21610155 CCATCAGGGCCCCCGCCCTCAGC 0: 1
1: 0
2: 1
3: 39
4: 416
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182144_903182153 8 Left 903182144 1:21610119-21610141 CCTTGTAGAGGGGGCCATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182142_903182153 11 Left 903182142 1:21610116-21610138 CCACCTTGTAGAGGGGGCCATCA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182141_903182153 12 Left 903182141 1:21610115-21610137 CCCACCTTGTAGAGGGGGCCATC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68
903182136_903182153 21 Left 903182136 1:21610106-21610128 CCAAGAGCGCCCACCTTGTAGAG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 903182153 1:21610150-21610172 CTCAGCCTGCACCACGACGTAGG 0: 1
1: 0
2: 1
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182153 Original CRISPR CTCAGCCTGCACCACGACGT AGG Exonic