ID: 903182155

View in Genome Browser
Species Human (GRCh38)
Location 1:21610158-21610180
Sequence GCACCACGACGTAGGCATGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182149_903182155 -9 Left 903182149 1:21610144-21610166 CCCGCCCTCAGCCTGCACCACGA 0: 1
1: 0
2: 2
3: 21
4: 293
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182146_903182155 2 Left 903182146 1:21610133-21610155 CCATCAGGGCCCCCGCCCTCAGC 0: 1
1: 0
2: 1
3: 39
4: 416
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182150_903182155 -10 Left 903182150 1:21610145-21610167 CCGCCCTCAGCCTGCACCACGAC 0: 1
1: 0
2: 2
3: 27
4: 374
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182147_903182155 -7 Left 903182147 1:21610142-21610164 CCCCCGCCCTCAGCCTGCACCAC 0: 1
1: 0
2: 4
3: 84
4: 887
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182142_903182155 19 Left 903182142 1:21610116-21610138 CCACCTTGTAGAGGGGGCCATCA 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182136_903182155 29 Left 903182136 1:21610106-21610128 CCAAGAGCGCCCACCTTGTAGAG 0: 1
1: 0
2: 0
3: 9
4: 77
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182148_903182155 -8 Left 903182148 1:21610143-21610165 CCCCGCCCTCAGCCTGCACCACG 0: 1
1: 0
2: 2
3: 25
4: 351
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182141_903182155 20 Left 903182141 1:21610115-21610137 CCCACCTTGTAGAGGGGGCCATC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28
903182144_903182155 16 Left 903182144 1:21610119-21610141 CCTTGTAGAGGGGGCCATCAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 903182155 1:21610158-21610180 GCACCACGACGTAGGCATGCAGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182155 Original CRISPR GCACCACGACGTAGGCATGC AGG Exonic