ID: 903182519

View in Genome Browser
Species Human (GRCh38)
Location 1:21612082-21612104
Sequence CGTCAAAGGTGACGATGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903182515_903182519 30 Left 903182515 1:21612029-21612051 CCCAAGCTTCTGATAAATGACGC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 903182519 1:21612082-21612104 CGTCAAAGGTGACGATGAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 56
903182516_903182519 29 Left 903182516 1:21612030-21612052 CCAAGCTTCTGATAAATGACGCC 0: 1
1: 0
2: 1
3: 1
4: 55
Right 903182519 1:21612082-21612104 CGTCAAAGGTGACGATGAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 56
903182517_903182519 8 Left 903182517 1:21612051-21612073 CCAAACTTGAAGTTATTGCTGAT 0: 1
1: 0
2: 0
3: 16
4: 161
Right 903182519 1:21612082-21612104 CGTCAAAGGTGACGATGAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903182519 Original CRISPR CGTCAAAGGTGACGATGAGC CGG Exonic
901957700 1:12798239-12798261 GGTCATAGGTGGCCATGAGCAGG - Intergenic
901965694 1:12863992-12864014 GGTCATAGGTGGCCATGAGCAGG - Intronic
901981093 1:13034370-13034392 GGTCATAGGTGGCCATGAGCAGG - Intronic
902000994 1:13194560-13194582 GGTCATAGGTGGCCATGAGCAGG + Intergenic
902020224 1:13340264-13340286 GGTCATAGGTGGCCATGAGCAGG + Intergenic
902686294 1:18079825-18079847 GGACAAGGGTGACGTTGAGCTGG + Intergenic
903182519 1:21612082-21612104 CGTCAAAGGTGACGATGAGCCGG + Exonic
907740449 1:57160648-57160670 AGTCAAAGGTGAAGAGGACCAGG + Intronic
910146486 1:84086182-84086204 CATCAAAGATGAGGATCAGCTGG + Intronic
920857390 1:209674405-209674427 CTTCAAAGCTGAAGTTGAGCTGG + Intergenic
1081871805 11:46386170-46386192 GGTCAAAGCTGATGATGAGAAGG + Exonic
1083026586 11:59556291-59556313 CGGCAAAATTGACAATGAGCAGG - Intergenic
1083475153 11:62910527-62910549 TGCCAAAGGTGATGATGGGCTGG + Exonic
1092938387 12:13385427-13385449 CTTCAAAGGTAACTATGCGCTGG - Intronic
1093191747 12:16082662-16082684 CGCCAAAGGTGAAGGGGAGCTGG - Intergenic
1096106956 12:49001679-49001701 CTTCCAAGGTGAGAATGAGCTGG - Intergenic
1096227055 12:49872670-49872692 CGTCAAAGGTGAGGAGGTGGGGG + Intronic
1096711244 12:53457996-53458018 AGTCAGAGGTTACGGTGAGCCGG - Intronic
1098108552 12:67096879-67096901 TGTCACAGGTGAAGATGAGTAGG + Intergenic
1116561891 14:46390283-46390305 TGTCACAGGTGAAGATCAGCAGG - Intergenic
1120215822 14:81679717-81679739 CGTGAAAGGTGACAACGTGCTGG - Intergenic
1125405154 15:39345073-39345095 TGTCAAAGGTAACAATGAGAGGG + Intergenic
1132698391 16:1211993-1212015 CGAAGAAGCTGACGATGAGCAGG - Exonic
1136275651 16:29177918-29177940 CGTAAACGCTGACGATGGGCGGG - Intergenic
1142080007 16:88143973-88143995 CGTAAACGCTGACGATGGGCGGG - Intergenic
1161061468 19:2217259-2217281 GGTCACAGGTGACGTTGGGCAGG + Intronic
1162138495 19:8571013-8571035 CATCAATGGTGGCCATGAGCTGG + Intronic
1164696045 19:30245155-30245177 GGTAAAAGGTGAGGATGAGGGGG - Intronic
1165052201 19:33148903-33148925 CATCAAAGGTGAGGGTGTGCGGG + Exonic
935109013 2:100074722-100074744 CATCCAAGGTGAGGATGTGCAGG + Intronic
938050087 2:128161706-128161728 CTTCAAAGGTGATGATGAATTGG + Intronic
944581844 2:201138405-201138427 CGTCAATGATCGCGATGAGCTGG - Intronic
1175496599 20:59418765-59418787 CTTCAAAGGTGATCGTGAGCAGG - Intergenic
1175832629 20:61974560-61974582 TGTCACAGGTGGAGATGAGCTGG - Intronic
1185205328 22:49534640-49534662 CGTTAAATGTCACGCTGAGCGGG - Intronic
951855459 3:27192043-27192065 CGTCACATGTCACCATGAGCTGG - Intronic
954414706 3:50387567-50387589 CGCCAAGGCTGACGCTGAGCTGG - Exonic
962285397 3:134081672-134081694 TGTCAAAGGTGACATTGAGATGG - Intronic
968518092 4:1023254-1023276 TTTCAAAGGGGACGATGACCGGG + Intronic
968753777 4:2404022-2404044 CCTCAAAGCTGAAGATGGGCCGG + Intronic
974989253 4:69063997-69064019 CATCAAAGGGGAAGATGAGATGG + Intronic
982432733 4:155340655-155340677 GGGCAAAGGTGATGATGAACTGG - Intergenic
998326857 5:141288576-141288598 GGTCACAGGTGACTATGAGACGG + Intergenic
998998925 5:147898336-147898358 CGATGAAGGTGATGATGAGCAGG + Intronic
1004732101 6:18367982-18368004 CGTCAACGATCTCGATGAGCTGG - Intergenic
1010580365 6:77589194-77589216 TGTTAAAGGTGATGATGAGAGGG - Intergenic
1020418433 7:7970621-7970643 TGTCAAAGGTAATGGTGAGCTGG + Intronic
1032019382 7:128398578-128398600 CGTCAATGATTGCGATGAGCTGG - Exonic
1043721549 8:83550803-83550825 CACCAAAGGTGAGGATGTGCTGG + Intergenic
1047275318 8:123401208-123401230 CGTCAATGACGATGATGAGCTGG + Intronic
1060441489 9:123643886-123643908 GTTCAAAGGTGACGACGACCAGG + Intronic
1060894191 9:127207225-127207247 TGTACAAGGTGATGATGAGCAGG - Intronic
1061391675 9:130320429-130320451 CGTGACCAGTGACGATGAGCCGG - Intronic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1186561987 X:10622357-10622379 CCTCAAAGGTAAATATGAGCTGG + Intronic
1189659207 X:43278994-43279016 CGTCAATGATCACAATGAGCTGG - Intergenic
1196117847 X:112016465-112016487 AGTCCAAGGTAAGGATGAGCTGG + Intronic