ID: 903184487

View in Genome Browser
Species Human (GRCh38)
Location 1:21621709-21621731
Sequence CATGCCCAGCTGAGGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903184487_903184492 3 Left 903184487 1:21621709-21621731 CCACACAACCTCAGCTGGGCATG 0: 1
1: 0
2: 2
3: 24
4: 226
Right 903184492 1:21621735-21621757 CCAAAGAGTCACACTGATGATGG 0: 1
1: 0
2: 0
3: 12
4: 141
903184487_903184493 4 Left 903184487 1:21621709-21621731 CCACACAACCTCAGCTGGGCATG 0: 1
1: 0
2: 2
3: 24
4: 226
Right 903184493 1:21621736-21621758 CAAAGAGTCACACTGATGATGGG 0: 1
1: 0
2: 1
3: 15
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903184487 Original CRISPR CATGCCCAGCTGAGGTTGTG TGG (reversed) Intronic
900439885 1:2649240-2649262 GATGCTCACCTGGGGTTGTGGGG - Intronic
900439979 1:2649839-2649861 GATGCTCACCTGAGGGTGTGAGG - Intronic
900440052 1:2650290-2650312 GATGCTCACCTGAGGGTGTGGGG - Intronic
900440086 1:2650495-2650517 CATGCTCACCTGGGGTAGTGGGG - Intronic
900588896 1:3450298-3450320 CATGCCCAGCTGATCCTTTGGGG + Intergenic
901231227 1:7642600-7642622 CTGGCCCAGCTGAGGCTCTGCGG - Intronic
902542297 1:17163765-17163787 CATGCCCTACTGTGGATGTGCGG + Intergenic
903184487 1:21621709-21621731 CATGCCCAGCTGAGGTTGTGTGG - Intronic
903443054 1:23402594-23402616 CAGCCTCAGCTGAGGTGGTGAGG - Intronic
906414564 1:45610754-45610776 CATGCCCAGCTGGGGTGCAGTGG + Intronic
908596947 1:65698113-65698135 CGTGCCCGGTTGAGCTTGTGAGG + Intergenic
911470713 1:98314801-98314823 CATGGCCAACTGTGGCTGTGTGG + Intergenic
912398187 1:109365377-109365399 CATGCCCAGCTAATTTTGTGAGG + Intronic
913045603 1:115071147-115071169 CAGGCCCAGGGGAGGGTGTGAGG + Intronic
914682006 1:149945020-149945042 CATCTCCAGCTGAGGCGGTGGGG + Exonic
916595231 1:166236479-166236501 CCTGAGCAGCTGATGTTGTGTGG + Intergenic
917303747 1:173606116-173606138 CCAGCCCAGCTGATGCTGTGTGG - Intergenic
917660438 1:177172099-177172121 CCTGCCCAGCTGACGCTGGGAGG + Intronic
918745049 1:188187993-188188015 CATCCCCAGCTGATGATCTGTGG + Intergenic
921670826 1:217922008-217922030 TATGCCCAGCTCAGGTTGGGAGG + Intergenic
922567132 1:226608138-226608160 GAGGCCAAGCTGGGGTTGTGGGG - Exonic
1063761810 10:9087337-9087359 CATGCCCAGCTCAGTTTGTCTGG - Intergenic
1067380808 10:45771462-45771484 AATGCTCAGCTGAGGGTGTTGGG - Intronic
1067888507 10:50112113-50112135 AATGCTCAGCTGAGGGTGTTGGG - Intronic
1068717053 10:60200171-60200193 CCGGCCAAGCTGAAGTTGTGCGG - Exonic
1070401504 10:76056862-76056884 CATGCCCTCCTGAGTTGGTGGGG - Intronic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1075223675 10:120605923-120605945 CTTGCCCAGCTGAGGGCCTGGGG - Intergenic
1075242799 10:120793316-120793338 GATGCCCAGCTCAGTATGTGTGG - Intergenic
1075446572 10:122517585-122517607 CAGGCCTCGCTGAGGTTGTGTGG + Intergenic
1076340678 10:129742908-129742930 CATGGGCAGCTGCGGTGGTGGGG - Intronic
1076653982 10:132009032-132009054 CATTCTCAGCAGAGGTTCTGAGG + Intergenic
1076705110 10:132297218-132297240 CATGTCCTGCAGAGGGTGTGGGG - Intronic
1077870012 11:6253806-6253828 CATGTCCAGCTGAGATTTTATGG + Intergenic
1080655102 11:34252462-34252484 CATGCCCAGCGGTGGTGGGGAGG - Intronic
1084456269 11:69269860-69269882 CAGGCCCACCAGAGGTTGGGAGG - Intergenic
1085590401 11:77754612-77754634 TAGTCCCAGCTAAGGTTGTGGGG + Intronic
1088746867 11:112811299-112811321 CCAGCCCTGCTGAGGTTGGGTGG - Intergenic
1089350137 11:117817362-117817384 CATGTCCAGGTGAGGGTGAGGGG - Intronic
1089372996 11:117974821-117974843 AGTGCCCAGCAGAGGATGTGTGG - Intergenic
1092291343 12:7161071-7161093 GATGCCAAGCTGATGTTCTGGGG + Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1098044083 12:66382080-66382102 CATGCCCAGCTAATTTTGAGGGG - Intronic
1100979818 12:100155247-100155269 CATGTCCAGCTGGGGTATTGGGG - Intergenic
1102563822 12:113781552-113781574 CATACCAAGCTGAGATTTTGAGG - Intergenic
1106466881 13:30021337-30021359 CTTGCCCATCTGCGGTTCTGGGG + Intergenic
1108050421 13:46430280-46430302 CAAGCCCAGCCCAGGCTGTGAGG + Intronic
1108248844 13:48544802-48544824 CACTCCAAGCTGAGGGTGTGAGG - Intergenic
1112676523 13:101708416-101708438 CCTGACCAGCAGAGGTTTTGAGG - Intronic
1113599397 13:111558008-111558030 CAGGCAGAGCTGAGGGTGTGGGG + Intergenic
1115078597 14:29422091-29422113 CATGCACAGCTGAAATTATGAGG - Intergenic
1117161439 14:52994266-52994288 CATTCCCAGCTGTGGCTATGGGG - Intergenic
1117342225 14:54802338-54802360 CTTGGCCAGCTGAGGTGCTGGGG + Intergenic
1117679969 14:58193883-58193905 CAAGCCCAGCTTAGGTTCTAGGG - Intronic
1118569806 14:67183000-67183022 CATGCCCAGCTGATGCTATTGGG + Intergenic
1119954245 14:78778052-78778074 CACACCCAGCTGAGGTTGAAGGG + Intronic
1120091635 14:80339097-80339119 CAAACCAAGCTGAGGATGTGGGG + Intronic
1120922950 14:89771806-89771828 CATTCTCAGCTGAGGTCGTTAGG - Intergenic
1121419382 14:93801954-93801976 CATGGCCAGCTGCTGCTGTGGGG - Intergenic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1125278560 15:38019903-38019925 CATGCCCAGCTGTGGTTCTATGG + Intergenic
1127309479 15:57739738-57739760 CATGCCCAGGGGAGCCTGTGGGG - Intronic
1127656545 15:61061194-61061216 CATGCCCGGCTAATGTTTTGTGG - Intronic
1128717873 15:69921892-69921914 GCTGATCAGCTGAGGTTGTGGGG + Intergenic
1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG + Intergenic
1129237307 15:74231385-74231407 CATGCCCAGCTGAGCCTCTGGGG + Intergenic
1130648790 15:85750598-85750620 CTTGCCCTGCTGAGGGTGTCTGG - Intergenic
1131409243 15:92192461-92192483 CATGGCCAGTTGAGGTTATCAGG - Intergenic
1132125879 15:99223739-99223761 CAAGACCAGCTGATGCTGTGCGG + Intronic
1132556739 16:575954-575976 CCTGCCCAGCTGATGAGGTGTGG + Exonic
1132860894 16:2071255-2071277 CGGGCCCAGCTGTGGTGGTGGGG + Intronic
1133093965 16:3428221-3428243 CATGCCCAGCTAATTTTGTGGGG - Intronic
1133989082 16:10690948-10690970 CATGCTCTGCTGAGGTGCTGGGG + Intronic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1134910665 16:18023389-18023411 CATGACCAACTGAGGCTGGGCGG - Intergenic
1135006632 16:18829616-18829638 CATTCACAGCTGACTTTGTGAGG - Exonic
1136113131 16:28077544-28077566 CATGCTCGGCTGGGGCTGTGGGG + Intergenic
1136253705 16:29024407-29024429 CATACCCAGCTGCTTTTGTGGGG - Intergenic
1136263980 16:29103308-29103330 CATGACCATCTGGGGTTGTCTGG + Intergenic
1137521233 16:49197074-49197096 CATTCACAGCTGATGTTCTGTGG + Intergenic
1138650184 16:58455876-58455898 CAGGCCCTGCTGAGGATGGGAGG - Intergenic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1139953002 16:70680955-70680977 CATTCCCAGCTGAGGTGAGGTGG - Exonic
1140513959 16:75529159-75529181 GATGCCCAGCTGAAGTGGTCTGG + Exonic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1143421781 17:6798927-6798949 CATGGACAGCTGACGGTGTGGGG - Exonic
1145234796 17:21200909-21200931 CATGCTGGGCTGAGGTTCTGGGG - Intronic
1149814186 17:59707052-59707074 AGTGCCCAGCTGAGGGTATGAGG + Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1153630087 18:7061332-7061354 CATGCCTGGCTGTGGTTTTGAGG - Intronic
1157094437 18:44674695-44674717 CCTGGTCAGCTGAGGTTATGAGG - Intergenic
1157319573 18:46623888-46623910 CATGCACAGCGGAGCTGGTGAGG + Intronic
1157553658 18:48598495-48598517 CAGGGCCTGCTGAGGTTGAGGGG + Intronic
1157614676 18:48979460-48979482 GGTGCCCAGCTGAGGGTCTGAGG + Intergenic
1159600769 18:70426742-70426764 CAAGCATAGGTGAGGTTGTGGGG + Intergenic
1159659752 18:71079447-71079469 GATGCCCAGAAAAGGTTGTGTGG + Intergenic
1160901088 19:1429079-1429101 CATGCACAGCAGAGGTGGGGAGG - Intronic
1161291535 19:3496306-3496328 CCTGCCCAGTTGAGGTTGTCTGG + Intronic
1163080413 19:14936149-14936171 AATGCCCTGGTGAGGCTGTGTGG - Intergenic
1163161780 19:15469288-15469310 AAGGCCAGGCTGAGGTTGTGAGG + Intronic
1164513813 19:28917711-28917733 CTTCCCCAGCTGAGGTTCTGTGG - Intergenic
1165128290 19:33616509-33616531 CCTGCCCACCTCAGGCTGTGGGG + Intergenic
1165259002 19:34597269-34597291 CATGCCCACCTGAGGTTACCTGG + Intronic
1165310428 19:35026354-35026376 TTTGCCCGGCTGAGGTTGTGGGG + Exonic
1166255613 19:41602069-41602091 CTTGCCCAGATGAGGCTCTGGGG - Intronic
1166332283 19:42085928-42085950 CATGCCGAGTTGAGTTTTTGGGG + Intergenic
1166415574 19:42592970-42592992 CTTGCCCAGATGAGGCTCTGGGG + Intronic
1166432305 19:42738159-42738181 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166435424 19:42763348-42763370 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166445290 19:42853380-42853402 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166452688 19:42915556-42915578 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166455173 19:42934837-42934859 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166464965 19:43024123-43024145 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166484728 19:43203320-43203342 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1167732379 19:51267963-51267985 CAAGCCCTGCTGAAGATGTGGGG - Intronic
1167791796 19:51688028-51688050 CAGACCCCGCTGAGGCTGTGTGG - Intergenic
925084326 2:1095954-1095976 CATGGCCAACTGAGGGAGTGGGG - Intronic
927999267 2:27508362-27508384 CTTGCCCAGCTGGCTTTGTGAGG - Intronic
928043157 2:27898970-27898992 TGTGCCCAGCTCAGGTTGTTTGG - Intronic
928989174 2:37213566-37213588 CATGCCCAGCTCATTTTTTGGGG + Intronic
932627980 2:73314134-73314156 CTTTCCCACCTGAGGTTGTCTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934866065 2:97812845-97812867 CATGCCCAGCTAATTTTGGGGGG - Intronic
937362168 2:121236971-121236993 AATGCCGAGCTGAGGATGTGCGG + Intronic
938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG + Intergenic
938465751 2:131523806-131523828 CATGCCCATCTGAGGTTTTCGGG - Intergenic
938694129 2:133819860-133819882 CAAGCCCAGCTCAGGCTGTGAGG - Intergenic
942977648 2:182038192-182038214 CATGACCAGCTAATGTTTTGTGG + Intronic
944134324 2:196381649-196381671 CAGACCCAGCTGAGGTTATAAGG + Intronic
944999288 2:205331409-205331431 CTAGCCCAGATGAGGCTGTGAGG - Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
948734153 2:239988582-239988604 CATTCCCACCTGAGCTTGTTCGG - Intronic
1169025592 20:2368467-2368489 AATTCCCAGCTGATGTTCTGGGG + Intergenic
1169338528 20:4777222-4777244 CATGCCCAGCTAATTTTGGGGGG + Intergenic
1170064745 20:12299187-12299209 CATGCACAGCTTTCGTTGTGGGG - Intergenic
1170579627 20:17687943-17687965 CATGGGAAGCTGAGGTTGGGTGG + Intergenic
1170696313 20:18662410-18662432 CATGCCCAGCTGGGGGTGGGGGG + Intronic
1171986253 20:31663498-31663520 CATGCCCAGCCGAGAATTTGTGG - Intergenic
1172373324 20:34414621-34414643 CACGCCCAGCTAATTTTGTGGGG + Intronic
1173460889 20:43242659-43242681 CATGCCCTTCTGAGGTCATGAGG - Intergenic
1173581298 20:44148672-44148694 GATGCCCACCTTAGATTGTGGGG - Intronic
1173882972 20:46432862-46432884 CAAGCCCAGCAGAGGTGCTGAGG - Intronic
1174210791 20:48876272-48876294 CCTGCCCACCTGAGGCTGGGTGG - Intergenic
1174680373 20:52400681-52400703 CATGCCCATCCGAAGTTGTTAGG - Intergenic
1175552071 20:59823944-59823966 CATGCACAGCTCAGCTGGTGTGG + Intronic
1175902276 20:62364694-62364716 GATGCCCACCTGGGGCTGTGAGG + Intronic
1176013178 20:62911436-62911458 CAGGCCCAGCTGCTGCTGTGGGG + Exonic
1179726897 21:43345910-43345932 CAGGCCCAGATGAGATGGTGGGG - Intergenic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1180002833 21:45002822-45002844 CATCCCAAGCAGAGGTCGTGGGG - Intergenic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1184480773 22:44745642-44745664 GATGCCCAGCTTGGGTGGTGAGG - Intronic
1184837303 22:47031604-47031626 CATGCTCAGCTCTGGTGGTGTGG + Intronic
1185173305 22:49305630-49305652 GACGCCCAGCTGAGGCTGTGAGG + Intergenic
1185197968 22:49484154-49484176 GATGCCTGGGTGAGGTTGTGGGG - Intronic
1185253797 22:49820479-49820501 TATTCCCAGCTGAGGCTGGGAGG + Intronic
950327043 3:12120592-12120614 CATGGCCAGGTGTGGTTTTGGGG + Intronic
951794762 3:26525960-26525982 CAGCCCCAGCTTAGGTTGTTGGG + Intergenic
954409954 3:50366155-50366177 CCTGCCCACCTGAGGATGTCAGG + Exonic
954937068 3:54336207-54336229 CCTGCCCAGCTGAGGAAGTCAGG - Intronic
961560407 3:127724782-127724804 GATGCCCAGATGAGCTTGTTTGG - Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
963623960 3:147647582-147647604 TAAGCCCAGCTGAGGCTGGGAGG - Intergenic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
966121607 3:176527933-176527955 CCTGCCCTGCTGAGGCTGTCTGG + Intergenic
968508229 4:982250-982272 GAGGCCAAGCTGAGCTTGTGGGG - Intronic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
969254343 4:5992251-5992273 CGAGCCCGGCTGTGGTTGTGTGG - Intergenic
969869806 4:10097508-10097530 CATGCCCAGCTGAGGGCCTGGGG + Intronic
969939558 4:10717112-10717134 AATGCCCAGCTGGGGTAGTGTGG + Intergenic
972629620 4:40832305-40832327 CATGGCGAGGTGAGGTTGCGAGG - Intronic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
975739688 4:77417735-77417757 AATACTCAGCTGAGGCTGTGAGG + Intronic
980096928 4:128501244-128501266 TCTGCACAGATGAGGTTGTGGGG - Intergenic
980991366 4:139741105-139741127 CCTGCCCAGCTGCGGTGGTGGGG + Intronic
983387377 4:167082629-167082651 CATGTCTTGGTGAGGTTGTGGGG + Intronic
983467668 4:168115041-168115063 CATGCCCAGCTAATTTTGTATGG + Intronic
984559810 4:181254974-181254996 CATGCCCAGCTAAGGGTTTAGGG + Intergenic
984731357 4:183070721-183070743 CATGCCCAGCTGATATGGTTTGG - Intergenic
985759271 5:1736735-1736757 CATGCCCAGCTGAGGAGGTAAGG - Intergenic
986646821 5:9924985-9925007 CAAGCTCAGCTGAGGTTGAGGGG + Intergenic
987943388 5:24571842-24571864 CATGCCCAGCTGAGGTCATGGGG - Intronic
988654781 5:33197884-33197906 CATGCCCAGCTGATTTTGTGAGG - Intergenic
990315964 5:54583710-54583732 CATACCCAGCTGGGGAAGTGGGG - Intergenic
990960189 5:61385878-61385900 CATGGCCAGCTTTGGATGTGGGG + Intronic
994725834 5:103434325-103434347 CATTCACAGCTAAGGTTGGGCGG - Intergenic
998105013 5:139462843-139462865 CATGTCCAGATGAGGATGTGAGG + Intergenic
998372980 5:141672912-141672934 CATGTCCCGCTGAGCTGGTGGGG + Exonic
998656015 5:144180591-144180613 GCTCCCCAGCTGAAGTTGTGTGG - Intronic
998745270 5:145251548-145251570 CATCACCAGCTGAGGTGGTTGGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000246897 5:159455906-159455928 CATGCCCAGCTCTGGCTATGTGG - Intergenic
1001598346 5:172912923-172912945 CATGCCCAGCTAATGTTTTGTGG + Intronic
1002150601 5:177226609-177226631 CATGCCCAGCTTAGGTCATTTGG + Intronic
1004015992 6:11732453-11732475 CATGGCCATCTGTGGCTGTGAGG + Intronic
1005801208 6:29427130-29427152 GTGGCCCAGCTGAGGTTCTGTGG - Exonic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1011023634 6:82841896-82841918 TATGCCCAGCACAGGCTGTGAGG + Intergenic
1011176310 6:84564823-84564845 CATGGCCAGATGAGGATGTAAGG + Intergenic
1018769750 6:166960038-166960060 AATGCCAAGAAGAGGTTGTGTGG - Intergenic
1018850930 6:167589587-167589609 CATGCCCAGCACAGGCTGTGGGG + Intergenic
1018956024 6:168411036-168411058 CATGCCCAGCTCACGTGGAGAGG - Intergenic
1019347476 7:538074-538096 CAGGCCCTGCTTAGGTTCTGGGG + Intergenic
1019649247 7:2147682-2147704 CAGCCACAGCTGGGGTTGTGAGG + Intronic
1019739609 7:2666105-2666127 CAGGCCCAGCAGAGGATGCGGGG + Intergenic
1022535080 7:31093528-31093550 CATGACCAGCTGGGTGTGTGGGG + Intronic
1023906235 7:44523572-44523594 CATGCCCAGCTGATATTTGGTGG - Intronic
1023912512 7:44565992-44566014 CAAGCCCTCCTGAGGTTGTTGGG - Exonic
1024442286 7:49434484-49434506 CAAGCCCAGCTGATGTTGATGGG + Intergenic
1026251115 7:68671612-68671634 CTTGCACATCTGAGATTGTGTGG + Intergenic
1027139127 7:75644726-75644748 CATGCCCAGCTGAGCTGTGGAGG + Intronic
1027230365 7:76268462-76268484 CACTCCCAGCTGAGGCTTTGGGG - Intronic
1027444987 7:78263514-78263536 CATGACCAAGTGAGCTTGTGGGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1029591792 7:101511834-101511856 CATGCCCAGCTAATTTTGGGGGG - Intronic
1029801239 7:102949812-102949834 CATGCCCAGCCTGGATTGTGAGG - Intronic
1031657724 7:124379400-124379422 CACCCCCAGCAGAGGCTGTGTGG + Intergenic
1034052283 7:147996018-147996040 CAGGCCCTTCTGAGGCTGTGAGG + Intronic
1036387580 8:8295500-8295522 CAGGCCAAGGTGAGGCTGTGGGG - Intergenic
1036807550 8:11845849-11845871 CATGACCAGCTGAGTGTGGGGGG - Intronic
1037015547 8:13901817-13901839 CATGAGCAGCTGAGGTTGCCAGG - Intergenic
1038659896 8:29488038-29488060 CATACCCACCTGATGGTGTGTGG + Intergenic
1039115861 8:34090600-34090622 CAAGCCAAACTAAGGTTGTGGGG + Intergenic
1041189575 8:55340260-55340282 CATTTTTAGCTGAGGTTGTGTGG + Intronic
1041831686 8:62162019-62162041 CATGCCCAGTTGTGGGTGTCAGG - Intergenic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1048508572 8:135042393-135042415 GATGCCCAGCTGGGGCAGTGAGG + Intergenic
1049252948 8:141598890-141598912 CAGCTCCAGCTGTGGTTGTGTGG + Intergenic
1049451535 8:142664670-142664692 CGTCGCCAGCAGAGGTTGTGTGG - Exonic
1049537573 8:143189484-143189506 AGTCCACAGCTGAGGTTGTGGGG - Intergenic
1049641441 8:143717784-143717806 GATGCCCAGGTGAGTGTGTGGGG + Exonic
1049655385 8:143794808-143794830 CATCCGCAGCTCAGGGTGTGTGG + Intronic
1049818064 8:144617498-144617520 GATGCCCAGCTGAGCTGGAGGGG - Intergenic
1052531438 9:29689503-29689525 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1060967719 9:127721031-127721053 TGTGCCCAGCCCAGGTTGTGTGG - Intronic
1062494430 9:136825121-136825143 CAGGCCCAGCTGCGATGGTGCGG + Intronic
1062665639 9:137669975-137669997 TAAACCCAGCTGAGGCTGTGTGG - Intronic
1187045847 X:15646993-15647015 CCTGCCCTGCTGAGGATATGTGG + Intronic
1190265111 X:48823492-48823514 CCTGCACAGGTGAGGTTGGGGGG - Exonic
1191862026 X:65673609-65673631 CATGCCCAGCTAATTTTGTATGG + Intronic
1195132585 X:101868455-101868477 CATGCCCAGCTAATTTTCTGGGG + Intergenic
1197932476 X:131710122-131710144 CGTGCCCAGCTAATTTTGTGGGG + Intergenic
1202258877 Y:22948706-22948728 CAAGTCCAGCTGAGGGTCTGGGG - Intergenic
1202411865 Y:24582464-24582486 CAAGTCCAGCTGAGGGTCTGGGG - Intergenic
1202458917 Y:25087608-25087630 CAAGTCCAGCTGAGGGTCTGGGG + Intergenic