ID: 903184771

View in Genome Browser
Species Human (GRCh38)
Location 1:21622687-21622709
Sequence GCGCTCGGGCCGGAACGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903184771_903184774 -10 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184774 1:21622700-21622722 GCCCGAGCGCTAGAAGCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 26
903184771_903184778 -1 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184778 1:21622709-21622731 CTAGAAGCTTTGGGTGCGTCGGG 0: 1
1: 0
2: 0
3: 2
4: 48
903184771_903184782 12 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184782 1:21622722-21622744 GTGCGTCGGGCTCCCCGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 65
903184771_903184777 -2 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184777 1:21622708-21622730 GCTAGAAGCTTTGGGTGCGTCGG 0: 1
1: 0
2: 0
3: 5
4: 58
903184771_903184780 10 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184780 1:21622720-21622742 GGGTGCGTCGGGCTCCCCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 39
903184771_903184784 24 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184784 1:21622734-21622756 CCCCGAGGGGGCCCCCCACTCGG 0: 1
1: 0
2: 1
3: 12
4: 106
903184771_903184779 9 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184779 1:21622719-21622741 TGGGTGCGTCGGGCTCCCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 72
903184771_903184781 11 Left 903184771 1:21622687-21622709 CCTGCGCGTTCCGGCCCGAGCGC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 903184781 1:21622721-21622743 GGTGCGTCGGGCTCCCCGAGGGG 0: 1
1: 0
2: 1
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903184771 Original CRISPR GCGCTCGGGCCGGAACGCGC AGG (reversed) Intronic
903184771 1:21622687-21622709 GCGCTCGGGCCGGAACGCGCAGG - Intronic
910892191 1:92029901-92029923 GCGCCCAGCCCGGAGCGCGCAGG - Intergenic
912471682 1:109911079-109911101 GCGCTGGGCCCGGGACGGGCTGG + Intronic
912927947 1:113929820-113929842 GGGCCCGGGCCGGCTCGCGCGGG + Exonic
914869194 1:151459029-151459051 GGGATGGGGCCGGTACGCGCGGG - Intronic
915511339 1:156388546-156388568 GCGCACGGGCCGGGGCGCGCGGG - Intergenic
915559235 1:156676802-156676824 GCGCGTCGGCCTGAACGCGCAGG - Exonic
920915166 1:210252969-210252991 GCGCGGGGCCCGGAACGCGGTGG - Intergenic
1069709322 10:70478803-70478825 GCGCACGGGCCGGGGCGCGCAGG + Exonic
1070333076 10:75431683-75431705 GCGCGCGGGACGGAGCGCGGGGG - Intronic
1072070226 10:91908502-91908524 GCGTGCGGGCGGGGACGCGCGGG + Exonic
1077107898 11:849827-849849 GCGCGGGGGCCGCAGCGCGCGGG + Intronic
1084154000 11:67303803-67303825 GGGCTCGGGCTGGAGGGCGCTGG + Intronic
1089262435 11:117232230-117232252 GCGCTGGGGGCTGAACCCGCGGG + Exonic
1094470376 12:30796602-30796624 GCGCACGGGCCGGGAGGGGCGGG - Intergenic
1096656975 12:53098023-53098045 GCGCGCGGGCCGGAAGGCAGCGG - Exonic
1103604807 12:122078761-122078783 GCGCGCGGGCCGGGCCGGGCCGG + Exonic
1103698626 12:122835890-122835912 GCGCTCGGGCCCAGAGGCGCCGG + Intronic
1104602488 12:130162807-130162829 GCGCTCGGGCCAGGCCGGGCGGG + Exonic
1113820562 13:113209592-113209614 GCGCTCGGGGCGGGGCGCGGCGG + Exonic
1119330056 14:73787014-73787036 GGGCTCGGGCTGGGCCGCGCGGG - Intronic
1122904463 14:104795488-104795510 GCGCTCGCGCCCGGACGCGGCGG - Intronic
1124629340 15:31327888-31327910 CCGGGCGGGCCGGAACGCCCGGG + Intronic
1125742096 15:41972448-41972470 GCGGGCGGGCGCGAACGCGCTGG - Exonic
1127515536 15:59689471-59689493 GCGCTCGCGCCTGCACTCGCGGG + Exonic
1127606294 15:60591754-60591776 GCGCGCGGGCCGGAGCGAGACGG - Intronic
1135047630 16:19168235-19168257 ACGCCGGGGCCGGAGCGCGCAGG - Exonic
1139467125 16:67159954-67159976 GCCCGCGGGGCGGGACGCGCGGG - Exonic
1139778281 16:69330596-69330618 GCGCTGCGGCCGGAAGGGGCGGG - Intronic
1141889552 16:86917651-86917673 GCGCTCGGCGCGGGACGGGCGGG + Intergenic
1143030366 17:3964147-3964169 GCGCGCGGGCCGGGCCGGGCCGG - Intronic
1143247798 17:5500779-5500801 GCGCGCGGGCGGGAGGGCGCAGG - Intronic
1147183640 17:38702312-38702334 CTGCTCGGGCCCGACCGCGCCGG - Intergenic
1152677302 17:81648217-81648239 GCGCGCGGGGAGGACCGCGCTGG + Exonic
1152689686 17:81712352-81712374 GCGCTGCGGCCGGTACACGCCGG + Exonic
1152721952 17:81927645-81927667 GCGCTCGGCCCGGCCCGCGCAGG - Exonic
1155199396 18:23503787-23503809 ACGCTCGGGCCTGGTCGCGCGGG - Intronic
1157383998 18:47247300-47247322 GCCCACTGGCCGGAAGGCGCTGG + Intronic
1157496657 18:48161693-48161715 GCGCCCGGGCCGGGCCGGGCCGG - Intronic
1160659428 19:291373-291395 GCGGCCGGGCCGGGACGCGACGG - Intronic
1160763632 19:797728-797750 GCGCTAGGGACGGGGCGCGCGGG - Intronic
1160865440 19:1253963-1253985 GCGCCCGGGCCGGGCCGGGCTGG + Intronic
1160930345 19:1567237-1567259 GCGGCGGGGCCGGAGCGCGCAGG + Intronic
1160930529 19:1567835-1567857 GCGCTCGGGCTGGGGGGCGCTGG - Exonic
1162445130 19:10718216-10718238 GCGCTCGGGCCGGGGGCCGCCGG + Exonic
1162778712 19:12995809-12995831 GCGCCCGGGCGGGAGCGCGGCGG - Exonic
1163547403 19:17948304-17948326 GCGCGCGGGCCGCAGTGCGCGGG + Intergenic
1165089191 19:33373825-33373847 CGGCTCGGGCCGCACCGCGCGGG + Exonic
934521991 2:95025587-95025609 GCGCTCGGGCCGGGTCTCCCGGG + Intergenic
937929480 2:127193217-127193239 GCGCTCAGGCCGGAACTCCTTGG + Exonic
946865729 2:224039500-224039522 GGGCTGCGCCCGGAACGCGCCGG + Intergenic
947636084 2:231681288-231681310 CCGCGCGGGCCGGAAGCCGCAGG - Intergenic
1168965443 20:1895382-1895404 GCGCTCGGGCGGGAGCAGGCTGG - Intronic
1171484315 20:25476502-25476524 GCGCTCGCGCCGAAAGGCTCTGG + Exonic
1173001548 20:39109452-39109474 GGGCACTGGCTGGAACGCGCAGG - Intergenic
1173494350 20:43507918-43507940 GCGGTCTGGGCGGAGCGCGCAGG + Intronic
1173663576 20:44750591-44750613 GCGCTCGGGCCAGTCGGCGCTGG - Exonic
1175215899 20:57391594-57391616 GCGCTCGGGGCGCACGGCGCGGG - Exonic
1176380596 21:6110726-6110748 GCACTCGGGCCGGGTCCCGCGGG - Intergenic
1179742876 21:43427514-43427536 GCACTCGGGCCGGGTCCCGCGGG + Intergenic
1181478069 22:23180759-23180781 GCGCGCGGGGCGGGGCGCGCCGG - Exonic
949522314 3:4868489-4868511 GCCCACGGGCCGGGGCGCGCAGG - Intronic
950902991 3:16513679-16513701 GGGCTGGAGCCGGAGCGCGCCGG - Exonic
953748735 3:45594168-45594190 GCGCGCGGGCCGGAGGGCGGCGG - Intronic
958026893 3:88059283-88059305 GCGCAGGGGCTGGTACGCGCTGG + Exonic
961182390 3:124887060-124887082 GGGCTGGGGCCGGAGCGCGGGGG + Exonic
966794090 3:183697814-183697836 ACGTGCGGGGCGGAACGCGCCGG + Exonic
972312128 4:37891301-37891323 GGGGCCGGGCCGGGACGCGCAGG - Exonic
975473231 4:74794138-74794160 GCGCTGGGGCTGGCAGGCGCGGG - Intronic
979530510 4:121764965-121764987 GCGCCCGGGCTGGAGCGCCCCGG + Exonic
981504284 4:145482371-145482393 GCTCCCGGGCCTGACCGCGCTGG + Intronic
1002710154 5:181190473-181190495 GCGCTAGTGCCCGAACGTGCTGG + Intergenic
1018730820 6:166649198-166649220 GCGCAGGGGCAGGAACGCGAGGG - Intronic
1018790835 6:167146428-167146450 GCACTTGGGCCGGAACACACCGG - Intronic
1019576168 7:1738699-1738721 GCGCACGGGCTGGGATGCGCTGG - Intronic
1022427885 7:30285313-30285335 GCTCTCGGGGCGCAGCGCGCGGG + Exonic
1034222991 7:149460150-149460172 GGGCCCGGGCCGGACAGCGCAGG - Intronic
1038204982 8:25457954-25457976 GCCCCCGGGCCGAACCGCGCCGG + Intronic
1039579274 8:38650884-38650906 GCGCTGGGGCAGGAACGGCCGGG + Intergenic
1043502985 8:80874416-80874438 GCGGTAGGCCCGGAGCGCGCGGG - Intronic
1043847263 8:85177441-85177463 GAGCTCGGGCCAGCAGGCGCCGG + Exonic
1043873850 8:85463853-85463875 GCGCTCGGGGCGGGGCGGGCCGG - Exonic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1051774920 9:20622564-20622586 GCGGGCGGGGCGGAGCGCGCGGG + Intergenic
1059145645 9:111897029-111897051 GCGCGCGGGCGGGGGCGCGCAGG + Exonic