ID: 903184910

View in Genome Browser
Species Human (GRCh38)
Location 1:21623324-21623346
Sequence ACTCTGTAGGCCCTTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 118}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903184902_903184910 20 Left 903184902 1:21623281-21623303 CCTCCTCTCTGGACCTCAGTTTC 0: 2
1: 35
2: 170
3: 475
4: 1137
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118
903184900_903184910 25 Left 903184900 1:21623276-21623298 CCCTGCCTCCTCTCTGGACCTCA 0: 1
1: 0
2: 13
3: 89
4: 603
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118
903184903_903184910 17 Left 903184903 1:21623284-21623306 CCTCTCTGGACCTCAGTTTCCCC 0: 8
1: 188
2: 962
3: 3166
4: 7042
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118
903184901_903184910 24 Left 903184901 1:21623277-21623299 CCTGCCTCCTCTCTGGACCTCAG 0: 1
1: 1
2: 16
3: 126
4: 815
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118
903184908_903184910 -4 Left 903184908 1:21623305-21623327 CCATCTTTAAAATATAAGGACTC 0: 1
1: 0
2: 0
3: 33
4: 352
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118
903184904_903184910 7 Left 903184904 1:21623294-21623316 CCTCAGTTTCCCCATCTTTAAAA 0: 14
1: 346
2: 2698
3: 8743
4: 16844
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118
903184907_903184910 -3 Left 903184907 1:21623304-21623326 CCCATCTTTAAAATATAAGGACT 0: 1
1: 0
2: 3
3: 46
4: 371
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118
903184906_903184910 -2 Left 903184906 1:21623303-21623325 CCCCATCTTTAAAATATAAGGAC 0: 1
1: 1
2: 5
3: 57
4: 616
Right 903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG 0: 1
1: 0
2: 2
3: 17
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903184910 Original CRISPR ACTCTGTAGGCCCTTCCAGC TGG Intronic