ID: 903185430

View in Genome Browser
Species Human (GRCh38)
Location 1:21626310-21626332
Sequence GTAGAGTGAAGGAGTATAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903185424_903185430 9 Left 903185424 1:21626278-21626300 CCGTAGGTATGGAGGGGGACACT 0: 1
1: 0
2: 2
3: 3
4: 98
Right 903185430 1:21626310-21626332 GTAGAGTGAAGGAGTATAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 191
903185420_903185430 16 Left 903185420 1:21626271-21626293 CCAGGGGCCGTAGGTATGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 149
Right 903185430 1:21626310-21626332 GTAGAGTGAAGGAGTATAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903185430 Original CRISPR GTAGAGTGAAGGAGTATAGG AGG Exonic
900765383 1:4501416-4501438 GAAGAGTGAGTGAGTAAAGGGGG + Intergenic
903185430 1:21626310-21626332 GTAGAGTGAAGGAGTATAGGAGG + Exonic
904304220 1:29577143-29577165 GTAGAGGGAAGGAATAAAGGTGG - Intergenic
905521331 1:38602902-38602924 GTAGAATGAAGGAGGGGAGGGGG + Intergenic
906280258 1:44548447-44548469 GCTGAATGAAGGAGTCTAGGTGG - Intronic
907235945 1:53047819-53047841 GGAGAAGGAAGGAGAATAGGAGG - Intronic
907243599 1:53093691-53093713 GTAGAGTGGAGGAGGAGAGAGGG - Intronic
910066763 1:83162763-83162785 GTAGAGGGAAGGAGTATTTCAGG - Intergenic
912587023 1:110776386-110776408 GTATAGGGATGGAGTATAGGAGG - Intergenic
913092015 1:115482673-115482695 GTGGAGTGAAGAGGTATATGAGG + Intergenic
913093832 1:115497909-115497931 GTGGAGAGAAGGAGTAGATGGGG - Intergenic
915189307 1:154135314-154135336 GTAGAGAAAAGGAGTATAGTTGG - Intronic
917200715 1:172511723-172511745 GTGGAGTAAAGGACTATAAGGGG - Intergenic
919814780 1:201430435-201430457 GAGGAGGGTAGGAGTATAGGTGG - Intergenic
921219255 1:212961590-212961612 GGACAGTGAAGGAGAACAGGAGG - Intronic
922605492 1:226887476-226887498 GGAGAGTGAAGGACAAGAGGGGG - Intronic
924128242 1:240878281-240878303 GTGGAGGGAAGAAGAATAGGGGG - Intronic
924673821 1:246155135-246155157 GTAGAGTAAGGGAGTTTGGGAGG - Intronic
1064314107 10:14238678-14238700 GTAGGGGGAAGGAGCATAAGGGG - Intronic
1064882270 10:20069327-20069349 GCAAAGTGAAGGAGAATATGGGG + Intronic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1071114999 10:82207745-82207767 GAAGAGTGAATGAGTGAAGGGGG + Intronic
1071243618 10:83738641-83738663 GGAGAATGAAGGAGTAGAGAAGG + Intergenic
1072039580 10:91594293-91594315 CTGGAGTAAAGGAATATAGGAGG - Intergenic
1073743915 10:106443868-106443890 GTAGAGTGATGGAGGGGAGGTGG + Intergenic
1074093894 10:110290552-110290574 GTAGAGAGGAGGAGCATAGCAGG - Intergenic
1075702875 10:124480548-124480570 GTTGAGTGAAGAAGTGCAGGGGG - Intronic
1078268905 11:9776549-9776571 ATAGAGTGAAGGGGTTTGGGAGG + Intergenic
1078287227 11:9969323-9969345 GTTGAATGAAGGAGTACAGGTGG - Intronic
1078405473 11:11066986-11067008 CTAGAGGGAAGGAGTAATGGGGG - Intergenic
1078550784 11:12279306-12279328 GTGGAGTGAACGAGTAGATGTGG + Intronic
1078634792 11:13039361-13039383 GTGGAGTGCAGGAGTGGAGGGGG + Intergenic
1078737355 11:14032841-14032863 GTTGAGTCAGGGAGTATAGGGGG - Intronic
1079247220 11:18761499-18761521 GAAGAGTGAAAGAGAAGAGGAGG + Intronic
1088577155 11:111283408-111283430 GTTGAGTGAAGGAGTCCATGAGG + Intronic
1088911738 11:114197390-114197412 TCAGTGTGAAGGAGTCTAGGAGG + Intronic
1089425563 11:118371379-118371401 GTAGAGTGAAGGAGAAAAAAAGG - Intronic
1091632174 12:2170601-2170623 GAAGAGTGAGGGAGTTGAGGTGG + Intronic
1093180872 12:15965843-15965865 GTCGAGGGAAGGAATTTAGGAGG - Intronic
1095566538 12:43630943-43630965 GTAGAGTGAAGAATTTTGGGAGG - Intergenic
1095971168 12:47902915-47902937 GTAGAGTGTAGGGGTTCAGGAGG + Intronic
1096456074 12:51788130-51788152 GTAGACTGAAGGAGTAGAATTGG + Intronic
1100356764 12:93838378-93838400 GTAGAGTGGTGGAGTGGAGGAGG - Intronic
1107712460 13:43163799-43163821 GAAGAGTGAAGGAATCAAGGTGG - Intergenic
1108067465 13:46592953-46592975 GTAGAGGGAAGGGACATAGGAGG - Intronic
1108974268 13:56418395-56418417 GTAGAGTGGAGGAGGCTGGGAGG - Intergenic
1109151266 13:58850525-58850547 TTTGAGTGAGGGAGTATAGCAGG - Intergenic
1110053651 13:70937323-70937345 GTGGAGTGAATGAGTAAATGCGG - Intergenic
1110342421 13:74408131-74408153 GGAGAGAGAAAGAGTAAAGGGGG - Intergenic
1112251718 13:97787058-97787080 GTGGACTGGAGGAGTATAGAAGG + Intergenic
1119110245 14:71965889-71965911 GGAAACTGAAGGAATATAGGCGG + Intronic
1119533612 14:75381636-75381658 GGAGAGTGAAAAAGTCTAGGAGG + Intergenic
1121423202 14:93830121-93830143 GTGGAGTGAGGGAGGAAAGGAGG + Intergenic
1124012274 15:25848575-25848597 CTAGAGTCAAGGAGTGTGGGCGG - Intronic
1124510176 15:30317542-30317564 GTGGAGGGAAGCAGTGTAGGAGG + Intergenic
1124732713 15:32213011-32213033 GTGGAGGGAAGCAGTGTAGGAGG - Intergenic
1125324682 15:38524817-38524839 GTAGAGTTTAAAAGTATAGGAGG + Intronic
1126130384 15:45335305-45335327 GTACAGTGAAGGAGTTGAGTAGG + Intergenic
1127556794 15:60095461-60095483 GTAGAGTGGAGGGGAATAAGTGG - Intergenic
1127657832 15:61071910-61071932 GTATAGTGAATGAGTAGAGATGG + Intronic
1127789268 15:62384142-62384164 GTTGAGTGATGGGGTATATGGGG + Intergenic
1128796915 15:70472812-70472834 GTAGAGGGAAGGAGGAAGGGAGG + Intergenic
1129502133 15:76049445-76049467 GTAGAGTGAATGTGGTTAGGAGG - Intronic
1129759377 15:78120677-78120699 GCAGAGGGAAGGAGAATTGGAGG + Intronic
1136343374 16:29659777-29659799 GTAGAGTGAAAGAGGAGAGAAGG - Intergenic
1141775740 16:86121676-86121698 GCAGAGGAATGGAGTATAGGAGG - Intergenic
1144618039 17:16794920-16794942 GTAGAATGAAGGAGGAGAGAAGG - Intronic
1152462743 17:80449949-80449971 GTGGAGAGAAGGAGGACAGGGGG - Intergenic
1153389387 18:4536834-4536856 GGAGAGTGAAGGAGATTAGAAGG + Intergenic
1154330858 18:13428185-13428207 GAAGAGTGAAGCAGGAAAGGAGG + Intronic
1155280671 18:24236360-24236382 ATAGAGTGAAGGAGGAAATGGGG + Intronic
1155371283 18:25103745-25103767 GAAGAGAGAAGGAGTAAGGGAGG + Intronic
1155445646 18:25910252-25910274 GTAAAGAAAAGGAGTAAAGGAGG - Intergenic
1156865007 18:41879219-41879241 GTAGAGCAAAGGAGTCTGGGGGG + Intergenic
1158610109 18:58931973-58931995 ATGGAGTCAAGGAGTAGAGGAGG + Intronic
1159757918 18:72389082-72389104 GTAAAATTAAGGAGTATAGTAGG + Intergenic
1160478143 18:79211505-79211527 GTGGAGTGTAGGAGTAAATGTGG + Intronic
1161108172 19:2454918-2454940 GCAGACTGAAGGAGAAGAGGCGG - Intronic
1162856216 19:13470432-13470454 GTAGAGACCAGGAGGATAGGAGG - Intronic
1163207223 19:15812540-15812562 GGAGAGTGAGGGAGGAAAGGAGG + Intergenic
1163252679 19:16135591-16135613 GTGGAGTGAAGGAGTAAGGAAGG - Intronic
1164182723 19:22833498-22833520 CTAGAGTAAAGGAGGATTGGGGG - Intergenic
1166123751 19:40701418-40701440 GGAGAGTGAGGGAGAACAGGAGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1166670243 19:44705536-44705558 GTAGAGGGAAGGAGGAGTGGAGG - Intronic
1168312032 19:55465216-55465238 GCAGAGTGAGGGAGGAGAGGGGG + Intergenic
925877410 2:8324721-8324743 GGAGAGTGAAGGAGCAAATGTGG - Intergenic
926053648 2:9760920-9760942 GTAGAAAGAAGGACTAGAGGAGG + Intergenic
926053660 2:9760966-9760988 GTAGAAAGAGGGAGTAGAGGAGG + Intergenic
927076936 2:19588266-19588288 GCAAAGTGAAGGAGTAGAGAGGG + Intergenic
927466183 2:23338592-23338614 GTAGAGTGCAGGAGTAAGGATGG - Intergenic
931234782 2:60404015-60404037 GTAGGCTGAATGAGGATAGGAGG - Intergenic
935106821 2:100052553-100052575 GTGGGGACAAGGAGTATAGGTGG - Intronic
938507034 2:131896730-131896752 GAAGACTGAAGGAATATAGGAGG + Intergenic
939979047 2:148756980-148757002 GTTGTGAGAAGGAGTAAAGGGGG + Intronic
944186863 2:196958629-196958651 GGAGAGAGAAGGAGCAAAGGGGG + Intergenic
944599139 2:201285361-201285383 GTAGTGTGATGGAGTAGGGGGGG - Intronic
947099812 2:226607867-226607889 GGAGAGTGAAGGAGTATGGAGGG - Intergenic
1169138174 20:3210134-3210156 ATAGAGAGGAGGAGTAAAGGAGG + Intronic
1170134461 20:13057362-13057384 GAAGAGTAAATGAGTAAAGGTGG - Intronic
1170152713 20:13242155-13242177 GTAGAGGGAAAGGGTATGGGAGG + Intronic
1171116540 20:22529710-22529732 GTTGTGTGAAGCAGTTTAGGTGG - Intergenic
1173312453 20:41910429-41910451 GTTGACTCAAGGAGAATAGGAGG - Intergenic
1175485899 20:59346042-59346064 ATGCAGAGAAGGAGTATAGGTGG - Intergenic
1176786597 21:13263568-13263590 AAAGACTGAAGGAATATAGGAGG - Intergenic
1177536623 21:22436589-22436611 GAAGTGTGAAGGAGTTGAGGAGG - Intergenic
1177985198 21:27965663-27965685 GAAGACTGAAGGAATATAGGAGG - Intergenic
1178982168 21:37273641-37273663 GAAGAGGGAAGGGGTACAGGAGG + Intergenic
1179353204 21:40632887-40632909 TTAAAGTGATGGAGTATCGGTGG - Intronic
1180035966 21:45249579-45249601 GTAGTGTGAAGGAGTGAAAGTGG - Intergenic
1180753104 22:18139108-18139130 GAAGGGTGAAGGAGTATGAGGGG - Intronic
1183492273 22:38122986-38123008 AGAGAGTGGAGGAGTAGAGGAGG - Intronic
1184510523 22:44930640-44930662 GGACAGTGAAGGAGGAGAGGAGG + Intronic
950290694 3:11781876-11781898 GTAAGGTGAAGGAGTTTAGATGG + Intergenic
950802896 3:15569284-15569306 CTTTAGTGCAGGAGTATAGGAGG - Intronic
951746519 3:25983981-25984003 GTAGAGTGACTGAGTGTAGTAGG - Intergenic
952949462 3:38508515-38508537 GTGGAGTGAAGCAGAAGAGGTGG + Intronic
953558390 3:43965096-43965118 GTAGAGTGAAAGAGAAAAGGAGG + Intergenic
954809281 3:53238165-53238187 GTAGGGAGAAGGAGTTTAGCTGG - Intronic
956119684 3:65954076-65954098 GTTGAGTGCCGGAGTATGGGGGG - Intronic
956568240 3:70663960-70663982 ATAGATTGAAGGAGACTAGGGGG - Intergenic
957230667 3:77510043-77510065 GTTGAGTGCTCGAGTATAGGAGG + Intronic
957657914 3:83106049-83106071 GTAAAGTGAGAGAGTATAGTGGG - Intergenic
960231656 3:115235107-115235129 GAAGAGGGAAGGATTTTAGGAGG + Intergenic
960917951 3:122716322-122716344 GTAGAGTCAAGGACTCTAGATGG - Intronic
961507728 3:127382059-127382081 GGAGAGTGAAAGTGTATAGTGGG - Intergenic
961880975 3:130060991-130061013 ATAGAGTGGAGGAGTGGAGGCGG - Intergenic
962630478 3:137270501-137270523 GTAGAGTGAATGAGAATATCAGG + Intergenic
963292418 3:143505204-143505226 GGAGAGAGAATGAGTGTAGGAGG - Intronic
964283028 3:155087532-155087554 GTAGAGAGAGGAAGCATAGGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965078921 3:164012869-164012891 GTACAGTGTAGGAGTGGAGGTGG - Intergenic
967439618 3:189491570-189491592 CAAGAGTGAAGGATTAGAGGTGG - Intergenic
967582082 3:191170990-191171012 CTGGAGTGAGGGATTATAGGCGG - Intergenic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
968887202 4:3341291-3341313 GTAGAGAGATGGGGTATGGGGGG + Intronic
971218083 4:24680551-24680573 GAAGAGGGAAGGAGGAAAGGAGG + Intergenic
971948511 4:33313536-33313558 GTAACGAGAAGGAGTATAGATGG - Intergenic
972911511 4:43822629-43822651 GTAGAGTGCAAGAGTGAAGGAGG - Intergenic
974920472 4:68233086-68233108 TTAGAGAGAAGGAGAAGAGGAGG + Intronic
974920517 4:68233605-68233627 TTAGAGGGAAGGAGAAGAGGAGG - Intronic
975411549 4:74057809-74057831 GGAGGGTGAAGGAGTTGAGGGGG + Intergenic
975442646 4:74429827-74429849 TTACAGTGAAGAAGTAGAGGTGG - Intergenic
975534038 4:75430138-75430160 GCAGAATGTAGGAGTATTGGGGG + Intergenic
978018563 4:103779482-103779504 GAAGAGTGAAGGAGTTTCTGTGG - Intergenic
982706972 4:158721095-158721117 TTAGAGTGAAGGAGAATGAGAGG + Intronic
984211809 4:176859031-176859053 GTATAATGAAGGAGTCTATGGGG + Intergenic
984258855 4:177419964-177419986 GTGGAATGATGGAGAATAGGAGG - Intergenic
984862355 4:184252290-184252312 GAAGAGGGAAGGAGAAGAGGAGG + Intergenic
986027780 5:3866538-3866560 GGTGAGTGAAGGAGTGTGGGTGG - Intergenic
988497985 5:31760958-31760980 GTTGAGTGGAAGAGTAGAGGAGG + Intronic
992236457 5:74714528-74714550 GTAGAGTGTAGCAGAGTAGGAGG + Intronic
993689677 5:90984487-90984509 GTAGAGTGAAGGGGGATGAGGGG - Intronic
994309129 5:98246113-98246135 GAAGTGTGAAGGAGTAGAAGTGG - Intergenic
994572421 5:101531158-101531180 GGAGACTGAAAGAGTAAAGGGGG + Intergenic
996435133 5:123425575-123425597 GAAGAGTGAGTGAGTAAAGGGGG - Intergenic
997411482 5:133694356-133694378 GTGGAGTGGAGGTGTAGAGGAGG - Intergenic
999431475 5:151528700-151528722 GAAGAGTGTGGGAGTATGGGTGG + Intronic
1000112318 5:158120745-158120767 GTAGTGAGAAGGAGGAAAGGGGG - Intergenic
1001133009 5:169079894-169079916 GAAGAGTGAAGAAGAAGAGGAGG + Intronic
1005022798 6:21433736-21433758 GTCAAGTCAAGGAGTATAGGTGG + Intergenic
1005281750 6:24282208-24282230 GTAGAGTGAGGGATGATTGGAGG - Intronic
1006808102 6:36801795-36801817 GCAGGGTGGAGGGGTATAGGGGG + Intronic
1009401484 6:63261639-63261661 CAAGAGTGAAGAAGAATAGGGGG - Intergenic
1009730260 6:67593357-67593379 TTAGATTGAAGGAGAAAAGGTGG - Intergenic
1010002698 6:70963650-70963672 GTAGAATGAATGAGTGTAGGTGG + Intergenic
1010022963 6:71182441-71182463 GTAGAGTGAGGGAATATTGCTGG + Intergenic
1015885069 6:137909583-137909605 AAAGAGGGAAGGAGTAGAGGGGG + Intergenic
1016388649 6:143553346-143553368 AGAGAATGAAGGAGTATAGAGGG + Intronic
1018934912 6:168267550-168267572 GTAGATTGAAGGTGTAAATGTGG + Intergenic
1022197393 7:28082374-28082396 GTAGAGTGAACGGGCAGAGGCGG - Intronic
1023276309 7:38522449-38522471 GCAGAGTGAGTGAGTATAGCGGG + Intronic
1024829469 7:53432683-53432705 CTGGAGTGAAGGAGTACAGACGG + Intergenic
1026976049 7:74499117-74499139 GTTGAGTGAATGAGTAGGGGTGG + Intronic
1027277343 7:76571996-76572018 GTAGAGGGAAGGAGTATTTCAGG + Intergenic
1028033920 7:85955136-85955158 GGATAGGGAAGGAGTTTAGGAGG + Intergenic
1028649428 7:93134777-93134799 GGAGAGTGAAGGACTAAAGCTGG - Exonic
1029380642 7:100212240-100212262 GTAGGGAGATGGAGGATAGGGGG - Intronic
1032668283 7:134060167-134060189 GTAGAGTGACAGAGAAGAGGAGG - Intronic
1036033155 8:4993782-4993804 GGAGAGGGAAGGAGGAGAGGAGG + Intronic
1036788150 8:11701595-11701617 GGAGAGCGAAGGAGGAAAGGAGG + Intronic
1036991066 8:13594612-13594634 GTAAAGTCAAGAAGTTTAGGAGG - Intergenic
1037516505 8:19637071-19637093 GTAAAGTGAGGGATTACAGGTGG - Intronic
1037916654 8:22777232-22777254 GGGGAGTGGAGGAGTAGAGGAGG - Intronic
1038442338 8:27580057-27580079 GGAGAGTGCAGGAGTGGAGGTGG - Intergenic
1039651636 8:39346646-39346668 ATAGAGTGCTGGAGTACAGGAGG + Intergenic
1041111732 8:54489260-54489282 GTAGAGTTTAGGAGCATTGGTGG + Intergenic
1045357927 8:101405751-101405773 GAAGAGGGAAGGAGTGAAGGAGG - Intergenic
1045826237 8:106401960-106401982 GGACAGTGAAGGTGTATTGGTGG + Intronic
1047684473 8:127290863-127290885 GCAGAGTGTAGGAGGATAGGTGG - Intergenic
1050172646 9:2838594-2838616 GTAGACTGAAGGACTAAATGTGG - Intronic
1052031183 9:23630651-23630673 GAAGACTGAAGGAGTGGAGGAGG + Intergenic
1055552802 9:77446617-77446639 GGAGAGTGAAGGAGAAGGGGTGG + Intronic
1057960388 9:99450303-99450325 GAAGAGTGAAGGAGAAAAAGGGG - Intergenic
1058303904 9:103412252-103412274 GTAGAGTGAAAGAACAAAGGGGG - Intergenic
1059985648 9:119817996-119818018 GTAGAGTGAAGCAGAACAGAGGG + Intergenic
1187253759 X:17622841-17622863 GTAGAGGCAAGGTGTATGGGAGG + Intronic
1187496353 X:19799100-19799122 GTAGTGTGAAGAAATAAAGGGGG - Intronic
1188388436 X:29590618-29590640 GCAGAGTCAAGGAGCATGGGCGG - Intronic
1188533462 X:31168055-31168077 GCAGTGTGATGGAGGATAGGTGG + Intronic
1188568837 X:31557742-31557764 GTAGAGTGTAGTAGAAGAGGGGG + Intronic
1189003363 X:36969066-36969088 GTAGAGAGAAGGTGTCTGGGAGG - Intergenic
1194168892 X:90557327-90557349 GCAGAGTGCAAGAGTAAAGGAGG + Intergenic
1199212181 X:145225720-145225742 GTAGAGAGAAGCAGCCTAGGTGG - Intergenic
1200515135 Y:4135112-4135134 GCAGAGTGCAAGAGTAAAGGAGG + Intergenic