ID: 903189003

View in Genome Browser
Species Human (GRCh38)
Location 1:21646016-21646038
Sequence GAGGGGAAGTGGTGGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 512}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189003_903189016 15 Left 903189003 1:21646016-21646038 CCCCTGGGCCACCACTTCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 512
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189003_903189013 11 Left 903189003 1:21646016-21646038 CCCCTGGGCCACCACTTCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 512
Right 903189013 1:21646050-21646072 GTTCCCTCATCTGTAAAATGGGG 0: 23
1: 594
2: 2828
3: 6721
4: 11858
903189003_903189012 10 Left 903189003 1:21646016-21646038 CCCCTGGGCCACCACTTCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 512
Right 903189012 1:21646049-21646071 AGTTCCCTCATCTGTAAAATGGG 0: 30
1: 766
2: 3523
3: 8849
4: 15187
903189003_903189018 28 Left 903189003 1:21646016-21646038 CCCCTGGGCCACCACTTCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 512
Right 903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 290
903189003_903189017 27 Left 903189003 1:21646016-21646038 CCCCTGGGCCACCACTTCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 512
Right 903189017 1:21646066-21646088 AATGGGGATGGACAGTAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 172
903189003_903189011 9 Left 903189003 1:21646016-21646038 CCCCTGGGCCACCACTTCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 512
Right 903189011 1:21646048-21646070 CAGTTCCCTCATCTGTAAAATGG 0: 37
1: 931
2: 4071
3: 9755
4: 16832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189003 Original CRISPR GAGGGGAAGTGGTGGCCCAG GGG (reversed) Intronic
900040459 1:458201-458223 GAGGACAAGTGCTGGCCTAGAGG + Intergenic
900143792 1:1149535-1149557 GAGGGGAGGAGGTGGCTGAGTGG + Intergenic
900143976 1:1150122-1150144 GGTGGGAGGTGGTGGCCCAGGGG + Intergenic
900183474 1:1322577-1322599 GTGGGGAAGGGATGGTCCAGGGG + Intronic
900204802 1:1427323-1427345 GAGGGGAAGGGGAGGCGCGGAGG - Intronic
900466733 1:2829250-2829272 GAGGTGAGGTGGTGGCCCGTTGG + Intergenic
900653779 1:3745052-3745074 GAGGGGTATTGGGGGGCCAGTGG - Intergenic
901346902 1:8552865-8552887 GTGTGGACGTGCTGGCCCAGTGG - Intronic
901420642 1:9148805-9148827 GAGGGGCAGTGGTGGCTCCAAGG - Intergenic
902044382 1:13513889-13513911 GAGCGGCAGGGGTGGCCGAGTGG + Exonic
902240313 1:15083977-15083999 GATGGGAAGTGAAGGCTCAGAGG - Intronic
902376987 1:16034576-16034598 GAGGGGGAGTGGGCTCCCAGGGG + Intergenic
902382159 1:16057835-16057857 GAGGGGGAGTGGGCTCCCAGGGG + Exonic
902561921 1:17282951-17282973 AAGGTGCAGTGGAGGCCCAGCGG - Exonic
902733604 1:18385698-18385720 GAGGAGCAGTGGTGACGCAGGGG - Intergenic
903189003 1:21646016-21646038 GAGGGGAAGTGGTGGCCCAGGGG - Intronic
903297032 1:22350535-22350557 AAGGGGAGGGGCTGGCCCAGGGG + Intergenic
903421102 1:23218091-23218113 GAGTGGAAGTGAGGGCTCAGGGG + Intergenic
903647661 1:24904765-24904787 GAGGAGGGGTGGTGGCCCTGAGG - Intronic
903878217 1:26490814-26490836 GAGGGGAAGTTGGGGCACAAAGG - Intergenic
903938735 1:26914105-26914127 GTGGGGAAGTGGTGGGGGAGGGG + Intronic
903997168 1:27314524-27314546 GAGGGCAAGTGTGGCCCCAGAGG + Intergenic
904927062 1:34057625-34057647 AACGGGAAGCGGTGGCCAAGAGG - Intronic
906087917 1:43151763-43151785 GATGGGAAGTGGGGGAGCAGAGG + Intronic
906343466 1:45001141-45001163 GGGTGGAAGTGGTGGCCTTGGGG + Intergenic
906530587 1:46521536-46521558 AAGAGGAAGTGGTGGCCCTTGGG - Intergenic
906540235 1:46579748-46579770 GAGGGCAAGTGGAGGCACAGAGG + Intronic
906568527 1:46817348-46817370 AAGGGGAAATGGAGGCTCAGAGG - Intronic
906964438 1:50442724-50442746 ATGGGGAAGTGGAGGCCCTGGGG + Intronic
907705754 1:56831113-56831135 ATGAGGAAATGGTGGCCCAGGGG + Intergenic
907713389 1:56905298-56905320 AATGGGAAATGGAGGCCCAGTGG + Intronic
910352977 1:86320890-86320912 GAGGGACAGTGGAGGCCTAGGGG + Intergenic
912555886 1:110515804-110515826 GAGGTGGAGCTGTGGCCCAGGGG + Intergenic
914652528 1:149708713-149708735 GAGAGGCAGTGGTGGTTCAGTGG - Intergenic
915586686 1:156847594-156847616 TGGGGGAACTTGTGGCCCAGCGG + Intronic
915734552 1:158076369-158076391 GAGGGGAGGCTGTGGCACAGAGG - Intronic
915736762 1:158090165-158090187 GAGGGGAAGTGTTAGCCCAGGGG - Intronic
916016146 1:160751269-160751291 CAGGAGAAATGGTGGGCCAGTGG + Intronic
917230731 1:172834846-172834868 GAGGGGAAGGCCTGGCCCAGAGG + Intergenic
917437731 1:175038133-175038155 GAAGGGAAATGGTGACCCATAGG + Intergenic
917564109 1:176194110-176194132 GGGGGGAAGTGGTTGCTCTGAGG - Intronic
917857143 1:179110008-179110030 GAGGAGAAGAGGTTGCGCAGTGG - Intronic
917919758 1:179741846-179741868 GAAGGGAATTGGTGGAGCAGGGG + Intergenic
918223722 1:182459100-182459122 GATGGGAAGTGGCAGCCCATGGG + Intronic
920599216 1:207305717-207305739 TAGGGGGTGTGGTGGCCCATAGG - Intergenic
922236360 1:223725660-223725682 CAGAGGAGGTGGTGTCCCAGGGG + Intronic
922800185 1:228361556-228361578 GTGGGGATGTGGTGACCCCGTGG + Intronic
922875451 1:228936712-228936734 GAGTGGAAGTGGGGACCCAGAGG - Intergenic
922934218 1:229411324-229411346 GAGGGGAAGAGGAGGCCGAGGGG - Intergenic
923592259 1:235328937-235328959 GAGAGGAAGGGTTGGCCAAGTGG + Intronic
1063004126 10:1952467-1952489 GAGTGGAGGTGTTGGGCCAGGGG - Intergenic
1063202579 10:3798190-3798212 GATGGGAAATGGTGGGCAAGGGG + Intergenic
1064016840 10:11779435-11779457 GAGGGGCAAGGGTGGCCCTGGGG + Intergenic
1064379819 10:14831312-14831334 GAGTGGAAGTGGGAGTCCAGGGG - Intronic
1064646438 10:17464691-17464713 GAGGGGAAGTGGTGGTGGTGTGG - Intergenic
1065354742 10:24828930-24828952 GAAAGGAGGTGGTGGCCAAGGGG - Intergenic
1067101704 10:43338988-43339010 GAGGGGAAGAGGAGGCCATGGGG + Intergenic
1067147520 10:43704087-43704109 GAAGGGGCCTGGTGGCCCAGTGG + Intergenic
1067177480 10:43960211-43960233 GATGGGAAGTGGGGACCCTGGGG - Intergenic
1069786301 10:70990367-70990389 GGGGGGATGTGGAGGGCCAGGGG - Intergenic
1069792894 10:71034525-71034547 GAGGGGAAGTGGGAGCTCAGAGG + Intergenic
1070749570 10:78955970-78955992 CTGGGGAAGTGGTGGCACTGTGG - Intergenic
1070812946 10:79307362-79307384 GAGGGGAGGGGGTCACCCAGAGG - Intronic
1070841632 10:79491617-79491639 GAGGGAGACTGGAGGCCCAGCGG - Intergenic
1071121324 10:82282320-82282342 CAGGTGAATTGGTGGCCCAGAGG - Intronic
1071498991 10:86190314-86190336 GTTGGGAAGAGGTGGCCCAGTGG + Intronic
1072093340 10:92151283-92151305 GAGTAGAAGTGCTGGGCCAGAGG - Intronic
1072521659 10:96235222-96235244 AAGGGGAAGCTGAGGCCCAGAGG - Intronic
1072638519 10:97193289-97193311 GAGGGGATGTGGTGGAGAAGGGG - Intronic
1072920147 10:99569906-99569928 GGTGGCAAGTGGTGGTCCAGAGG - Intergenic
1074382296 10:112991118-112991140 GAGGGGAAGTGGGTCCCCAAAGG - Intronic
1077140237 11:1020974-1020996 GAGGGGATGGGAGGGCCCAGTGG + Intronic
1077299609 11:1840937-1840959 GCGGGTAGGCGGTGGCCCAGCGG + Intronic
1077364176 11:2154877-2154899 GTGGGCAGGTGGTGGCCCTGTGG + Intronic
1077535361 11:3121567-3121589 AAGGGGAAATGGAGGCTCAGAGG + Intronic
1078108626 11:8374179-8374201 GAGAGGTAGTGGGAGCCCAGTGG - Intergenic
1078245603 11:9571421-9571443 GAGGGGAAGTGTTGGAGCAAGGG + Intergenic
1078779007 11:14419680-14419702 GAGGGAACGTGGTCCCCCAGAGG + Intergenic
1078866345 11:15301610-15301632 AAGAGGAGGAGGTGGCCCAGGGG + Intergenic
1078918885 11:15808263-15808285 GCTGAGAACTGGTGGCCCAGGGG + Intergenic
1079091759 11:17485682-17485704 TAGGGGAAGAGGTGGCCTTGAGG + Intergenic
1079359451 11:19758443-19758465 GAAGGGTGGTGGTGGACCAGAGG + Intronic
1079995505 11:27291268-27291290 GAGGGGAGTTGGTGGGCAAGTGG + Intergenic
1080548295 11:33343858-33343880 AAGGTGAAATTGTGGCCCAGTGG + Intronic
1081357780 11:42134537-42134559 GAAGGGTAGTGGGGGCCGAGGGG + Intergenic
1081425876 11:42926063-42926085 GAGGAGGAGCGGGGGCCCAGGGG + Intergenic
1081620923 11:44618794-44618816 TTGGGGAGGTGGTGGCCAAGGGG + Intronic
1081966985 11:47176301-47176323 AAGAGGAAGTTTTGGCCCAGAGG + Intronic
1082869822 11:57933903-57933925 GAAGGGAAGTGGGGAACCAGAGG - Intergenic
1083419668 11:62545890-62545912 GAGGGGAAGGGGCGGTCCCGAGG + Intronic
1083757463 11:64799381-64799403 GAGGGGAAGGTGGTGCCCAGAGG - Intronic
1083780299 11:64914118-64914140 CAGGGGCTGTGGTGGCTCAGAGG + Exonic
1083814521 11:65125191-65125213 GAGGGCAAGGGTTGGCCTAGAGG + Intronic
1084064173 11:66693876-66693898 GGGGGTCAGTGGAGGCCCAGAGG + Intronic
1084194472 11:67516615-67516637 GAGGGGTAGTGATGGCCATGAGG - Intergenic
1084473643 11:69376887-69376909 GATGGGGGCTGGTGGCCCAGAGG + Intergenic
1084561991 11:69910451-69910473 GAGGGGAAGACGTGGGCCCGTGG - Intergenic
1084608033 11:70183946-70183968 GAGGTCAAGTGATTGCCCAGGGG + Intronic
1085182093 11:74544451-74544473 GAGGGGAGTTGGTGGACCAGTGG - Intronic
1085515544 11:77109764-77109786 GAGGGGAAATGGAGGCCCTTGGG + Intronic
1086634537 11:89065621-89065643 GAGGGCAAGTGGTGGGCAGGTGG - Intronic
1087828886 11:102797425-102797447 GCGGAGAAATAGTGGCCCAGTGG - Exonic
1088633352 11:111795388-111795410 GGGGGGCTGTGGTGGCCCATGGG + Intronic
1090274564 11:125410369-125410391 GAGGAGAAAGGGTGGCCCCGAGG + Intronic
1090763302 11:129855743-129855765 GAGTGGATGTGCTGGTCCAGCGG - Exonic
1091016833 11:132059150-132059172 AAGGGAAGGTGGAGGCCCAGAGG - Intronic
1091080000 11:132657648-132657670 TTGGGGAAGAAGTGGCCCAGGGG + Intronic
1091121719 11:133063265-133063287 GAGGGCTAGCCGTGGCCCAGGGG - Intronic
1091855343 12:3734874-3734896 GAGGGGAAATGTTGGTCCAAGGG + Intronic
1092274272 12:7047342-7047364 GAGTGGAAGTGGAGGCTCAGAGG + Intronic
1092489545 12:8932923-8932945 GATGGGAATTGGTGGCTTAGGGG - Exonic
1092884075 12:12910499-12910521 GATGGGATGGGGTGGCTCAGGGG - Intronic
1093158305 12:15714963-15714985 GATGGGAAGGAATGGCCCAGGGG - Intronic
1093500436 12:19806048-19806070 AAGGGGAGGAGGTGACCCAGTGG - Intergenic
1095196471 12:39324316-39324338 GATGTGAAGTGGTGGCCTAAAGG - Intronic
1095383703 12:41625970-41625992 GGCAGAAAGTGGTGGCCCAGTGG - Intergenic
1096946390 12:55413249-55413271 GATGGGAATTGGTGGCTTAGGGG + Intergenic
1099315653 12:81079002-81079024 GAGGGGAAGTGGTGAGTCAGGGG + Intronic
1100946876 12:99794695-99794717 GAAGGGTAGTGGGGGCACAGGGG + Intronic
1101286315 12:103316932-103316954 GAAGTGAAGTGGTTACCCAGAGG - Intronic
1101660411 12:106760090-106760112 GTTGGAAAGTGGAGGCCCAGGGG - Intronic
1101901138 12:108792132-108792154 GATGGGAGCTGGGGGCCCAGAGG + Intronic
1103366732 12:120389429-120389451 GAGGGGAAGAGCTGGACCAGTGG + Intergenic
1104037864 12:125110550-125110572 GAGCTGAAGAGCTGGCCCAGAGG - Intronic
1104706240 12:130949636-130949658 GCGGGGGAGTTGTGACCCAGTGG - Intergenic
1104931148 12:132340088-132340110 GAGGGGACATGGTGGACCCGCGG - Intergenic
1107814703 13:44233937-44233959 AAGGGGAAATGGTGGCTCAGAGG - Intergenic
1109700250 13:66015535-66015557 GATGGGAAGTGGTGGGCAACAGG - Intergenic
1113354493 13:109565669-109565691 GAGGGGAAGAGGAGTCTCAGAGG + Intergenic
1113504174 13:110801744-110801766 GAGGGGCAGTGGTGCCTTAGTGG + Intergenic
1113701234 13:112390141-112390163 GGGGAGGAGTGGAGGCCCAGGGG + Intronic
1113743378 13:112725951-112725973 GGCGGGAAGCGGTGGCCCTGGGG + Intronic
1113851484 13:113421012-113421034 GGGGGGTAGGGGTGTCCCAGGGG - Intergenic
1114066053 14:19060511-19060533 GAGGGTCAGGGGTGCCCCAGGGG - Intergenic
1114096215 14:19339514-19339536 GAGGGTCAGGGGTGCCCCAGGGG + Intergenic
1114529958 14:23389379-23389401 GAGGGCAAGGTGAGGCCCAGTGG - Exonic
1117368314 14:55052227-55052249 GAGGGGAAATCGGGGCCAAGGGG - Intronic
1118317043 14:64731809-64731831 GAGGGGAAGGTGGGGCTCAGGGG + Intronic
1118493240 14:66282134-66282156 GATGGGAAGTGGTGGGGTAGTGG - Intergenic
1119435292 14:74594501-74594523 GAGGGGATCGGGTGGCTCAGTGG - Intronic
1119524432 14:75310940-75310962 GAGGAGCAGGGGTGCCCCAGGGG + Intergenic
1119773810 14:77236535-77236557 GAGGGTAGGAGGAGGCCCAGGGG + Intronic
1121092211 14:91190641-91190663 TAGGTGGAGTGGGGGCCCAGTGG + Intronic
1121254991 14:92524761-92524783 GAGGGGAAGTGGTTTCCCCAGGG + Intronic
1121265883 14:92602324-92602346 CAGGGGAGATGGTGGCCCACAGG + Intronic
1121509981 14:94505388-94505410 GAGGGAAGGTGGTGGCTCAGGGG - Intronic
1122444750 14:101760899-101760921 GAGGGGAAGGGCTGGCCGAGGGG + Intergenic
1122697343 14:103562518-103562540 CTGGCGAAGGGGTGGCCCAGCGG + Intronic
1124237855 15:28005170-28005192 GAGGGGAAGTGGGGGTGCTGAGG - Intronic
1125672308 15:41482993-41483015 GTGGGGAGGTGGTGGCAAAGTGG - Exonic
1127169787 15:56289630-56289652 TAGGGGAAGTTGTGGCTGAGGGG + Intronic
1127994586 15:64145792-64145814 GATGGGCAGGGGTTGCCCAGTGG + Intronic
1128064068 15:64753688-64753710 GAGGGGAAGACGTGTCCCAAGGG - Intronic
1128137610 15:65275599-65275621 GTGGGGAAGTGGCTGCCAAGAGG + Intronic
1128359791 15:66953978-66954000 GAGGGCACGTGATGGCACAGGGG + Intergenic
1128380354 15:67107670-67107692 GAAGGGAAGTGGAGGGACAGAGG - Intronic
1128704073 15:69825874-69825896 AGGGGGAAGTGGTGGGGCAGGGG - Intergenic
1128980004 15:72179184-72179206 GGGGGGATGTGGAGGGCCAGAGG + Intronic
1129717259 15:77859677-77859699 GAGGGGGAGAGGAGGCCCATGGG + Intergenic
1129786126 15:78311304-78311326 GCAGGGAAGTGCTGACCCAGAGG + Intergenic
1129895425 15:79102093-79102115 GAGGGGAAATAGTGGGGCAGAGG + Intergenic
1130669575 15:85899633-85899655 GAGGGGAAAGGGTGGCCCTATGG + Intergenic
1130782106 15:87051125-87051147 AAGGGGAAGAGGTGGGGCAGTGG + Intergenic
1131453168 15:92562961-92562983 GAGGGTGAGTGGTGGCACACAGG - Intergenic
1131771901 15:95746905-95746927 GATGAGAAGTGGAGGCTCAGGGG - Intergenic
1132311078 15:100858500-100858522 CCGGGGCAGTGCTGGCCCAGAGG - Intergenic
1132441447 15:101869422-101869444 GAGGACAAGTGCTGGCCTAGAGG - Intergenic
1132549572 16:548758-548780 CAGGGGACGTGTGGGCCCAGGGG - Intronic
1132647578 16:1006311-1006333 GAGGGGAGGTGGTGGCACTGGGG + Intergenic
1132652899 16:1029480-1029502 GGAGGGAGGTGGTGGCCCCGGGG - Intergenic
1132935397 16:2477924-2477946 GAAGGGCAGTGGTGGCCCCAGGG + Intronic
1133171668 16:3985835-3985857 CAGGGCCAGGGGTGGCCCAGAGG - Intronic
1133747286 16:8696817-8696839 CAGGGGAAGTGGATGCCCTGGGG - Intronic
1133834119 16:9351300-9351322 CTGGGGCAGTGGTGGCCAAGGGG - Intergenic
1134019136 16:10909288-10909310 GAGGGCATGGGGTGTCCCAGAGG - Intronic
1134367255 16:13590898-13590920 GAGGAGATGTGGTTCCCCAGAGG + Intergenic
1134699758 16:16255402-16255424 GAGGGGAGGAGATGGCACAGGGG + Intronic
1134826305 16:17287229-17287251 GAGGGGGAGTGGTGTCTGAGTGG - Intronic
1134972067 16:18539263-18539285 GAGGGGAGGAGATGGCACAGGGG - Intronic
1135063502 16:19290330-19290352 GAGGGGAAGTGGAGGGAGAGAGG - Intronic
1136037380 16:27550266-27550288 GTCAGGAAGTGGTGGTCCAGGGG - Intronic
1136267977 16:29131984-29132006 GGGGGAATGTGGGGGCCCAGCGG + Intergenic
1136367148 16:29814099-29814121 GCAGGGCAGTGGTGGCTCAGAGG - Intronic
1136406438 16:30050666-30050688 GAGGGCCAGGGGTGGCCAAGAGG + Intronic
1137725618 16:50654832-50654854 GAGAGGAGGGGATGGCCCAGGGG - Intergenic
1137870652 16:51947065-51947087 GGGGGAAAGTGGGGGCCCTGAGG - Intergenic
1138251971 16:55508681-55508703 CAGGGGAAGTGGTTGCTCAATGG + Intergenic
1138329781 16:56204388-56204410 GAGTGGATGTGGTGTCCCTGGGG + Intronic
1139475666 16:67201435-67201457 GGTAGGAAGTGGTGGGCCAGGGG + Exonic
1139701692 16:68711640-68711662 AAGGGGAAGTGGTGGTCCCGTGG + Intronic
1139711957 16:68782689-68782711 GAGGGTAAGATGTGGGCCAGCGG - Intronic
1139922524 16:70469025-70469047 GAGGGGAAGTGGCTGGCCTGAGG - Intronic
1140980756 16:80106770-80106792 GAGGGGATGTGGGTGCCAAGTGG - Intergenic
1141267784 16:82512571-82512593 ATGGGGAAATGGAGGCCCAGAGG - Intergenic
1141749108 16:85946475-85946497 GAGAGATGGTGGTGGCCCAGAGG - Intergenic
1141994865 16:87629890-87629912 CAGGGGAAGTGGGGGGCGAGGGG + Intronic
1142071284 16:88092322-88092344 GGGGGAATGTGGGGGCCCAGCGG + Intronic
1142154038 16:88525129-88525151 AAGAGGCAGGGGTGGCCCAGAGG + Intronic
1203145853 16_KI270728v1_random:1797227-1797249 CTGGGGAAGTGGGGACCCAGAGG + Intergenic
1143757794 17:9079575-9079597 CAGAGGAAGTGGTAGCCCAGTGG + Intronic
1144606253 17:16667437-16667459 GAGGGGCTGAGGTGGCTCAGGGG + Intergenic
1144711437 17:17404070-17404092 GACTGGAAGTGGGGGCCTAGGGG + Intergenic
1144826728 17:18109331-18109353 GTGAGGAACTTGTGGCCCAGTGG - Intronic
1146439636 17:32882732-32882754 GAGGTGAATTGGTGGCCCGTGGG - Intergenic
1146674219 17:34761680-34761702 GAGGTGAAGTGGCTCCCCAGAGG - Intergenic
1147605073 17:41769768-41769790 CAGGGCAAGAGGTAGCCCAGAGG - Intronic
1147904269 17:43812882-43812904 TGGGGGAGGTGGTGGCCCTGGGG - Intronic
1148769160 17:50056894-50056916 GAGCGGAAGTGGGGTCCCGGTGG + Intronic
1149376833 17:56052350-56052372 CAGTGGAAGTGGTGGGGCAGTGG + Intergenic
1150214296 17:63458023-63458045 GACGAGAAGAGGGGGCCCAGTGG + Intergenic
1151727699 17:75894221-75894243 GAAGGGAAGGGGTGGCCAGGAGG - Intronic
1151994193 17:77598224-77598246 CAGGGGATGTGGCTGCCCAGTGG + Intergenic
1152034191 17:77861917-77861939 GATGGGAAGTGGAGGCCAACTGG + Intergenic
1152132313 17:78484826-78484848 GAGGGGAAGGCGTGGCCCCGGGG - Intronic
1152245680 17:79183474-79183496 GAGGGGGAGGGGAGGCCCAGAGG - Intronic
1152247204 17:79191257-79191279 GAGAGGGAATGGTGGCCCGGGGG + Intronic
1152629962 17:81406427-81406449 GAGGGGAAATGAGGTCCCAGAGG - Intronic
1152684394 17:81686966-81686988 GAAGGGAAGGGTTGGGCCAGTGG - Intronic
1152686075 17:81694448-81694470 GAAGGGAAGGGGTGGCTCACTGG - Intronic
1153030794 18:711557-711579 GAGGGGCAGTGAGGACCCAGTGG + Intronic
1153539726 18:6140562-6140584 GAGGGGAAGTGCTGGGCAGGCGG - Intronic
1154299911 18:13184044-13184066 GAGGAGAAATGGAGGCTCAGAGG - Intergenic
1155070267 18:22308801-22308823 GAGGGGAAGAAGTGGACAAGGGG + Intergenic
1157290991 18:46409582-46409604 GAGTGGAAGTTGTGGTGCAGAGG + Intronic
1157567360 18:48688614-48688636 GTGGGGAAGTGCTGGGCCAGAGG + Intronic
1157887663 18:51384314-51384336 GAGTGGGTGTGGTGGCCAAGAGG + Intergenic
1158350556 18:56561174-56561196 AAGAGGAAGTGCTGCCCCAGGGG + Intergenic
1158395904 18:57078202-57078224 GACTGGAAGTGGTGGCCCTTTGG + Intergenic
1159158854 18:64618705-64618727 GAGCAGATGTGGAGGCCCAGTGG + Intergenic
1159623720 18:70668955-70668977 TAGTGGCAGTGGTGGCCCATTGG + Intergenic
1160250383 18:77198808-77198830 GAGCTGACGGGGTGGCCCAGGGG - Intergenic
1160800645 19:966536-966558 AAGGGGAATTGGTGGCCAGGAGG - Intronic
1160975323 19:1790044-1790066 GAGGGGCAGTGGAGCCCCCGGGG - Intronic
1160975365 19:1790151-1790173 GAGGGGAAGGGGAGGGGCAGCGG - Intronic
1160975499 19:1790460-1790482 GAGGGGCAGGGGTGGCGAAGTGG - Intronic
1161065002 19:2233197-2233219 CTGGGGAAGTGGTTGCCCTGGGG - Exonic
1161086688 19:2338737-2338759 GGGGGGACCTGGGGGCCCAGAGG - Exonic
1162145712 19:8611207-8611229 GGGGGGAAGTGGGGGCCTGGAGG + Intergenic
1162513890 19:11136814-11136836 GAGGGACAGGGTTGGCCCAGGGG + Intronic
1163029879 19:14537173-14537195 GGGGGGAAGGGGAGGCCGAGGGG + Intronic
1163173734 19:15550547-15550569 GAATGGAAGAGGTGGCCCTGGGG + Intronic
1163438472 19:17309668-17309690 GAGGGGGAGTGGGGGCCTGGAGG - Intronic
1163729192 19:18940064-18940086 GAGGGGAGGCCCTGGCCCAGCGG + Intronic
1163760382 19:19133142-19133164 GCGGGGAAGCCGAGGCCCAGAGG - Exonic
1164398836 19:27889045-27889067 GAGGGGAAGGCCTGGTCCAGAGG - Intergenic
1164430752 19:28186717-28186739 GAGGGGTGGTGGTGACACAGTGG - Intergenic
1165053110 19:33155757-33155779 GAGGGCAATTTGTGCCCCAGTGG + Intronic
1165076626 19:33283042-33283064 GCGGGGCAGTGGTGGCTCAGGGG + Intergenic
1165180686 19:33964899-33964921 GGGGGTAAGTGGTGGGACAGAGG - Intergenic
1166082340 19:40451912-40451934 GAGGGAAAGAGGAGCCCCAGAGG - Intronic
1167136106 19:47616672-47616694 AAGAGGAAATTGTGGCCCAGTGG - Intronic
1167291915 19:48629295-48629317 GGTGGGAAGTGGGAGCCCAGAGG - Exonic
1167593597 19:50416738-50416760 GAGGGCCAGTGGGGGCCCAGTGG - Intronic
1167690601 19:50982274-50982296 GAGGGTCAGTGGGGGCCCTGAGG + Intronic
1167798161 19:51724203-51724225 GAGGGGGAGTGATGGCAGAGAGG - Intergenic
1168293609 19:55368865-55368887 GGGGCCAGGTGGTGGCCCAGGGG + Exonic
1168433775 19:56302147-56302169 GGAGGGAAGTGGGGGCACAGAGG + Intronic
1168493370 19:56829865-56829887 CTGGGGAAGTGGGGGCCAAGTGG - Intronic
1168706911 19:58475663-58475685 GGCTGGAAGTGGCGGCCCAGTGG - Intronic
925235703 2:2275525-2275547 GAGGGAAAGTGGTTTCCTAGAGG + Intronic
925274258 2:2637659-2637681 GAGGGGCAGTGGAGCACCAGAGG + Intergenic
926890724 2:17637100-17637122 GAGGGGAAGAGCTGGGCAAGAGG - Intronic
927553436 2:24017406-24017428 GAGAGGGAGTGGGGTCCCAGGGG - Intronic
928371076 2:30740670-30740692 GAGGGTGACTGGTGGCCCATAGG - Intronic
928507924 2:31973119-31973141 GAGTGGAATTGGTGGGTCAGTGG - Intronic
928854840 2:35790758-35790780 GAGGGGAGTTGGTGGGCAAGTGG - Intergenic
929450676 2:42034975-42034997 GAGGGAAAGTGGGGAGCCAGAGG + Intergenic
930020135 2:46996685-46996707 GTGGGTAAGTGGTTGCCCAGGGG + Intronic
931063606 2:58559054-58559076 GAGGAAAAATGGTGGCACAGAGG - Intergenic
931223639 2:60310416-60310438 GAGGGAAAGTGCTGACCCAAGGG + Intergenic
931339750 2:61388429-61388451 GAGGGGATGTGGGGGTACAGGGG + Intronic
931426895 2:62179540-62179562 GAGGGGAAATGGTGGCTCTTTGG + Intergenic
932449285 2:71799278-71799300 GAAGGGAAGTGAGGGGCCAGTGG + Intergenic
932469605 2:71945244-71945266 GAGGGGAAATGGAGGCAGAGTGG - Intergenic
933090687 2:78112105-78112127 GAGGGGAGTTGGTGGGCAAGTGG + Intergenic
933856140 2:86416272-86416294 GAGGAGGACTGGAGGCCCAGTGG + Intergenic
934126438 2:88897364-88897386 CAGGGGACTTGGTGGCACAGAGG - Intergenic
936018787 2:108979364-108979386 TGGGGGAAGTGGTGGGGCAGGGG - Intronic
936259628 2:110947765-110947787 GAGGGGCAGTGGAGACCCTGTGG - Intronic
936610396 2:113996844-113996866 AAAGGGAAGTGATGGCTCAGGGG + Intergenic
937148909 2:119672408-119672430 CAGGGGAAGGCATGGCCCAGAGG + Intergenic
937983018 2:127625892-127625914 GAGGGGATGCTGAGGCCCAGAGG - Intronic
938031538 2:127998778-127998800 GAGGGGCCCTTGTGGCCCAGAGG - Intronic
938803425 2:134784562-134784584 GAGGTGAAGTGGTTGTCCCGAGG + Intergenic
938892058 2:135715635-135715657 GATGGAAAGTGGTGGTCCAGAGG - Exonic
940654611 2:156472907-156472929 AAGGGGCAGTGGTAGCTCAGAGG - Intronic
942457391 2:176147699-176147721 GCGGGGAAGTGGTGGGCTAAGGG + Intergenic
945089441 2:206165195-206165217 GAGCGGAACTGGAGGCCTAGGGG - Intergenic
945846243 2:214948490-214948512 GAGGGGAAATGGTGGGGCAGGGG + Intronic
946177631 2:217931111-217931133 GAGGGAAACTTGTGGCCCGGTGG + Intronic
946432843 2:219634739-219634761 GGGGGGAGCTGTTGGCCCAGGGG + Intronic
947651368 2:231788849-231788871 GATGGGAATTGGTGGGGCAGAGG + Intronic
947839421 2:233198160-233198182 CAGGGGCATTGGTGGCCCAAAGG - Exonic
947912663 2:233811624-233811646 CAGAGGAAGTGCTGGCCCAGGGG + Intronic
948230253 2:236344060-236344082 GGGGGGAAGTGGTGGAGGAGGGG + Intronic
948919245 2:241053615-241053637 GAGGCCAAGAGGTAGCCCAGGGG + Intronic
1170029085 20:11925353-11925375 CAGGGGAAGAAGTGGCCCAGAGG - Exonic
1170589708 20:17762553-17762575 GAGGGGAGGGGCTGGGCCAGAGG + Intergenic
1170887827 20:20356155-20356177 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887858 20:20356314-20356336 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887867 20:20356354-20356376 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887938 20:20356649-20356671 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887965 20:20356765-20356787 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170887997 20:20356900-20356922 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888048 20:20357136-20357158 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888079 20:20357296-20357318 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888088 20:20357336-20357358 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888154 20:20357635-20357657 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888163 20:20357675-20357697 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888282 20:20358174-20358196 GAGGGGAAGTGGTCACACTGAGG + Intronic
1170888295 20:20358232-20358254 GAGGGGAAGTGGTCACACTGAGG + Intronic
1171293099 20:23993862-23993884 GAGGGTAACCTGTGGCCCAGTGG + Intergenic
1171306647 20:24112642-24112664 GCAGGGCAGTGTTGGCCCAGAGG - Intergenic
1172036598 20:32015164-32015186 CAGGGGAAGTTGTGGCTCATTGG + Intronic
1172182969 20:33014840-33014862 AAGGGGAAATGGAAGCCCAGAGG + Intronic
1172295091 20:33804254-33804276 GATGGGAAGTGGTGACACATGGG - Intergenic
1172331140 20:34077002-34077024 GAGGGGAAGGGGTGGAGGAGGGG - Intronic
1172808682 20:37631857-37631879 GATGGGAAATGGTGGCGCCGCGG - Intergenic
1173674272 20:44820394-44820416 GTGGGGAAGCTGAGGCCCAGAGG - Intergenic
1173855525 20:46248122-46248144 GAGGGGAAACTGAGGCCCAGAGG - Intronic
1173863293 20:46297936-46297958 TAGGGGGAGTGGTGGAGCAGAGG - Intronic
1174202719 20:48818583-48818605 GAGGGGAAGTGGCGTACCTGAGG - Intronic
1174407210 20:50310198-50310220 GAGGGGCAGGGGAGTCCCAGCGG - Intergenic
1174407782 20:50313192-50313214 GAGGGGAAGGGGTTGGCCTGAGG + Intergenic
1174417032 20:50374157-50374179 GATGGGAGGTGGTGGGGCAGAGG + Intergenic
1174532726 20:51226938-51226960 GAAGGAAAGTGCTGGCCCTGTGG + Intergenic
1174740194 20:53005435-53005457 GAGGAGAAATGGTGGCCTAGAGG + Intronic
1175442712 20:59002536-59002558 GAGGGGATGTGCAGGTCCAGAGG - Intronic
1176089683 20:63313282-63313304 GTGGGGCAGGGATGGCCCAGGGG + Intronic
1176256481 20:64155733-64155755 GAGAGGGAGAGGTGGCCCACAGG - Intronic
1176375376 21:6084508-6084530 GAGGCGACGTGGGGGCTCAGAGG - Intergenic
1176960601 21:15154764-15154786 GAGGGGAGGTGGTTGCCATGGGG + Intergenic
1179513641 21:41891768-41891790 TAGGGGAAATGGAGGCCTAGGGG + Intronic
1179714583 21:43280538-43280560 GAGGGGAAGTGGAGGTGGAGGGG + Intergenic
1179714604 21:43280577-43280599 GAGGGGAGGTGGAGGGGCAGGGG + Intergenic
1179714760 21:43280934-43280956 GAGGGGAGGTGGGGGCAGAGGGG + Intergenic
1179748098 21:43453736-43453758 GAGGCGACGTGGGGGCTCAGAGG + Intergenic
1180795894 22:18605158-18605180 TCGGGGAAGATGTGGCCCAGAGG + Intergenic
1180952859 22:19728577-19728599 TGAGGGAAGTGGTGGCCCGGTGG - Intergenic
1181163011 22:20968652-20968674 GAGGGAAAGTGGGGGGCCAGAGG - Intronic
1181225830 22:21390113-21390135 TCGGGGAAGATGTGGCCCAGAGG - Intergenic
1181252803 22:21544700-21544722 TCGGGGAAGATGTGGCCCAGAGG + Intergenic
1181288520 22:21772513-21772535 GAAGTGAAGTGCTGGCCCTGAGG - Intronic
1181600390 22:23948580-23948602 CAGGGGAAGGTGTGGCCCTGGGG + Intergenic
1181608120 22:23992747-23992769 CAGGGGAAGGTGTGGCCCTGGGG - Intergenic
1182075665 22:27493786-27493808 GAGGGGAAGTGGTTGGCCCAAGG + Intergenic
1182076729 22:27500031-27500053 GAGGGCAAGGGGTGGAGCAGGGG - Intergenic
1182090636 22:27592174-27592196 GAGGTGAAGTGGAGGGCCCGGGG - Intergenic
1182423732 22:30260989-30261011 GAGGGCAAGGGGGAGCCCAGTGG + Intergenic
1183063778 22:35350241-35350263 GTGGGATCGTGGTGGCCCAGGGG - Intergenic
1183358027 22:37369808-37369830 GAGGGGAGATGGAGGCCCGGTGG - Exonic
1183619094 22:38962269-38962291 GAGGGGAAGGCAAGGCCCAGGGG - Intronic
1183672709 22:39282631-39282653 GAGGGGATGTGATGTCCCCGAGG - Intergenic
1183775267 22:39959971-39959993 GTGGAGAAGAGGTGACCCAGAGG - Intronic
1184177380 22:42795913-42795935 GAGGGGAAGGGGAGGGGCAGTGG + Intergenic
1184516536 22:44965906-44965928 GAGAGGAAGTGGTGGAGCAGGGG - Intronic
1184522589 22:45004095-45004117 GAGGGGAAGTGACAGCCAAGGGG + Intronic
1184695560 22:46137108-46137130 GTGGGGACATGGAGGCCCAGAGG - Intergenic
1184746879 22:46461420-46461442 GAGGGGATCTGCTGGCCCAGGGG + Intronic
1185384446 22:50525430-50525452 GAGGGGAGGAGGTAGCCCTGAGG - Intronic
949595910 3:5547321-5547343 GGGGGGAAGTGCTGGCTGAGGGG + Intergenic
950574236 3:13821781-13821803 GAGGGGCTGTGGTTGGCCAGGGG + Intronic
951636878 3:24788873-24788895 AAGAGGTAGTGGAGGCCCAGGGG + Intergenic
952421530 3:33136034-33136056 GAGTGGGAATGTTGGCCCAGAGG - Intronic
953697535 3:45171691-45171713 GAGGGGCAAATGTGGCCCAGGGG - Intergenic
954620823 3:51994439-51994461 GAGGGGAGGGGGTGTCCCTGAGG - Intronic
956272288 3:67460936-67460958 GAGGGGAAGTGGAGAGACAGAGG + Intronic
959110284 3:102114997-102115019 GAGGGGCAGGGGAGGCACAGCGG - Intronic
960236203 3:115285505-115285527 GTGGGGTAGTGGTGTGCCAGGGG - Intergenic
961138429 3:124534369-124534391 GTGGGGACGTGGGGGGCCAGGGG + Intronic
961591681 3:127986017-127986039 GGAGGGAAGTGGAGGCCCTGTGG - Exonic
962320925 3:134389569-134389591 GAGGGGCTGTGTGGGCCCAGGGG - Intergenic
962742268 3:138370453-138370475 GGGAGGGAGGGGTGGCCCAGTGG - Intronic
962960749 3:140309286-140309308 GAGGGGCAGTGAAGGACCAGAGG + Intronic
963109781 3:141678392-141678414 GAGAGAAAGTGGGAGCCCAGTGG - Intergenic
963376126 3:144467314-144467336 TAGGCTTAGTGGTGGCCCAGAGG + Intergenic
963853171 3:150227635-150227657 GAGGGAAAGTGGTGGCAGTGGGG + Intergenic
964812215 3:160677825-160677847 CAGGGGAGGGGCTGGCCCAGGGG + Exonic
965121080 3:164558531-164558553 GTTGGGAAGTGGAGCCCCAGAGG - Intergenic
966416752 3:179697086-179697108 GAGGTGAAGTGGTGGCTCCTTGG - Intronic
966609191 3:181851405-181851427 GAGTGGGGGTGGGGGCCCAGTGG - Intergenic
966881254 3:184352560-184352582 GAGGGGAAGTGGTGGAGCCCAGG + Intronic
968480375 4:830508-830530 GAGAGGCAGGGCTGGCCCAGGGG + Intergenic
968730123 4:2265572-2265594 GAAAGGAAGTTGGGGCCCAGTGG - Intergenic
969174215 4:5386364-5386386 GGGTGGAAATGGTGGGCCAGAGG + Intronic
971293053 4:25361686-25361708 GAGGGGAGTGGGTGGACCAGTGG - Intronic
972245535 4:37243291-37243313 CAGAGGAAGTGCAGGCCCAGAGG + Intergenic
972382907 4:38535970-38535992 GAGGGGAGGATGGGGCCCAGAGG - Intergenic
972880026 4:43410894-43410916 GCGGGGGAGTGGGGGGCCAGAGG - Intergenic
978859536 4:113431618-113431640 GACGGGAAGCAGTGCCCCAGAGG + Intergenic
980411835 4:132429924-132429946 GAGGGGAAGTGTTGCCTGAGAGG - Intergenic
980980778 4:139652996-139653018 GAGGAGAAGTGCAGGCGCAGTGG - Intergenic
982112790 4:152071928-152071950 GAGAGGCAGGGGTGGCTCAGTGG - Intergenic
982457054 4:155622881-155622903 GTGGGGATGGGGTGGCCTAGTGG - Intergenic
983670015 4:170226123-170226145 GAGGGGAAATGGGAGCCCAGTGG + Intergenic
985541686 5:490340-490362 GAGGGGCAGGGGAGGGCCAGGGG + Intronic
985577117 5:678628-678650 GAGGGTGCGTGGTGGCCCTGGGG + Intronic
985592036 5:770681-770703 GAGGGTGTGTGGTGGCCCTGGGG + Intergenic
985784329 5:1886228-1886250 GCGGGGAACTGGTGGCCCCCAGG - Intronic
986693739 5:10333961-10333983 GAGGGGCAGCGGCGACCCAGGGG + Intergenic
986910595 5:12550708-12550730 GTAGGGAAGTGGTGACACAGAGG + Intergenic
987507442 5:18792564-18792586 GAGGGGAGTGGGTGGACCAGTGG - Intergenic
989164528 5:38421688-38421710 GAGGAGAAGTGGTGCTGCAGTGG + Intronic
991001105 5:61783994-61784016 GAGGGGAAGCGGTGGGTAAGGGG - Intergenic
991443508 5:66676240-66676262 GAGGGGAAGAGCTAGACCAGTGG + Intronic
991488851 5:67164689-67164711 GGGGAGAACTGGTGGCACAGAGG - Exonic
991528852 5:67593639-67593661 GGTGGGCAGTGGTGGTCCAGAGG + Intergenic
992997193 5:82345481-82345503 GAGAGGAAGGGGTGGGACAGTGG + Intronic
994981239 5:106876606-106876628 GAGGGGAGTTGGTGGGCCAGTGG + Intergenic
995190996 5:109319251-109319273 CAGGGGAAGTGGTCGTGCAGTGG + Intergenic
995359284 5:111276306-111276328 GAGGAGTAGAGGTGGCCCACAGG - Intronic
995541681 5:113191779-113191801 CATGGGGAGTGGTGGCCCACTGG - Intronic
997974078 5:138428564-138428586 GATGGGAAGTGGGTGCCCAGTGG + Intronic
998355336 5:141530624-141530646 ATGGGGAAGTGGTGGGGCAGTGG - Intronic
998400962 5:141849024-141849046 GAGGAGATGTGGTGGCCGACTGG - Intergenic
999133168 5:149299827-149299849 GTGGGGAGGTGGGGCCCCAGTGG - Intronic
1000971580 5:167720776-167720798 GAGTGAAAGTGGAAGCCCAGAGG + Intronic
1001014027 5:168124737-168124759 GATGGGAACTGGTGACCCACTGG + Intronic
1001015938 5:168141051-168141073 GAGGGGAAGGCATAGCCCAGCGG - Intronic
1001415908 5:171544785-171544807 GGGGGTAAGTGGTGGGCCATGGG - Intergenic
1001906480 5:175478068-175478090 GAGGGGATGTGGAGGCAGAGAGG - Intronic
1002294310 5:178221686-178221708 GAGGAGAGGAGGAGGCCCAGAGG - Intronic
1002313295 5:178327753-178327775 GAGGGGAGCAGGTAGCCCAGTGG - Intronic
1002497361 5:179624292-179624314 AAGGGGAAGTGGAGGCACACAGG - Exonic
1002569316 5:180130999-180131021 GAGGGGTGGTGATGGCCTAGAGG - Intronic
1002733387 5:181360744-181360766 GAGGACAAGTGCTGGCCTAGAGG - Intergenic
1005332670 6:24764864-24764886 GAGGCGAAAGGGAGGCCCAGTGG - Intergenic
1005366013 6:25077699-25077721 GATGGGTAGTGGTGTCTCAGCGG + Intergenic
1006296548 6:33172488-33172510 GAGGGGAAGTGGGGGAGCTGGGG - Intronic
1006320502 6:33316872-33316894 CAGGGGAAGTGCTGCCCCACTGG + Exonic
1006513409 6:34533476-34533498 GAGGGAGAGTGGGGGGCCAGGGG - Exonic
1006720590 6:36147607-36147629 GAAGAGATGTGGTGGCCCAGTGG - Intergenic
1006838394 6:37013187-37013209 GTGAGGAAGTGGAGGCTCAGAGG - Intronic
1007103420 6:39267276-39267298 AAGAGAAAGTGATGGCCCAGAGG - Intergenic
1008981203 6:57486095-57486117 GTGTGGAAGTGCTGGACCAGTGG + Intronic
1009169294 6:60379057-60379079 GTGTGGAAGTGCTGGACCAGTGG + Intergenic
1010035759 6:71324098-71324120 GAGGGGATGAGGGGGCCTAGAGG + Intergenic
1010902211 6:81441702-81441724 GAATGGCAGTGGTGGGCCAGTGG + Intergenic
1011421878 6:87181487-87181509 TGGGGGAAGTGGTGGGCCAAAGG + Intronic
1015547202 6:134373634-134373656 AAAGGGAAGTGCTGCCCCAGAGG - Intergenic
1016778866 6:147936437-147936459 GAGGGGCAGTGGTGGGGGAGGGG + Intergenic
1017106168 6:150890309-150890331 GAGGGGCAGTGGTGGTTCTGTGG + Intronic
1017180818 6:151550326-151550348 AAGGGCTAGTGGTGGCCCACAGG + Intronic
1017907312 6:158765635-158765657 GAGGGGCCGTGGTGTCCCTGGGG - Intergenic
1018273342 6:162103946-162103968 GAGGGCAAGTGGAGTCTCAGGGG + Intronic
1018584059 6:165335947-165335969 GGGGAGAAGTCGTGGCCCTGGGG + Intronic
1019237638 6:170633066-170633088 GAGGACAAGTGCTGGCCTAGAGG - Intergenic
1019347671 7:538728-538750 GTGAGGAAGTGGGGGCCCTGGGG - Intergenic
1019516118 7:1440909-1440931 AAGGGGAAGTTGAGGCCCAGAGG - Intronic
1020092704 7:5350273-5350295 GAGGGGTAGTAGCAGCCCAGGGG + Intronic
1020281724 7:6653379-6653401 ACGGGGAAGTGGAAGCCCAGCGG - Exonic
1021160751 7:17270651-17270673 CAGAGGAAGTTGTGGCCAAGGGG + Intergenic
1022203141 7:28137312-28137334 AAGGGGCAGGGGTGGACCAGAGG + Intronic
1022253135 7:28628631-28628653 GAGGGGACATGCTGGCCAAGGGG + Intronic
1023585039 7:41720297-41720319 GAGAGGAAGTGGTGGGTGAGAGG - Intergenic
1024983630 7:55177969-55177991 GGGAGGAAGTGATGGCCCAGTGG + Intronic
1024985333 7:55188980-55189002 GTGGGGAAGGGCTGGGCCAGAGG + Intronic
1025850257 7:65238843-65238865 GAGTGGAGCAGGTGGCCCAGGGG - Intergenic
1026726045 7:72870621-72870643 GAGGGGAAGGAGTGGCACATGGG - Intergenic
1026747889 7:73027004-73027026 GAGGGGAAGGAGTGGCACATGGG - Intergenic
1026751539 7:73055143-73055165 GAGGGGAAGGAGTGGCACATGGG - Intergenic
1026755188 7:73083257-73083279 GAGGGGAAGGAGTGGCACATGGG - Intergenic
1026758836 7:73111291-73111313 GAGGGGAAGGAGTGGCACATGGG - Intergenic
1026959084 7:74397238-74397260 GTGGGGTAGGGGTGGCCTAGGGG + Intronic
1027034095 7:74912298-74912320 GAGGGGAAGGAGTGGCACATGGG - Intergenic
1027088568 7:75282195-75282217 GAGGGGAAGGAGTGGCACATGGG + Intergenic
1027092211 7:75310123-75310145 GAGGGGAAGGAGTGGCACATGGG + Intergenic
1027095854 7:75338090-75338112 GAGGGGAAGGAGTGGCACATGGG + Intergenic
1027323487 7:77029602-77029624 GAGGGGAAGGAGTGGCACATGGG - Intergenic
1027420235 7:78011579-78011601 GAGGGGCAGTGGTGGTTCTGTGG - Intergenic
1029118800 7:98252498-98252520 GAGGAGAAGGGGTGGCGGAGAGG + Intronic
1029139571 7:98400637-98400659 GAGGGGCTGTGGAGGGCCAGGGG + Intronic
1029251005 7:99236339-99236361 GAGGGGAACTGGAGGCTCAAGGG - Intergenic
1029395954 7:100308801-100308823 GAGGGGAAGGAGTGGCACATGGG + Intronic
1029396177 7:100310187-100310209 GAGGGGAAGGAGTGGCACATGGG + Intronic
1029396403 7:100311577-100311599 GAGGGGAAGGAGTGGCACATGGG + Intronic
1029396627 7:100312967-100312989 GAGGGGAAGGAGTGGCACATGGG + Intronic
1029396852 7:100314359-100314381 GAGGGGAAGGAGTGGCACATGGG + Intronic
1029514945 7:101018398-101018420 CAGGGGAAGGGGTGGCCCCAGGG - Intronic
1029549629 7:101230811-101230833 GAGAGGAAGTGGTGGAGCAGAGG + Intergenic
1030662976 7:112241853-112241875 GAAGGGTAGTGGTGGCGGAGAGG + Intronic
1031273251 7:119682192-119682214 TAGTGGAAGTGGTGGACAAGGGG - Intergenic
1032706133 7:134422649-134422671 GAGGGGCAGTGGGGTCCAAGGGG + Intergenic
1033620953 7:143061674-143061696 GAAGGGAAGTAGTGGCCCCACGG + Intergenic
1034100548 7:148446272-148446294 GTGGGGCAGTGGTGCCCCTGTGG - Intergenic
1035510130 8:173545-173567 GAGGACAAGTGCTGGCCTAGAGG + Intergenic
1035654346 8:1294177-1294199 GAGGGGATGTGTGGGCCCTGTGG - Intergenic
1035690299 8:1555458-1555480 GGGGGGAAGCGGTGGCCCAGAGG - Intronic
1035767635 8:2119779-2119801 GAGGGGCAGTGCTGGCCTGGAGG + Intronic
1036692385 8:10951997-10952019 CAGGGGAAATCGTGGGCCAGTGG + Intronic
1036697131 8:10982904-10982926 GAGCGGAAATGGGGTCCCAGTGG - Intronic
1037784196 8:21892912-21892934 GCTGGGATGTGGGGGCCCAGAGG - Intergenic
1037948388 8:23003608-23003630 TAGGGGAAGTAGAGGCCCATTGG + Intronic
1038190791 8:25318497-25318519 GAGGGGAAGTGGGGGAGGAGAGG - Intronic
1039440476 8:37591778-37591800 GAGAGGAAGTGGGGGCCTAAGGG - Intergenic
1039793280 8:40892074-40892096 AGGGTGGAGTGGTGGCCCAGTGG - Intronic
1040047052 8:42975034-42975056 GACGGGAAGGGGTGGCTCTGGGG + Intronic
1041563436 8:59247442-59247464 GAGGTGAACTGGTGGGCCAGAGG + Intergenic
1042174028 8:66021433-66021455 GAGAGGAAGTGTTGTCCAAGAGG + Intergenic
1044346683 8:91112354-91112376 CAGGGGTAGTTGTGGCCAAGGGG - Intronic
1045367003 8:101485572-101485594 GGGTGGAGGTGGTGGCCTAGGGG + Intergenic
1047254816 8:123207084-123207106 GAGGGGAAGTGGAGGAGGAGGGG - Intronic
1047410092 8:124617357-124617379 GAGCAGACGTGGTGGCCCAAAGG + Intronic
1047751386 8:127883331-127883353 GAGGGGGAGTGGATGCGCAGAGG + Intergenic
1048611464 8:136027605-136027627 GAGGGGAAGTGGTTGACCGGAGG + Intergenic
1048986727 8:139738772-139738794 CCTGGGAAGTGGTGGCCCTGAGG - Intronic
1049009052 8:139875242-139875264 GATGGGATGAGGTGGCCCTGGGG + Intronic
1049019993 8:139949754-139949776 AAGGGGGAGTGGTGGCCAATGGG + Intronic
1049224185 8:141441823-141441845 CAGGGCAGGGGGTGGCCCAGGGG - Intergenic
1049325934 8:142021458-142021480 GGCAGGAACTGGTGGCCCAGTGG - Intergenic
1049361832 8:142215663-142215685 GAGGGGAAGGGCAGGCCAAGGGG + Intronic
1049498010 8:142945778-142945800 GAGGGGAAGCTGGGGCACAGAGG - Intergenic
1049758989 8:144323408-144323430 GAGGGGTAGGGGTAGCGCAGTGG - Intronic
1050043572 9:1520839-1520861 GATGGGACGTGGTGGGCCAATGG - Intergenic
1051196991 9:14572951-14572973 GAGGGGAAGATGTGATCCAGGGG - Intergenic
1052818519 9:33120763-33120785 GAGGGGAATTGCTGACTCAGAGG - Intronic
1055282864 9:74694948-74694970 GAAGGAAAGTGATGGCCCATTGG + Intergenic
1055323631 9:75106099-75106121 TAGGGGAAGTGGTGGGGAAGAGG + Intronic
1056965141 9:91159245-91159267 AAGGGGAAGGGGTGGGGCAGGGG + Intergenic
1057040984 9:91847285-91847307 GAGGGAAAGTGGCCTCCCAGAGG - Intronic
1057080430 9:92170921-92170943 GAGGGGGAGGGGTGGGCCGGAGG + Intergenic
1057216999 9:93234649-93234671 GAGGGGCAGGGCTGGCCCTGGGG + Intronic
1058606903 9:106732642-106732664 GAAGGGAAGTACTGGCACAGAGG - Intergenic
1059362204 9:113753682-113753704 CAGGGGCAGTGGAAGCCCAGAGG + Intergenic
1060106312 9:120875777-120875799 GAAGGAAATTGGTGGCCCTGCGG - Intronic
1060757388 9:126223426-126223448 GAGGGGCACTGGAGACCCAGAGG + Intergenic
1060768709 9:126314658-126314680 AAGCGGAAGTGGTGGGGCAGGGG - Intergenic
1060986464 9:127822112-127822134 CAAGGGAAGTGGTGGCCAAAGGG + Intronic
1061415040 9:130443033-130443055 CAGGGTGAGTGGTTGCCCAGAGG - Intergenic
1061875410 9:133541091-133541113 GAGGGGAAGAACTTGCCCAGTGG - Intronic
1061899458 9:133665647-133665669 GTGGGGAAGTGGCAGCCCATGGG - Intronic
1061993964 9:134174811-134174833 GAAGGGAAAGGGTGGCCCTGGGG - Intergenic
1062046276 9:134425898-134425920 CTGCGGAAGTGGTGGCTCAGAGG + Intronic
1062212181 9:135371131-135371153 GAGGGGTAGTGGTTCCCCCGAGG - Intergenic
1062535291 9:137018585-137018607 GAGGGGAAGTGGCGGGTGAGGGG + Intronic
1062564047 9:137156104-137156126 GAGGGGAAGCGGAGGCACATGGG - Intronic
1062696839 9:137879977-137879999 CAGAGCAAGTGGGGGCCCAGGGG + Intronic
1062717078 9:138016470-138016492 GAGGTGTCCTGGTGGCCCAGAGG + Intronic
1190066538 X:47245294-47245316 AATGGGGAGTGGGGGCCCAGCGG - Intronic
1190194373 X:48304740-48304762 GGGGCAAAGTAGTGGCCCAGGGG - Intergenic
1192168064 X:68838413-68838435 GTGTGGAAGGGGTGGCCCATGGG - Intronic
1192205836 X:69095420-69095442 GAAGGGAAGGGGAGGGCCAGAGG - Intergenic
1192261711 X:69509484-69509506 GAGGGGAAATAGAGGCCCAAGGG + Intronic
1196972154 X:121121551-121121573 GAGGGGAAGAGGAGGCCTAGGGG - Intergenic
1197753250 X:129979911-129979933 GTGGGGAAGTGGGGGGCCGGGGG + Intergenic
1197757001 X:130002534-130002556 GAGGGGAGGGGGAGGCACAGGGG + Intronic
1197790470 X:130249042-130249064 TAGTGGCAGTGGTGGCTCAGGGG - Intronic
1198871944 X:141185341-141185363 GAAGGGTAGTGGGGGCCTAGGGG - Intergenic
1199089330 X:143672499-143672521 GTGGGGAATTGTTGGGCCAGAGG + Intergenic
1200068373 X:153515734-153515756 ATGGGGAAGTGGAGGCCCAGAGG - Intergenic
1200111560 X:153743393-153743415 GAGGGGAGGAGGTGGCCTGGCGG + Intronic
1200746851 Y:6910825-6910847 GCGGGGCAGAGGCGGCCCAGGGG + Exonic
1201670033 Y:16509644-16509666 GAGGGGAAATGGTGGGAAAGTGG - Intergenic
1202187144 Y:22197382-22197404 GGGGGGCAGTGGTGGGACAGCGG + Intergenic
1202204216 Y:22389014-22389036 GGGGGGCAGTGGTGGGACAGCGG - Intronic
1202241113 Y:22770837-22770859 GGGGGGCAGTGGTGGGACAGCGG - Intergenic
1202394099 Y:24404580-24404602 GGGGGGCAGTGGTGGGACAGCGG - Intergenic
1202476686 Y:25265512-25265534 GGGGGGCAGTGGTGGGACAGCGG + Intergenic