ID: 903189004

View in Genome Browser
Species Human (GRCh38)
Location 1:21646017-21646039
Sequence AGAGGGGAAGTGGTGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 438}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189004_903189017 26 Left 903189004 1:21646017-21646039 CCCTGGGCCACCACTTCCCCTCT 0: 1
1: 0
2: 3
3: 52
4: 438
Right 903189017 1:21646066-21646088 AATGGGGATGGACAGTAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 172
903189004_903189012 9 Left 903189004 1:21646017-21646039 CCCTGGGCCACCACTTCCCCTCT 0: 1
1: 0
2: 3
3: 52
4: 438
Right 903189012 1:21646049-21646071 AGTTCCCTCATCTGTAAAATGGG 0: 30
1: 766
2: 3523
3: 8849
4: 15187
903189004_903189011 8 Left 903189004 1:21646017-21646039 CCCTGGGCCACCACTTCCCCTCT 0: 1
1: 0
2: 3
3: 52
4: 438
Right 903189011 1:21646048-21646070 CAGTTCCCTCATCTGTAAAATGG 0: 37
1: 931
2: 4071
3: 9755
4: 16832
903189004_903189016 14 Left 903189004 1:21646017-21646039 CCCTGGGCCACCACTTCCCCTCT 0: 1
1: 0
2: 3
3: 52
4: 438
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189004_903189013 10 Left 903189004 1:21646017-21646039 CCCTGGGCCACCACTTCCCCTCT 0: 1
1: 0
2: 3
3: 52
4: 438
Right 903189013 1:21646050-21646072 GTTCCCTCATCTGTAAAATGGGG 0: 23
1: 594
2: 2828
3: 6721
4: 11858
903189004_903189018 27 Left 903189004 1:21646017-21646039 CCCTGGGCCACCACTTCCCCTCT 0: 1
1: 0
2: 3
3: 52
4: 438
Right 903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189004 Original CRISPR AGAGGGGAAGTGGTGGCCCA GGG (reversed) Intronic
900143975 1:1150121-1150143 AGGTGGGAGGTGGTGGCCCAGGG + Intergenic
900539218 1:3194450-3194472 AGAGGGGAAGGGGTAGACCATGG + Intronic
900553096 1:3266311-3266333 AGCCGGGCAGGGGTGGCCCAAGG + Intronic
900996267 1:6125073-6125095 AGGGGCTAGGTGGTGGCCCAGGG - Intronic
901066258 1:6496144-6496166 CCAGGGGAAGTGGTCTCCCACGG - Intronic
901210053 1:7519574-7519596 AGAGTGGCAGAGGTGGCTCAGGG - Intronic
901784664 1:11616825-11616847 AGAGGGGAGTGGCTGGCCCAGGG + Intergenic
901807471 1:11747648-11747670 CAATGGGAAGTGGTGGCCCAAGG - Intronic
902764968 1:18607981-18608003 GGAGGGAAGGTGGTGGACCATGG - Intergenic
902765259 1:18610201-18610223 AGAAAGGAAGTGATTGCCCAGGG + Intergenic
903189004 1:21646017-21646039 AGAGGGGAAGTGGTGGCCCAGGG - Intronic
904137690 1:28326678-28326700 GGAGGGGAAGTGAATGCCCATGG + Intergenic
904368443 1:30033581-30033603 AGAGGGGCAGAGCTGGCTCATGG - Intergenic
904756232 1:32770266-32770288 ACAGTGGACGTGGTGGCCCTAGG + Exonic
905654368 1:39676626-39676648 ACAGGGGAATGGGTGACCCAGGG + Intergenic
906530588 1:46521537-46521559 GAAGAGGAAGTGGTGGCCCTTGG - Intergenic
906800218 1:48730520-48730542 AGAGTGGGTGTGGTGGCCCTTGG + Intronic
907472710 1:54684741-54684763 AGAGGGGAAGTGATTGACCACGG - Intronic
910452642 1:87362670-87362692 AGAGGTGAAGTGGTTGCATAAGG - Intergenic
912485601 1:110025174-110025196 AGAGGGGAACTGCTGCTCCAAGG - Intergenic
912796885 1:112698823-112698845 AGTGGGCAAGTGGGGGCACACGG - Intronic
913371357 1:118103177-118103199 GGAGTGGAAGTGGAGGTCCAGGG + Intronic
914845214 1:151280144-151280166 ATAGGGCAAGTGGTGGCTCCAGG + Exonic
914858572 1:151369363-151369385 AGCTGGGAAGGGGGGGCCCAGGG + Intronic
915552639 1:156644224-156644246 AGAGGTGAAAGGGTGGTCCAGGG + Intronic
915718481 1:157966093-157966115 GGAGGGGAAGTGGAGGCCTCTGG - Intergenic
915736763 1:158090166-158090188 AGAGGGGAAGTGTTAGCCCAGGG - Intronic
915997185 1:160575297-160575319 AGAGGGGAAGAGGAAGCACAGGG + Intronic
916171622 1:162005354-162005376 AGTTGGGAAGTGGTGGCAGAGGG - Intronic
916445812 1:164870844-164870866 AGATGGGGAGTGATGCCCCATGG - Intronic
917264658 1:173207650-173207672 TTAGGGGAAATGCTGGCCCAAGG + Intergenic
917386617 1:174483276-174483298 AGAGGGGAAGTTGTGGCAGGGGG - Intronic
918223721 1:182459099-182459121 GGATGGGAAGTGGCAGCCCATGG + Intronic
919813102 1:201421302-201421324 CCAGGGGAAGGGGTGGCCCTGGG - Intronic
921357905 1:214303831-214303853 AGGGGGGACGAGGTGGCACAGGG + Intronic
922236045 1:223723504-223723526 CGAGGGGACATGATGGCCCATGG - Intronic
922236359 1:223725659-223725681 ACAGAGGAGGTGGTGTCCCAGGG + Intronic
922934219 1:229411325-229411347 GGAGGGGAAGAGGAGGCCGAGGG - Intergenic
923456051 1:234166612-234166634 AGAGAGGACCAGGTGGCCCAAGG + Intronic
923707158 1:236353234-236353256 GGAGGGGAAGAGTTTGCCCAAGG - Intronic
924470709 1:244340353-244340375 AAAGGAGAAGATGTGGCCCAGGG - Intergenic
1063566441 10:7175327-7175349 TCAGGGGAAGCGGTTGCCCAAGG + Intronic
1064016839 10:11779434-11779456 AGAGGGGCAAGGGTGGCCCTGGG + Intergenic
1064379820 10:14831313-14831335 AGAGTGGAAGTGGGAGTCCAGGG - Intronic
1064560973 10:16595260-16595282 AGAGGGGAAGGGCTGGCAGATGG + Intronic
1065895422 10:30159148-30159170 GGAGGGGAAGTGGAGGCAGAGGG - Intergenic
1066058202 10:31700529-31700551 GGATGGGATGGGGTGGCCCAGGG + Intergenic
1067177481 10:43960212-43960234 AGATGGGAAGTGGGGACCCTGGG - Intergenic
1067941488 10:50660462-50660484 AGTGGAGAAGTGAAGGCCCATGG + Intergenic
1069943182 10:71969290-71969312 AGAGGTGCAGTGGATGCCCAAGG + Intronic
1070227381 10:74523957-74523979 AGAGGGGTAGGGGTGGATCATGG - Intronic
1070343870 10:75523036-75523058 AGAGGGGAAATGATTGTCCAAGG - Intronic
1070718319 10:78738767-78738789 AGTGGGCACGTGGTTGCCCAGGG - Intergenic
1071289485 10:84177855-84177877 AGAGGGGAAGTGGAGGGGGAGGG - Intronic
1071309205 10:84327713-84327735 AGAGGGGAAGAGATGGCCTCTGG + Intergenic
1071495582 10:86165493-86165515 AGAGGGGAGGTGTTGAGCCAGGG + Intronic
1071634152 10:87236025-87236047 AGGGGGGCAGAGTTGGCCCATGG - Intronic
1071647602 10:87368242-87368264 AGGGGGGCAGAGTTGGCCCATGG - Intronic
1072486194 10:95858241-95858263 GGAGGGGAAGTGGAAGTCCAGGG + Intronic
1072816904 10:98518368-98518390 AGAGGGAAAGTTTTTGCCCAAGG - Intronic
1072831168 10:98660399-98660421 AGAGGTGAAATTGTGGTCCAAGG + Intronic
1073674855 10:105634361-105634383 AGTGGGAAAGTTTTGGCCCACGG + Intergenic
1074075356 10:110118602-110118624 ATAGGAGAAGTGGTTGACCAGGG + Exonic
1074095071 10:110304672-110304694 CGAGGTGAAGCGGAGGCCCAAGG - Intronic
1075778824 10:125004147-125004169 AGAGGGGCAGGGGTGACCCCAGG + Intronic
1075845866 10:125544624-125544646 AGAGGGGGAGCTGTGCCCCAGGG + Intergenic
1076401268 10:130186908-130186930 AGATGGGAGGTGGTGGCCCACGG + Intergenic
1076848880 10:133083326-133083348 AGAGGGGAAATGGCGGCCTCCGG - Intronic
1077529022 11:3086543-3086565 AGAAGGGAGGTGGTGACCCGAGG + Intergenic
1078245602 11:9571420-9571442 GGAGGGGAAGTGTTGGAGCAAGG + Intergenic
1078430296 11:11283025-11283047 GGAGGGGAGGAGGTGGCCCACGG + Intronic
1078866344 11:15301609-15301631 AAAGAGGAGGAGGTGGCCCAGGG + Intergenic
1079026136 11:16949268-16949290 AGGTGGGAAGGGGTGGCACAGGG + Intronic
1079233460 11:18669953-18669975 AGAGGGGAAGCGCTGGCTTAGGG + Intergenic
1082822538 11:57553914-57553936 AGAGGTGAAGTGGTTGCCTAAGG - Intronic
1083069410 11:59961339-59961361 AGAAGGGAAGTGGTGTAACAAGG - Intergenic
1083733580 11:64667199-64667221 AGATGGAAAGGGGTGGCCCATGG + Intronic
1084360071 11:68663505-68663527 AGAGGGAATTTGGTGACCCAAGG + Intergenic
1084608032 11:70183945-70183967 AGAGGTCAAGTGATTGCCCAGGG + Intronic
1084622439 11:70282166-70282188 AGACGGGAATTGGAGGCCAAGGG - Intronic
1084903554 11:72328477-72328499 TGAGGGGATGTGGTAGCCCAAGG + Intronic
1085463571 11:76709621-76709643 AGAGGGGAAGCTGTGGACCTGGG - Intergenic
1085470303 11:76753284-76753306 AGAAGGGAAGTGAAGACCCAAGG + Intergenic
1085515543 11:77109763-77109785 GGAGGGGAAATGGAGGCCCTTGG + Intronic
1085527382 11:77172288-77172310 AGCTAGGAAGTGGTGGGCCAGGG + Intronic
1088633351 11:111795387-111795409 TGGGGGGCTGTGGTGGCCCATGG + Intronic
1089329976 11:117682364-117682386 AGAGGGGAATGAGTGGCTCATGG - Intronic
1090703550 11:129316549-129316571 AGTGGGGAGGTGGAGGCCCCAGG - Intergenic
1090848698 11:130551565-130551587 AAAGGGGAAGGGCTTGCCCACGG + Intergenic
1091410543 12:236485-236507 AGAGGGGAGGCTGTGGCTCAAGG - Intronic
1091578281 12:1760464-1760486 AGATGGGAAGTGATGGCAAATGG - Intronic
1091674951 12:2482407-2482429 AGCTGGGAAGTGGTGGCACAGGG - Intronic
1091855342 12:3734873-3734895 AGAGGGGAAATGTTGGTCCAAGG + Intronic
1091900593 12:4141104-4141126 AGAGGAGACCTGGAGGCCCAGGG + Intergenic
1092071701 12:5636717-5636739 GGAGGGGAAGTGGGGGCCTCTGG + Intronic
1092290863 12:7158718-7158740 GGAGGGGACGTGGGGGCCCCGGG + Exonic
1093158306 12:15714964-15714986 AGATGGGAAGGAATGGCCCAGGG - Intronic
1094302621 12:28982600-28982622 GGAGGGGTAGTGGTGACTCAGGG - Intergenic
1095865235 12:46964576-46964598 AGTGGGGAAGTGGTGGCACGGGG - Intergenic
1096573287 12:52537125-52537147 GGAGGGGAAGAGGAGGCGCAGGG - Intergenic
1097659875 12:62417732-62417754 ACAAGGGAAGTGGTGTACCATGG + Intergenic
1097845738 12:64363545-64363567 AGAGGGGAAATGGTTGCCAGAGG + Intronic
1099055440 12:77834095-77834117 AATGGGGAGGTGGTGGGCCAGGG + Intronic
1099074216 12:78084569-78084591 AGAGAGAGAGTGGTGGCTCAAGG - Intronic
1099315652 12:81079001-81079023 GGAGGGGAAGTGGTGAGTCAGGG + Intronic
1101660412 12:106760091-106760113 AGTTGGAAAGTGGAGGCCCAGGG - Intronic
1101896700 12:108762321-108762343 ACAGGAGAAGGGGTAGCCCATGG - Intergenic
1102136765 12:110582476-110582498 GGAGGGGACGAGGTCGCCCAGGG + Intronic
1102534380 12:113569859-113569881 AGATGGGAAGGAGTGGCCCCCGG + Intergenic
1104770268 12:131357295-131357317 GGAGGTGAAGAGGTGGCCTATGG - Intergenic
1105454088 13:20525136-20525158 AGAGGGGAGGTGGGGGCCGATGG - Intronic
1105540670 13:21313572-21313594 AGAGGGTATAGGGTGGCCCAGGG + Intergenic
1107155152 13:37157561-37157583 AGAGGGGAAGGAGGGGCACAAGG - Intergenic
1107834259 13:44400914-44400936 AGAGAGGAAGTCATGGCCCATGG - Intergenic
1111353461 13:87064192-87064214 AGACGGAGTGTGGTGGCCCATGG - Intergenic
1112299962 13:98221029-98221051 AAAGGGGAAGTGCAGGCCCTGGG + Intronic
1113347489 13:109494438-109494460 AGAGGTTAAATGGTGGCCCAAGG - Intergenic
1113820014 13:113206878-113206900 AGAAGGGAAGGGGTGACCCAGGG - Intronic
1114827222 14:26095503-26095525 AGAGTGGTAGTGGTGGTCTAAGG - Intergenic
1115715255 14:36096517-36096539 AGAAGGGACGTGAGGGCCCAGGG - Intergenic
1116402836 14:44530076-44530098 AGAGGGAAAGAGGTGACACAAGG + Intergenic
1117356786 14:54931939-54931961 AGAGGTTAAGTGGTCCCCCAAGG + Intergenic
1117368315 14:55052228-55052250 AGAGGGGAAATCGGGGCCAAGGG - Intronic
1117980623 14:61339254-61339276 AGAAGGGAAGGCCTGGCCCAGGG - Intronic
1118843365 14:69528465-69528487 GGAGGGGAAGGGGTGGCAGAGGG + Exonic
1119431480 14:74570748-74570770 AGCAGGGAAGTGCTGGGCCAGGG + Intronic
1119633912 14:76258297-76258319 AGGGGGGCAGTGGTCCCCCACGG + Intergenic
1119826341 14:77660242-77660264 AGAGGAGCAGTGGTGGCCAGCGG - Intergenic
1119862239 14:77944550-77944572 GCAGGGGAAGTGGAGGCTCAGGG - Intergenic
1120050338 14:79858720-79858742 AGAGAGGAAGTGAAGGCCCATGG - Intronic
1120395773 14:83965259-83965281 AGTGGTTAAGTGGTGGCCAATGG - Intergenic
1121230684 14:92355332-92355354 AGAGGGCAGATGGTGGCACAGGG + Intronic
1121254990 14:92524760-92524782 AGAGGGGAAGTGGTTTCCCCAGG + Intronic
1121501252 14:94440154-94440176 TGAGGGGAAGTTGTGTCACATGG - Intergenic
1121509982 14:94505389-94505411 CGAGGGAAGGTGGTGGCTCAGGG - Intronic
1122047506 14:99034486-99034508 AGAGGGGAAGCGGAGGACAAAGG + Intergenic
1122444749 14:101760898-101760920 CGAGGGGAAGGGCTGGCCGAGGG + Intergenic
1124624968 15:31302556-31302578 AGAGGGGACGTCATGGCCCCAGG + Intergenic
1125002352 15:34784773-34784795 AGAGGGGCAGAGGTGGGCTACGG - Intergenic
1125719925 15:41840397-41840419 GGAGGGGAAGTGGGGGCCAGAGG - Intronic
1125728508 15:41880311-41880333 AGCTGGGGAGAGGTGGCCCAAGG + Exonic
1125741741 15:41970037-41970059 TGAGCGGAAGGGTTGGCCCAGGG - Intronic
1125748441 15:42012906-42012928 AGAGGGGAAGTTGGCCCCCAAGG - Intronic
1126582613 15:50255129-50255151 GGAGGGGAAATGTTAGCCCAAGG - Intronic
1127169786 15:56289629-56289651 ATAGGGGAAGTTGTGGCTGAGGG + Intronic
1127624192 15:60764123-60764145 AGAGGGTAGGTGTTGGCCCATGG + Intronic
1128064069 15:64753689-64753711 TGAGGGGAAGACGTGTCCCAAGG - Intronic
1128359790 15:66953977-66953999 AGAGGGCACGTGATGGCACAGGG + Intergenic
1128485485 15:68082255-68082277 AAAGGGGAAGTAGTGGCATAAGG + Intronic
1128499109 15:68214756-68214778 AGAAGGGAAGTATTAGCCCAGGG - Intronic
1128568751 15:68718357-68718379 AGAGGGCAAGGGGTTACCCAAGG - Intronic
1128704141 15:69826268-69826290 AGAGGGAAAGGGATTGCCCAGGG - Intergenic
1128713707 15:69891556-69891578 AGAGAGAGAGTGGTGGCCCCAGG - Intergenic
1129204821 15:74030722-74030744 AGAGGTGAAGTGATTTCCCAAGG - Intronic
1129539997 15:76341373-76341395 AGAGGGGAGGGGGTGGCCTTGGG + Intronic
1129717258 15:77859676-77859698 GGAGGGGGAGAGGAGGCCCATGG + Intergenic
1130756734 15:86772141-86772163 AGAGGAGAGGTGGTTTCCCAAGG - Intronic
1130968892 15:88717390-88717412 GGAGGGGGAGCGGTGGCGCAAGG - Intergenic
1131057647 15:89385107-89385129 AGAGGGGAAGGGGTGTCCTGTGG - Intergenic
1131476223 15:92742466-92742488 AGTTGGGAAGTGGTGGACCTGGG + Intronic
1131771902 15:95746906-95746928 AGATGAGAAGTGGAGGCTCAGGG - Intergenic
1131845018 15:96481983-96482005 AGAAGGGAAATGGTGGCAGATGG - Intergenic
1132026182 15:98406128-98406150 ACAGAGGAAGGAGTGGCCCAGGG + Intergenic
1132647577 16:1006310-1006332 GGAGGGGAGGTGGTGGCACTGGG + Intergenic
1132929467 16:2451488-2451510 AGCGGGGAAGTGGGAGACCAGGG - Intronic
1132935396 16:2477923-2477945 AGAAGGGCAGTGGTGGCCCCAGG + Intronic
1133747287 16:8696818-8696840 ACAGGGGAAGTGGATGCCCTGGG - Intronic
1134023306 16:10936786-10936808 AATGGGGAAGTGGAGGCCGAGGG - Intronic
1134107133 16:11493167-11493189 AGAAGGGAGGTAGTGGTCCAGGG + Intronic
1134664971 16:16012217-16012239 AGAGGAGAAGGACTGGCCCAAGG + Intronic
1135529582 16:23241109-23241131 AGTGGGGAAGTGTCAGCCCAGGG - Intergenic
1137583461 16:49649271-49649293 AGAGGGGATATGCTTGCCCATGG - Intronic
1137725619 16:50654833-50654855 AGAGAGGAGGGGATGGCCCAGGG - Intergenic
1137876584 16:52002436-52002458 AGAGGGGAAGGGCTTGCCCAAGG + Intergenic
1138329780 16:56204387-56204409 AGAGTGGATGTGGTGTCCCTGGG + Intronic
1138504637 16:57472069-57472091 AGAGGGGAACTGGGGTCCAAAGG - Exonic
1139475665 16:67201434-67201456 AGGTAGGAAGTGGTGGGCCAGGG + Exonic
1139514676 16:67446152-67446174 GGAGGGGAGGTGGCAGCCCAGGG + Intronic
1139672587 16:68501874-68501896 AGAGGGGATCTGTTGGCCAATGG + Intergenic
1141985705 16:87578383-87578405 AGATGGGAAGTCGCTGCCCAAGG + Intergenic
1141995746 16:87635465-87635487 TGAGGGGCTGTGCTGGCCCAGGG + Intronic
1142148889 16:88504080-88504102 AGAGGGTGAGTGAGGGCCCAGGG - Intronic
1142211576 16:88811116-88811138 AGAGCCCAAGAGGTGGCCCAGGG - Intronic
1144519941 17:15946694-15946716 AGAGGAGGGGTGATGGCCCAGGG + Intronic
1144643509 17:16952757-16952779 AGAGGGGAGGTGGCTGCCCCAGG - Intronic
1144711436 17:17404069-17404091 AGACTGGAAGTGGGGGCCTAGGG + Intergenic
1145205242 17:20981319-20981341 AGAGGGGAGGTGGCTGCCCTAGG + Intergenic
1146272949 17:31496468-31496490 AGAGGGAAACTGGTGTTCCAAGG + Intronic
1146439637 17:32882733-32882755 GGAGGTGAATTGGTGGCCCGTGG - Intergenic
1146547327 17:33750259-33750281 AAAGAGGAAGGGGTTGCCCAGGG - Intronic
1146652439 17:34614923-34614945 AGAGGGGAAGGGAGGGACCATGG + Intronic
1147045865 17:37751733-37751755 AGAGGGTAAGGATTGGCCCAAGG + Intergenic
1147327242 17:39675292-39675314 GGAGGGGCTGTGGTGGGCCAGGG + Intronic
1147944679 17:44074225-44074247 AGAGGGGAACTGGTGAACCTGGG - Exonic
1148445538 17:47734824-47734846 AGTGGGGAAGGGGTGTCCCATGG + Intronic
1148630698 17:49106141-49106163 AGAGTAGAAGTTGAGGCCCAGGG + Intergenic
1149585450 17:57783208-57783230 AGGTGGGGGGTGGTGGCCCATGG - Intergenic
1149661029 17:58333899-58333921 GGAGGGGAAGTGGCTGCCCCAGG + Intergenic
1150004876 17:61463336-61463358 AGAGGGGAATTGGTGGGCAGGGG + Intronic
1151378557 17:73708752-73708774 AGAGGGAAAGGGCTTGCCCATGG - Intergenic
1151578267 17:74963558-74963580 GGAGGGGAACTGAGGGCCCAAGG + Intronic
1151888815 17:76940189-76940211 AGAGGGGAAGTGCTTGCCCGTGG + Intronic
1152132314 17:78484827-78484849 GGAGGGGAAGGCGTGGCCCCGGG - Intronic
1152247203 17:79191256-79191278 AGAGAGGGAATGGTGGCCCGGGG + Intronic
1152287897 17:79423060-79423082 AGAGGGGAGTTCGTGGCACACGG - Intronic
1152892798 17:82892018-82892040 AGGGGGGAAGTGGGGGGCCTGGG - Intronic
1153015054 18:576081-576103 AGAGGGGAGGTGGAGCCCCCAGG - Intergenic
1153228020 18:2912553-2912575 GGAAAGGAAGTGGTGGCCAAAGG - Intronic
1153843776 18:9030508-9030530 ATAGGGGATGGGGTGACCCAAGG + Intergenic
1157216263 18:45786196-45786218 AGAGGGGCAGTGCTGGCCTTAGG + Intergenic
1157502941 18:48203651-48203673 GGTGGGGCAGTGGGGGCCCATGG - Intronic
1158350555 18:56561173-56561195 AAAGAGGAAGTGCTGCCCCAGGG + Intergenic
1160023748 18:75202227-75202249 ATTGGGGAGGTGGTGGCCCTAGG - Exonic
1160594051 18:79962192-79962214 AGATGGGCAGTGGTGCCCCACGG - Intergenic
1161083904 19:2325153-2325175 AGTTGGCAAGTTGTGGCCCAAGG - Intronic
1161462018 19:4403095-4403117 AGAGGGGAAACTGAGGCCCAGGG + Intronic
1162157232 19:8686728-8686750 AGAGGGGAAGTGGCCTCCCACGG + Intergenic
1162332851 19:10041055-10041077 GGAGGGGCAGAGGTGGCCCTTGG - Intergenic
1162687496 19:12400189-12400211 AGAGGGGAAACGGTCGCCCTTGG + Intronic
1162691808 19:12440031-12440053 AGAGGGGAAACGGTCGCCCTTGG + Intronic
1162766775 19:12924610-12924632 AGGGGGGCAGGGGTGGGCCATGG - Intronic
1162799573 19:13103226-13103248 GGAGAGGAGGTGGGGGCCCAGGG - Intergenic
1162835320 19:13313180-13313202 AGAGGGGAAACTGAGGCCCATGG - Intronic
1163267067 19:16227868-16227890 AAAGGGGTGGTGGTGGCCAAAGG - Intronic
1164036962 19:21463922-21463944 AGAGAGGAAGGGGTGGCTCCCGG - Intronic
1164899472 19:31906168-31906190 AGAAGGGAAGTGTGGGGCCAAGG + Intergenic
1165076625 19:33283041-33283063 AGCGGGGCAGTGGTGGCTCAGGG + Intergenic
1165861275 19:38910829-38910851 GGAGAGGAAGAGGGGGCCCATGG - Exonic
1165993459 19:39828628-39828650 AGAGGGCAGGTGGTGGCCTGGGG + Intronic
1166677346 19:44748095-44748117 AGAGGGGAAGTGTTTGGCCAAGG + Intronic
1166774716 19:45305368-45305390 AGAGGGGAAATTGAGGCCTAGGG - Intergenic
1167077577 19:47258678-47258700 AGAGGGGATGGGGTCTCCCAGGG - Intronic
1167577623 19:50325412-50325434 AGAGGGACAGTGCTGGCCCTTGG - Intronic
1202648395 1_KI270706v1_random:160319-160341 AGAGGGGAAGGTGAGGCACATGG + Intergenic
925125292 2:1450372-1450394 AGAGGGGAACTAGGGTCCCAGGG + Intronic
925319645 2:2952248-2952270 AGAGCAGAAGTGGTGGCAGAAGG - Intergenic
926313014 2:11688059-11688081 TGAGTGTCAGTGGTGGCCCAGGG + Intronic
926315499 2:11706753-11706775 AGAGGGTAAGTGCTTGCTCAAGG - Intronic
927295842 2:21452330-21452352 AGGAGGGAAGTGCTGGCTCATGG - Intergenic
928025426 2:27735553-27735575 CGATGGGAAGTGCTTGCCCACGG - Intergenic
928089195 2:28363737-28363759 AGAGGGGCTGCGGTGCCCCAGGG - Intergenic
929079848 2:38111358-38111380 AGTCGGGAAGTGGGGGCCAAGGG - Intergenic
930020134 2:46996684-46996706 GGTGGGTAAGTGGTTGCCCAGGG + Intronic
931223638 2:60310415-60310437 AGAGGGAAAGTGCTGACCCAAGG + Intergenic
932012652 2:67993913-67993935 GGAGGGGAGATGGTGTCCCAGGG - Intergenic
932860666 2:75287983-75288005 AAAGGGCAAGAGGTGGCCTATGG - Intergenic
935014167 2:99164299-99164321 AGAGGGGAGGAGGGGGGCCATGG - Intronic
936053352 2:109242141-109242163 AGAGGGGAAGTGATTCCTCAGGG - Intronic
936285466 2:111177958-111177980 AGAGGAGAAATAGTGGCCCCAGG - Intergenic
936497586 2:113035862-113035884 AGAAGGGAAGTGGTTGCCTCAGG + Intronic
936709276 2:115112713-115112735 AGCGGGGAGGTGTTGGCCAAAGG + Intronic
937438829 2:121900234-121900256 AGAGGGGAAGTGACTGTCCAAGG + Intergenic
938251776 2:129821332-129821354 TGAGGGGAAGGGGTGGGCCCAGG - Intergenic
938828573 2:135031657-135031679 AGAAGGGAAGTGGGGAACCAGGG + Intronic
940936221 2:159497963-159497985 AGATGGGAAGTTGGGACCCAAGG - Intronic
941207430 2:162591145-162591167 AAAGGTGAAGTGGTTGCTCAAGG - Intronic
942457390 2:176147698-176147720 CGCGGGGAAGTGGTGGGCTAAGG + Intergenic
942483908 2:176419387-176419409 AGAGAGAAGGGGGTGGCCCAAGG - Intergenic
943815694 2:192251235-192251257 AGTGGGGAAGTGCTCACCCATGG + Intergenic
944662094 2:201929660-201929682 AGAGGGCAAGTAATGGTCCAAGG - Intergenic
945019625 2:205557837-205557859 AGAGGGTAGTTGGTGGCTCAAGG - Intronic
945846242 2:214948489-214948511 TGAGGGGAAATGGTGGGGCAGGG + Intronic
946110696 2:217412729-217412751 GAAGGTGAAGTGATGGCCCAAGG + Intronic
946143729 2:217713261-217713283 AGAGGGGAAGTGACAGCTCACGG - Intronic
946771853 2:223096859-223096881 AGAGGGGGCGAGGTGGTCCAGGG - Intronic
947216538 2:227755085-227755107 GGAGGGGAATTGGTGGCTGAAGG + Intergenic
947912662 2:233811623-233811645 GCAGAGGAAGTGCTGGCCCAGGG + Intronic
948341450 2:237256125-237256147 AGAAGGCAAGTGATGGCCCCTGG + Intergenic
948689709 2:239694176-239694198 AGGGAGGAAGTGGGGGCCCAAGG + Intergenic
1168841985 20:915509-915531 AGAGGGCAAGTGGCGGCCCTGGG - Intronic
1169000572 20:2164896-2164918 TGAGGGGAGGTGGAGGCCCAAGG + Intronic
1169291686 20:4358654-4358676 AGCTGGGAAATGGTGGCCAAGGG + Intergenic
1170570242 20:17628478-17628500 AGAGGGGCACGAGTGGCCCATGG - Intronic
1172190448 20:33059235-33059257 AGAGATGAAGTGATGGGCCAAGG + Intronic
1172295092 20:33804255-33804277 GGATGGGAAGTGGTGACACATGG - Intergenic
1172757877 20:37299975-37299997 ACAGGGGCAGTGGTGGCCAGTGG - Intronic
1173587484 20:44193821-44193843 AGATAGGAAGGGGTGGGCCAGGG - Intergenic
1174363864 20:50044490-50044512 AGAGGGGAGGTGATTGTCCAAGG - Intergenic
1175687015 20:61038830-61038852 AGGTGGTAAGTGGTAGCCCAGGG + Intergenic
1175868279 20:62193235-62193257 AGAGGGCAAGACGTGACCCAGGG + Intronic
1176603457 21:8812370-8812392 AGAGGGGAAGGTGAGGCACATGG - Intergenic
1178803369 21:35817769-35817791 AGAGCAGGAGTGGAGGCCCAAGG + Intronic
1179068934 21:38053753-38053775 AGAGAGGCAGAGGTGGCCCTCGG - Intronic
1179716459 21:43291157-43291179 GCAGGGGCAGTGGTGGACCAGGG + Intergenic
1179895259 21:44358286-44358308 AGATGAGGATTGGTGGCCCAGGG - Intronic
1180063897 21:45403398-45403420 TGGGTGGAAGTGGTGCCCCAGGG + Intergenic
1180345740 22:11703928-11703950 AGAGGGGAAGGTGAGGCACATGG - Intergenic
1180921871 22:19525279-19525301 CCAGGGGCAGTGGTGGCCCCAGG + Intronic
1181080095 22:20408123-20408145 AGAGGGGAAGCTGAAGCCCAGGG + Exonic
1181552613 22:23649358-23649380 AGAGAGGAAGAGGTGGGCCAGGG + Intergenic
1181646556 22:24234366-24234388 AGATGGGGAGTGGAGTCCCAGGG - Intronic
1182076730 22:27500032-27500054 AGAGGGCAAGGGGTGGAGCAGGG - Intergenic
1182090637 22:27592175-27592197 AGAGGTGAAGTGGAGGGCCCGGG - Intergenic
1182362603 22:29755801-29755823 GGAGGGGATGTGGGGGTCCATGG - Intronic
1182438357 22:30345900-30345922 AGAAGGGAAGGGATGGCACAAGG + Intronic
1182809576 22:33104440-33104462 GGAGGGGACCTTGTGGCCCAGGG + Intergenic
1182867808 22:33619691-33619713 AGATGGTAAGTCGTGGCTCAAGG - Intronic
1183073100 22:35409993-35410015 AGAGGGGAGTTGGAGGCTCATGG + Intronic
1183619095 22:38962270-38962292 AGAGGGGAAGGCAAGGCCCAGGG - Intronic
1184516537 22:44965907-44965929 AGAGAGGAAGTGGTGGAGCAGGG - Intronic
1184522588 22:45004094-45004116 AGAGGGGAAGTGACAGCCAAGGG + Intronic
1184607623 22:45583128-45583150 AAAAAGGAAGTGCTGGCCCAGGG + Intronic
1184746878 22:46461419-46461441 AGAGGGGATCTGCTGGCCCAGGG + Intronic
1184818174 22:46888166-46888188 GGAGGTGGAGAGGTGGCCCAAGG - Intronic
1185125320 22:49007311-49007333 AGAGGGGATGTGTTGGCCAGAGG - Intergenic
1185238157 22:49726490-49726512 ATAGACGAAGTGGTGGCCCCTGG + Intergenic
1185278020 22:49958049-49958071 TGTGGGAAAGGGGTGGCCCAGGG + Intergenic
949947708 3:9203330-9203352 AGAGGTTAAGTGGTTTCCCAGGG - Intronic
950160107 3:10754096-10754118 TCAGGGGAAGAGGTGGGCCAGGG + Intergenic
950609959 3:14120122-14120144 AGTGGGGAACTGGAGGCCCGAGG + Intronic
950630290 3:14277737-14277759 AGAGGGGAAGTGGATGCTGAGGG + Intergenic
951571921 3:24072954-24072976 AAAGGGGAAGGGGTGTACCAAGG - Intergenic
952881261 3:37987419-37987441 AGAGGGGAAACTGAGGCCCAGGG - Intergenic
953697536 3:45171692-45171714 AGAGGGGCAAATGTGGCCCAGGG - Intergenic
954323061 3:49844989-49845011 AGAGGAGGAGTAGTCGCCCAAGG - Intronic
954920048 3:54182726-54182748 AGAGAGGAAGTGATCGCCCAGGG - Intronic
959540682 3:107534332-107534354 AGAGGGAATGTGGTGGAGCATGG + Intronic
960236204 3:115285506-115285528 AGTGGGGTAGTGGTGTGCCAGGG - Intergenic
960918223 3:122719292-122719314 AAAGGAAAAGTGATGGCCCAAGG + Intronic
961138428 3:124534368-124534390 AGTGGGGACGTGGGGGGCCAGGG + Intronic
961339614 3:126209239-126209261 AGAGGGAAAGTTGTGGTCCAGGG + Intergenic
962320926 3:134389570-134389592 AGAGGGGCTGTGTGGGCCCAGGG - Intergenic
962868279 3:139465987-139466009 AGTGGGGAAGTGGGGGCTCTAGG - Intronic
963853170 3:150227634-150227656 AGAGGGAAAGTGGTGGCAGTGGG + Intergenic
964812214 3:160677824-160677846 ACAGGGGAGGGGCTGGCCCAGGG + Exonic
966939108 3:184734246-184734268 CGGGGGTAAGTGGGGGCCCAGGG - Intergenic
967873124 3:194248755-194248777 AGAGGGAAATTCATGGCCCAAGG - Intergenic
967919825 3:194606196-194606218 AGAGGGGCAGAGGGGTCCCATGG - Intronic
969263805 4:6051124-6051146 AAAGAGAAGGTGGTGGCCCAGGG + Intronic
969718574 4:8880500-8880522 AGAGGCCAAGTGGAGGCTCAGGG - Intergenic
970468550 4:16352337-16352359 GGAGTGGATGTGGTGGCCCCAGG + Intergenic
976100672 4:81559595-81559617 AAAGGAGAAGTGGCAGCCCAGGG - Intronic
981749675 4:148081894-148081916 AAGGGGCAAGTGCTGGCCCAGGG + Intronic
982114006 4:152082065-152082087 AGAGGGGCTGTGGTGGATCAAGG - Intergenic
982277936 4:153656020-153656042 AGAGAGGAAGGGGTGGCAGAGGG - Intergenic
982303539 4:153904770-153904792 AGAGGGGAAATGCTTGTCCAAGG + Intergenic
983484849 4:168321306-168321328 AGAGTTGAAGTGTTGGCTCATGG - Intergenic
984630198 4:182052720-182052742 AGATGGGAAATGGGGGCCAATGG + Intergenic
985135921 4:186786073-186786095 GGAAGGGAAGTGTTGGCTCAAGG + Intergenic
985373740 4:189313221-189313243 AGAGGGGAGCTGGTGTCACAAGG + Intergenic
986148996 5:5109804-5109826 AGAGGAGAAGTGGAGGCAGATGG - Intergenic
986361549 5:6983065-6983087 GGAGGGGAACAGGTGGCCCAGGG - Intergenic
986693738 5:10333960-10333982 AGAGGGGCAGCGGCGACCCAGGG + Intergenic
986737248 5:10676943-10676965 AGTAGGGAAGTGATGGCCAAAGG - Intergenic
986748446 5:10763771-10763793 AGAGGGGCCCTGGTGGCCCCTGG + Intergenic
988878828 5:35477678-35477700 AGAGGTGAAGTGGTGAGCTAAGG - Intergenic
989291285 5:39769347-39769369 AGTGGGGAGGTGGTGGCAGAGGG + Intergenic
990128373 5:52548124-52548146 ATGGGGGAAGGGGTGGGCCATGG - Intergenic
990890012 5:60637645-60637667 TGAGGAGAATTGGGGGCCCATGG - Intronic
992880315 5:81102224-81102246 AGAGGGCAAGAGTTGGCCTAAGG + Intronic
993484622 5:88467715-88467737 AGAGAGAAAATGGTGGCCCTTGG - Intergenic
993899448 5:93574463-93574485 AGGGATGATGTGGTGGCCCAGGG - Intergenic
994047781 5:95328833-95328855 AGCTGGGCAGTGGTGGCGCATGG + Intergenic
996092587 5:119365177-119365199 AGAGAGGAAGTGAAGGCCAAAGG - Intronic
997309928 5:132871321-132871343 AAAGGGGAAGGGCTGGCCTATGG + Intergenic
997363873 5:133312962-133312984 AGAGGGGAAGTGGCTTCCCCAGG + Intronic
997782606 5:136675270-136675292 AGAGGGGAGGCCGTGGGCCAGGG + Intergenic
997939226 5:138141568-138141590 AGAGGAGGAGTGCTGGCCCCAGG + Intronic
998652374 5:144135322-144135344 AGATGGGTAGGGGTGGCCCAGGG + Intergenic
998807735 5:145935342-145935364 AGAGGTGAAGAGGTGGTTCAAGG - Intergenic
999319642 5:150605524-150605546 AGAGGGGAAGGGGAGGCCCTTGG + Intronic
999370352 5:151051502-151051524 AGAGGGGAAACTGAGGCCCAGGG - Intronic
1001415909 5:171544786-171544808 AGGGGGTAAGTGGTGGGCCATGG - Intergenic
1002692025 5:181056674-181056696 GGAGGGGGACTGCTGGCCCATGG + Intronic
1003397461 6:5765396-5765418 AGAGTGGAAGAGGTGGGCCCTGG + Intronic
1003412546 6:5878245-5878267 AGAGGGTATAGGGTGGCCCAGGG - Intergenic
1003960118 6:11201139-11201161 GGAGGTGAAGTGGATGCCCAAGG - Intronic
1004579469 6:16934930-16934952 AAAGGGGAAGTCTTGGGCCAAGG + Intergenic
1004744836 6:18499451-18499473 GGAGGGAAGGTGGTGGCCAAAGG + Intergenic
1005200852 6:23342607-23342629 ATAGGGGACATGGTGGGCCACGG - Intergenic
1006105847 6:31715806-31715828 GGTGGGGAAGTGGGGGCACAAGG - Intronic
1006296549 6:33172489-33172511 AGAGGGGAAGTGGGGGAGCTGGG - Intronic
1006505565 6:34486549-34486571 ACAGGGAAAGTGATGTCCCAAGG + Intronic
1006743553 6:36325755-36325777 AGAGGGGAATTTCAGGCCCATGG - Intronic
1007493149 6:42239999-42240021 AGAGGGTAAGAGGGTGCCCAAGG - Intronic
1007703208 6:43776224-43776246 AGAGGGGAGGGACTGGCCCAAGG + Intronic
1009781622 6:68279231-68279253 AGAGAGGAAGAGGTTGACCAAGG + Intergenic
1010980492 6:82364656-82364678 AGAGGCGAAGAGGTGGCACCAGG + Exonic
1012452515 6:99367918-99367940 AGTTGGGAAGTGTTTGCCCAAGG - Intergenic
1014407790 6:121072013-121072035 ACAAGGGAAGAGGTGACCCAAGG - Intergenic
1014966094 6:127753757-127753779 AGTGGGGAGGTGGTGGTCAAAGG + Intronic
1017405162 6:154111491-154111513 AGAGGTGAAGTGGTGTGCCCAGG - Intronic
1018233749 6:161702551-161702573 AGAGGGGAATTGGTGTCTAATGG + Intronic
1018273341 6:162103945-162103967 AGAGGGCAAGTGGAGTCTCAGGG + Intronic
1018479586 6:164176606-164176628 TGAGGGAATGTGGTGGCCAAGGG - Intergenic
1018584058 6:165335946-165335968 AGGGGAGAAGTCGTGGCCCTGGG + Intronic
1018824285 6:167397647-167397669 AGAGGGGAAGCCATGGCACAGGG + Intergenic
1019331663 7:463471-463493 AAAGGCGACGGGGTGGCCCAAGG + Intergenic
1019508450 7:1405166-1405188 AGAGGGGAGGAGGGGGCCGAGGG + Intergenic
1019597842 7:1866547-1866569 AGTGGGGAAGAGGAGGCTCAGGG + Intronic
1019728562 7:2617089-2617111 AGTGGGGAGGTGCTGGCCAAAGG - Intergenic
1020092703 7:5350272-5350294 AGAGGGGTAGTAGCAGCCCAGGG + Intronic
1021160750 7:17270650-17270672 ACAGAGGAAGTTGTGGCCAAGGG + Intergenic
1021632974 7:22664927-22664949 GAGGGGGAAGTGGGGGCCCAGGG + Intergenic
1022383982 7:29884790-29884812 AGAGGCCAAGTGGTCGCCCAGGG - Intronic
1023057891 7:36304257-36304279 AGAGGGGCAGTGTTTGCCAAGGG + Intergenic
1023294762 7:38702983-38703005 AGAGTGAAGGTGATGGCCCAGGG + Intergenic
1025025877 7:55515672-55515694 AGAGGGGAAGTGGAGTGGCATGG - Intronic
1025249260 7:57341116-57341138 AGAGGTGAAGAGGCTGCCCAGGG + Intergenic
1025944027 7:66092739-66092761 AGAGAGGAAGAGGTGGGCCAGGG - Intronic
1026385641 7:69845028-69845050 AGATGGGAATAGGAGGCCCAGGG + Intronic
1026726046 7:72870622-72870644 GGAGGGGAAGGAGTGGCACATGG - Intergenic
1026747890 7:73027005-73027027 GGAGGGGAAGGAGTGGCACATGG - Intergenic
1026751540 7:73055144-73055166 GGAGGGGAAGGAGTGGCACATGG - Intergenic
1026755189 7:73083258-73083280 GGAGGGGAAGGAGTGGCACATGG - Intergenic
1026758837 7:73111292-73111314 GGAGGGGAAGGAGTGGCACATGG - Intergenic
1027034096 7:74912299-74912321 GGAGGGGAAGGAGTGGCACATGG - Intergenic
1027088567 7:75282194-75282216 GGAGGGGAAGGAGTGGCACATGG + Intergenic
1027092210 7:75310122-75310144 GGAGGGGAAGGAGTGGCACATGG + Intergenic
1027095853 7:75338089-75338111 GGAGGGGAAGGAGTGGCACATGG + Intergenic
1027323488 7:77029603-77029625 GGAGGGGAAGGAGTGGCACATGG - Intergenic
1028494104 7:91444993-91445015 TGGGGGGTAGTGGTGGCACATGG + Intergenic
1029139570 7:98400636-98400658 AGAGGGGCTGTGGAGGGCCAGGG + Intronic
1029147734 7:98458682-98458704 AGAGGGAAGGCGGTGGCCCAAGG - Intergenic
1029251006 7:99236340-99236362 GGAGGGGAACTGGAGGCTCAAGG - Intergenic
1029395953 7:100308800-100308822 GGAGGGGAAGGAGTGGCACATGG + Intronic
1029396176 7:100310186-100310208 GGAGGGGAAGGAGTGGCACATGG + Intronic
1029396402 7:100311576-100311598 GGAGGGGAAGGAGTGGCACATGG + Intronic
1029396626 7:100312966-100312988 GGAGGGGAAGGAGTGGCACATGG + Intronic
1029396851 7:100314358-100314380 GGAGGGGAAGGAGTGGCACATGG + Intronic
1029514946 7:101018399-101018421 CCAGGGGAAGGGGTGGCCCCAGG - Intronic
1030359092 7:108576549-108576571 AGAGGGGCAATGGTGGAACAAGG + Intergenic
1031273252 7:119682193-119682215 ATAGTGGAAGTGGTGGACAAGGG - Intergenic
1031378526 7:121057422-121057444 AGAGGAGAAGTGGGGGGCAAGGG - Intronic
1031862742 7:127000248-127000270 AGTGGGGATGTGGTGGGGCAGGG + Intronic
1032451715 7:132037157-132037179 AGTGGGGAAATGGTGGACCCTGG + Intergenic
1032534768 7:132653558-132653580 AAAGGGGAAGTGGTGACTGATGG + Intronic
1034528963 7:151683700-151683722 TGAGGGGGAACGGTGGCCCAGGG + Intronic
1034553811 7:151837399-151837421 AAAGAGGCAGTGCTGGCCCACGG + Intronic
1034681717 7:152934013-152934035 GGATGGGAGGTGGTGGCCCAAGG - Intergenic
1035083697 7:156238321-156238343 GAAGGGGAAGAGATGGCCCAGGG - Intergenic
1035306828 7:157938510-157938532 AGATGGGAAGGAGAGGCCCAGGG + Intronic
1035461406 7:159041352-159041374 ACATGGAAAGTGGTGGCCCTCGG - Intronic
1036351521 8:8015161-8015183 CGGGGGGAGGTGGTGTCCCACGG - Intergenic
1036474580 8:9081546-9081568 AGAGGGGAAGAGGGATCCCAGGG - Intronic
1037298113 8:17422694-17422716 AGAGGGAGAGTGGTGGCTCTGGG - Intergenic
1038462591 8:27729444-27729466 AGTGGGCAAATGGAGGCCCAGGG + Intergenic
1038746695 8:30261123-30261145 AGAGGGGAAGTGGTAGTGGAAGG - Intergenic
1039440477 8:37591779-37591801 TGAGAGGAAGTGGGGGCCTAAGG - Intergenic
1039833423 8:41236173-41236195 AGAGGGGAAGCGGTTGCACAAGG - Intergenic
1041871034 8:62634627-62634649 AGATGGGAAGAGGTGGGCCCTGG + Intronic
1044233707 8:89807007-89807029 AGAGAGCTAGTGGGGGCCCATGG - Intergenic
1047958483 8:129993880-129993902 AGAGGTGCTGTGGTGGCACAAGG - Intronic
1048058908 8:130897014-130897036 AGGGGAGAAGTGGTTGCCCAAGG + Intronic
1049009051 8:139875241-139875263 AGATGGGATGAGGTGGCCCTGGG + Intronic
1049019992 8:139949753-139949775 AAAGGGGGAGTGGTGGCCAATGG + Intronic
1049269121 8:141684810-141684832 AGATCGGAAGTGGTGGCACTGGG - Intergenic
1049361831 8:142215662-142215684 AGAGGGGAAGGGCAGGCCAAGGG + Intronic
1049537823 8:143190124-143190146 GGTGAGGAGGTGGTGGCCCAGGG - Intergenic
1050272355 9:3959666-3959688 AGAGGTGAAGTGTTGGGGCAGGG - Intronic
1052420060 9:28232741-28232763 AGTAGGGAAATGGTGGTCCAAGG - Intronic
1053393219 9:37751116-37751138 AGGGGGGAATTGTTGGGCCAAGG + Intronic
1054835456 9:69671806-69671828 AGAGGGGATGGGGTGGCGGACGG - Intronic
1057546708 9:96024408-96024430 AGATGGGACGTGGTGGCCCACGG + Intergenic
1057589636 9:96361187-96361209 AGAGTGGAACTGCTGGCCCCTGG - Intronic
1058242055 9:102576454-102576476 ATAGAGGAAGTTCTGGCCCAGGG + Intergenic
1058959232 9:109977447-109977469 AGAGCAGAAGTGGTGGGACATGG - Intronic
1059414589 9:114155309-114155331 AGAGAGGAAGGGGCTGCCCAGGG - Intergenic
1059959548 9:119551752-119551774 AGATGAGAAATGGGGGCCCAGGG - Intergenic
1060104709 9:120866365-120866387 AGAGGGGAAGAGGGTGACCATGG - Intronic
1060985370 9:127816395-127816417 AGAGGGGCAGGGTTGACCCAAGG - Intronic
1060986463 9:127822111-127822133 TCAAGGGAAGTGGTGGCCAAAGG + Intronic
1061178384 9:129010516-129010538 AGAGGGGAAACTGAGGCCCAGGG + Intronic
1061451369 9:130668657-130668679 AGATGGGGAGAGGCGGCCCAGGG + Intronic
1061471565 9:130830830-130830852 AGAGGTGAAGTCGTTGCCCATGG + Intronic
1061780881 9:132995410-132995432 AGAGGAGAGGTGCTAGCCCAAGG + Intergenic
1061899459 9:133665648-133665670 TGTGGGGAAGTGGCAGCCCATGG - Intronic
1061993965 9:134174812-134174834 AGAAGGGAAAGGGTGGCCCTGGG - Intergenic
1062115401 9:134805732-134805754 AGAGGGGAGTGGGTGCCCCATGG + Intronic
1062128748 9:134881170-134881192 AGAGGGGGACATGTGGCCCAGGG - Intronic
1062444775 9:136588995-136589017 ACAGGGGAAGTGGAGGCCACTGG + Intergenic
1062564048 9:137156105-137156127 CGAGGGGAAGCGGAGGCACATGG - Intronic
1062646235 9:137549941-137549963 AGACAGCCAGTGGTGGCCCATGG - Intronic
1186830933 X:13389713-13389735 GGCAGGGTAGTGGTGGCCCAGGG - Intergenic
1187364480 X:18655265-18655287 AGAGGGCCAGATGTGGCCCATGG - Intronic
1188407121 X:29825415-29825437 AGAGAGGAACTGGTTGCCAAAGG - Intronic
1188918731 X:35945405-35945427 GGAAGGGAAGTGATGGTCCAAGG - Intronic
1191824719 X:65352497-65352519 ATAAGGGAAGTGATAGCCCACGG + Intergenic
1192056697 X:67780785-67780807 AGAGGGGAGGAGCTTGCCCAAGG - Intergenic
1192168065 X:68838414-68838436 AGTGTGGAAGGGGTGGCCCATGG - Intronic
1192250472 X:69409050-69409072 TGAGGGAAAGAGGAGGCCCAGGG + Intergenic
1192261710 X:69509483-69509505 TGAGGGGAAATAGAGGCCCAAGG + Intronic
1193091830 X:77502147-77502169 AGAGGGGAAAAGGTGCCCTAGGG - Intergenic
1195689729 X:107614470-107614492 AGAGGGGAAGTGAATGCCCAAGG - Intergenic
1196180949 X:112688831-112688853 AGGGTGAAAGTGGTGGCCCAAGG - Intergenic
1196972155 X:121121552-121121574 AGAGGGGAAGAGGAGGCCTAGGG - Intergenic
1197757000 X:130002533-130002555 AGAGGGGAGGGGGAGGCACAGGG + Intronic
1198133545 X:133724130-133724152 AGAGGTTAAGTGATTGCCCAAGG + Intronic
1198541467 X:137644419-137644441 AGAAGGGGAGTGGTGGCCAGAGG - Intergenic
1198807753 X:140506698-140506720 AGGGGGGGAGTGGAGGCTCAGGG + Intergenic
1199596921 X:149513346-149513368 AGAGGGTCATTGCTGGCCCAAGG + Intronic
1199677731 X:150201696-150201718 AGAGTGGAAGTGGAGGGCCAGGG + Intergenic
1201438420 Y:13984902-13984924 AGAGAGGAAGAGGTGGCCTGTGG - Intergenic
1201446153 Y:14057806-14057828 AGAGAGGAAGAGGTGGCCTGTGG + Intergenic