ID: 903189005

View in Genome Browser
Species Human (GRCh38)
Location 1:21646018-21646040
Sequence GAGAGGGGAAGTGGTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 525}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189005_903189013 9 Left 903189005 1:21646018-21646040 CCTGGGCCACCACTTCCCCTCTC 0: 1
1: 0
2: 5
3: 52
4: 525
Right 903189013 1:21646050-21646072 GTTCCCTCATCTGTAAAATGGGG 0: 23
1: 594
2: 2828
3: 6721
4: 11858
903189005_903189012 8 Left 903189005 1:21646018-21646040 CCTGGGCCACCACTTCCCCTCTC 0: 1
1: 0
2: 5
3: 52
4: 525
Right 903189012 1:21646049-21646071 AGTTCCCTCATCTGTAAAATGGG 0: 30
1: 766
2: 3523
3: 8849
4: 15187
903189005_903189011 7 Left 903189005 1:21646018-21646040 CCTGGGCCACCACTTCCCCTCTC 0: 1
1: 0
2: 5
3: 52
4: 525
Right 903189011 1:21646048-21646070 CAGTTCCCTCATCTGTAAAATGG 0: 37
1: 931
2: 4071
3: 9755
4: 16832
903189005_903189018 26 Left 903189005 1:21646018-21646040 CCTGGGCCACCACTTCCCCTCTC 0: 1
1: 0
2: 5
3: 52
4: 525
Right 903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 290
903189005_903189016 13 Left 903189005 1:21646018-21646040 CCTGGGCCACCACTTCCCCTCTC 0: 1
1: 0
2: 5
3: 52
4: 525
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189005_903189017 25 Left 903189005 1:21646018-21646040 CCTGGGCCACCACTTCCCCTCTC 0: 1
1: 0
2: 5
3: 52
4: 525
Right 903189017 1:21646066-21646088 AATGGGGATGGACAGTAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189005 Original CRISPR GAGAGGGGAAGTGGTGGCCC AGG (reversed) Intronic
900086882 1:902896-902918 GTGAGGGGACGAGGGGGCCCGGG + Intergenic
900143974 1:1150120-1150142 AAGGTGGGAGGTGGTGGCCCAGG + Intergenic
901210054 1:7519575-7519597 GAGAGTGGCAGAGGTGGCTCAGG - Intronic
901454490 1:9355302-9355324 CAGAGGGGAAGTGGAGCCCCAGG - Intronic
902600788 1:17539415-17539437 GAGGCGGGAAGTGGGGACCCCGG + Intergenic
902765258 1:18610200-18610222 GAGAAAGGAAGTGATTGCCCAGG + Intergenic
903189005 1:21646018-21646040 GAGAGGGGAAGTGGTGGCCCAGG - Intronic
903365846 1:22805077-22805099 GAGGGGGCAAGGTGTGGCCCTGG - Intronic
903560125 1:24220825-24220847 GATAGGGGCAGTGGGTGCCCAGG + Intergenic
903604676 1:24567038-24567060 GAGAGGGGCTGTGATGGTCCAGG + Intronic
904043023 1:27594927-27594949 GAGAGGTGTAGGGGTGTCCCTGG + Intronic
904905716 1:33895885-33895907 GAGAGGGGAGTTGGTTGCTCAGG - Intronic
905241087 1:36582078-36582100 GGGAGGGGAAGGGCTGCCCCAGG - Intergenic
905370996 1:37482659-37482681 GAGCAGGGAAGGGGTGGCACAGG - Intronic
905654367 1:39676625-39676647 GACAGGGGAATGGGTGACCCAGG + Intergenic
905798000 1:40826265-40826287 AAGAGGAGAGGTGCTGGCCCTGG - Intronic
906121823 1:43398264-43398286 GAGAGGGGAAGAGGTGGTGGTGG + Intronic
906326158 1:44847413-44847435 GAGGAGGGAAGTGGGGGTCCTGG + Intergenic
910652325 1:89582897-89582919 GGGAGCGGAAGCGGTGTCCCAGG - Exonic
911536287 1:99105061-99105083 GAGAAGGGGAGAGGTGGCACTGG - Intergenic
912449117 1:109758743-109758765 GAGAGAGGTGGTGGTGCCCCTGG - Intronic
914813860 1:151048692-151048714 GAAGGGGGTAGTGGTGGTCCTGG - Exonic
914829944 1:151163821-151163843 GAAAGGGGCTGTGGTGGGCCAGG - Intronic
914858571 1:151369362-151369384 GAGCTGGGAAGGGGGGGCCCAGG + Intronic
915733618 1:158071025-158071047 GGGAGGGGAGCTGGGGGCCCTGG - Intronic
915736764 1:158090167-158090189 AAGAGGGGAAGTGTTAGCCCAGG - Intronic
916171394 1:162003884-162003906 GAAAGGGGAAGTGGTGCCGGAGG - Intronic
917002846 1:170379219-170379241 GAGAAGGGTAGTGGGGGCCTGGG - Intergenic
917386618 1:174483277-174483299 GAGAGGGGAAGTTGTGGCAGGGG - Intronic
918309933 1:183278655-183278677 AAGGGAGTAAGTGGTGGCCCGGG + Intronic
919776563 1:201198090-201198112 GAAGGTGGAAGAGGTGGCCCAGG + Intronic
919813104 1:201421303-201421325 CCCAGGGGAAGGGGTGGCCCTGG - Intronic
919930974 1:202221441-202221463 GAGAGGGGCAGTTGTGGGCATGG - Intronic
920111146 1:203588213-203588235 GAGTGGGGAATTGATGGCCCAGG - Intergenic
921357904 1:214303830-214303852 GAGGGGGGACGAGGTGGCACAGG + Intronic
922236358 1:223725658-223725680 GACAGAGGAGGTGGTGTCCCAGG + Intronic
922754533 1:228088232-228088254 GAGATGTGAAGGAGTGGCCCGGG + Intronic
922762213 1:228140280-228140302 GTGGGCGGAAGAGGTGGCCCCGG + Exonic
922934220 1:229411326-229411348 GGGAGGGGAAGAGGAGGCCGAGG - Intergenic
924144499 1:241060052-241060074 GAGAGAGGAACTGGTGCCCTAGG - Intronic
1063161867 10:3424284-3424306 GAGCGGGGAAGGGATGGCGCAGG - Intergenic
1064016838 10:11779433-11779455 GAGAGGGGCAAGGGTGGCCCTGG + Intergenic
1065483883 10:26218012-26218034 GAGAGGGGCAGGGGCGCCCCGGG - Intronic
1066216640 10:33294767-33294789 GAGAGGTGAAGTTCTGTCCCAGG - Intronic
1067089274 10:43258398-43258420 GGCAGGGGAAGTGGTGACCGAGG - Intronic
1067177482 10:43960213-43960235 GAGATGGGAAGTGGGGACCCTGG - Intergenic
1067847370 10:49735117-49735139 GAGAGGGGCTGTGGGGCCCCAGG - Exonic
1068735557 10:60409997-60410019 GAGAGGGGAAGTGGAGGGACTGG - Intronic
1069336034 10:67351811-67351833 AAGAGGAAAAGTGGTGGCCTGGG + Intronic
1070690697 10:78522721-78522743 GAGAGAGGAAGTGGGAGTCCTGG + Intergenic
1071289486 10:84177856-84177878 GAGAGGGGAAGTGGAGGGGGAGG - Intronic
1072570587 10:96654620-96654642 GAGAGGGGAAGGGGCAGGCCGGG - Intronic
1073131501 10:101191954-101191976 GGGAGGGGAAGTGGGGGCGGGGG - Intergenic
1073245314 10:102086303-102086325 GGGAGGGGAAGTGGCAGCCGTGG - Intergenic
1074106741 10:110394456-110394478 GAGAGAGGAGGCTGTGGCCCGGG - Intergenic
1074234949 10:111575881-111575903 GAGAAGGAAAGTGGTGGCAGAGG + Intergenic
1075512155 10:123081300-123081322 GAGAGGGAAAGAAGAGGCCCTGG - Intergenic
1075552681 10:123403651-123403673 GAGCTGGGAAGTGGTGGCATGGG + Intergenic
1076907184 10:133368601-133368623 GAGAGGGAACATGGTGACCCTGG - Intronic
1077351282 11:2094362-2094384 GAGGGTGGCAGTGGTGCCCCAGG + Intergenic
1077374494 11:2199196-2199218 GTGAGGGGACGTGGTGGTGCGGG + Intergenic
1078866343 11:15301608-15301630 GAAAGAGGAGGAGGTGGCCCAGG + Intergenic
1079103614 11:17557002-17557024 GGGAGGGGAAGTGGGGGCCTTGG + Intronic
1079233459 11:18669952-18669974 GAGAGGGGAAGCGCTGGCTTAGG + Intergenic
1079297042 11:19242572-19242594 GAGTGGGGAAGTGTGGCCCCGGG - Intergenic
1080244052 11:30159512-30159534 GAGAGGGTCTGTGGTGGCCAGGG + Intergenic
1080859706 11:36142639-36142661 GGGAGGGGCAGTGGTGCACCCGG + Intronic
1081750194 11:45505127-45505149 GAGAGGGTAAGTGATGGATCTGG + Intergenic
1082219044 11:49610355-49610377 GGGAAGGGAAGTGGGGGCACTGG - Intergenic
1082998059 11:59268341-59268363 GAGAGGGGAACCTGTGGCCAAGG + Intergenic
1083681810 11:64354884-64354906 GAGAAGGGAAGTGGGGGCTGAGG - Intronic
1083681849 11:64355015-64355037 GAGAAGGGAAGTGGGGGCTGAGG - Intronic
1083891242 11:65596721-65596743 GAGAGGGGAAGGGGGAGCCTGGG + Intronic
1083997566 11:66279651-66279673 GAGAGAGGAAGTGGAGAGCCCGG - Intronic
1084426882 11:69088945-69088967 GTGATGGGGAGTGGTGTCCCCGG - Intronic
1084490660 11:69476551-69476573 GAAGGGGGAGGTGGTGGCCATGG - Intergenic
1084608031 11:70183944-70183966 GAGAGGTCAAGTGATTGCCCAGG + Intronic
1085460506 11:76690277-76690299 GGGATGGGAAGAGGTGGCCTTGG + Intergenic
1085463572 11:76709622-76709644 CAGAGGGGAAGCTGTGGACCTGG - Intergenic
1086511270 11:87560523-87560545 GAAAGAGGAAGTGGTGGTACTGG + Intergenic
1086630607 11:89014519-89014541 GGGAAGGGAAGTGGGGGCTCTGG + Intronic
1088789030 11:113208002-113208024 GGTAGGGGCAGTGGGGGCCCAGG + Exonic
1089534851 11:119154646-119154668 GAGTGGGAGAGTGGTGGCCTAGG + Intronic
1090249284 11:125240158-125240180 GAGTGGGGAGGGGGTGGACCGGG + Intronic
1091165416 11:133471522-133471544 GAGAGGGGAACTGGTTGGCTGGG + Intronic
1091403717 12:196319-196341 GCCAGGGGAAGTGGAGGCCAGGG - Intronic
1091674952 12:2482408-2482430 CAGCTGGGAAGTGGTGGCACAGG - Intronic
1091912681 12:4244595-4244617 GAGAGGAGTAGTGTTGGCCTTGG - Intergenic
1092008133 12:5086849-5086871 GAGAGGTGATGGGCTGGCCCTGG + Intergenic
1092255611 12:6925434-6925456 GAGAGGGAAAGGGGGAGCCCTGG + Intronic
1092290862 12:7158717-7158739 GGGAGGGGACGTGGGGGCCCCGG + Exonic
1093158307 12:15714965-15714987 GAGATGGGAAGGAATGGCCCAGG - Intronic
1093958616 12:25250343-25250365 GAGAGGGGGAGGGGAGGCCGGGG + Intronic
1094833392 12:34311061-34311083 GAAAGGGGAAGTAGAGGCGCTGG + Intergenic
1094842436 12:34347763-34347785 GAAAGGGGAGGTCGAGGCCCTGG - Intergenic
1094843360 12:34351106-34351128 GAGAGGGGAGGTTGAGGCACCGG - Intergenic
1095099136 12:38163077-38163099 GCCAGGGGAAGTGGCGGCCAGGG - Intergenic
1095865236 12:46964577-46964599 AAGTGGGGAAGTGGTGGCACGGG - Intergenic
1096109902 12:49022395-49022417 GAGAGTGGCAGTGGTGGCTGTGG + Intronic
1096630201 12:52921568-52921590 GAGAGAGGAAGGAGGGGCCCTGG - Intronic
1096659329 12:53114139-53114161 GAGAGGGGATGTGGCAGGCCAGG - Intronic
1097138136 12:56876583-56876605 AAGAGGGGCAATGGTGGGCCAGG - Intergenic
1098285392 12:68901890-68901912 GAGAGGGGAGGGGATGGCACAGG + Intronic
1099055439 12:77834094-77834116 GAATGGGGAGGTGGTGGGCCAGG + Intronic
1099315651 12:81079000-81079022 GGGAGGGGAAGTGGTGAGTCAGG + Intronic
1101717087 12:107320519-107320541 GAGTGGGGAAGTGGGAGCACTGG - Intronic
1102136764 12:110582475-110582497 GGGAGGGGACGAGGTCGCCCAGG + Intronic
1102394680 12:112575598-112575620 GAGAGGGGAACAGGTGGTCGCGG + Intronic
1103145479 12:118591442-118591464 GAGAGGTGAAGGGGCTGCCCAGG + Intergenic
1103592987 12:122005468-122005490 GAGCGGGGAGGTGGAGGTCCTGG + Intergenic
1107288693 13:38826348-38826370 GAGAGGGGGAGTGGCACCCCTGG + Intronic
1107392205 13:39977578-39977600 GAGAGCGTGAGTGGAGGCCCTGG - Intergenic
1108256074 13:48612159-48612181 GATAGGGGAAGGGGTGGCACTGG + Intergenic
1111176726 13:84605771-84605793 GAGAGTGGCAGTGGTGGGCTGGG + Intergenic
1111456791 13:88494973-88494995 GAGTGGGGAAGTGCAAGCCCTGG - Intergenic
1112299961 13:98221028-98221050 TAAAGGGGAAGTGCAGGCCCTGG + Intronic
1113743376 13:112725949-112725971 GGGGCGGGAAGCGGTGGCCCTGG + Intronic
1113803070 13:113096436-113096458 GAGCGGGGACGTGGTGGAGCTGG + Exonic
1113820015 13:113206879-113206901 GAGAAGGGAAGGGGTGACCCAGG - Intronic
1113871240 13:113561081-113561103 AAGGGAGGAAATGGTGGCCCTGG + Intergenic
1114055613 14:18965131-18965153 GGGATGGGAGCTGGTGGCCCTGG - Intergenic
1114106933 14:19436632-19436654 GGGATGGGAGCTGGTGGCCCTGG + Intergenic
1115043146 14:28955805-28955827 GCTAGGGGAAGTGGTGGCTGTGG + Intergenic
1117097827 14:52315295-52315317 GAGAGGGGAAAGGGTGTCCATGG + Exonic
1118843364 14:69528464-69528486 GGGAGGGGAAGGGGTGGCAGAGG + Exonic
1120949035 14:90024028-90024050 GGGAGGTGAAGTGGGGGCCATGG - Intronic
1121006606 14:90494696-90494718 GAGATGGGAAGTGATGGCACAGG + Intergenic
1121509983 14:94505390-94505412 GCGAGGGAAGGTGGTGGCTCAGG - Intronic
1121662833 14:95648550-95648572 GAGTGGGGAGGAGGTGGCTCTGG + Intergenic
1121735850 14:96217642-96217664 GAGAGGTGAAGTGGGGGGCTGGG + Intronic
1122624111 14:103075485-103075507 GGAAGGGGAAGTCGAGGCCCGGG - Intergenic
1122828419 14:104383520-104383542 CAAAGGGGAGCTGGTGGCCCAGG + Intergenic
1123144102 14:106111286-106111308 GAGAGAGGAAGTGGTGGACAAGG + Intergenic
1123192145 14:106581703-106581725 GAGAGAGGAAGTGGTGGACAAGG + Intergenic
1125505126 15:40263470-40263492 GAGTGGGGAACTGGGGGCCTGGG - Intronic
1126346289 15:47697769-47697791 GCGGGGGGAAGTGGGGGCGCAGG - Intronic
1126666778 15:51082454-51082476 GAGAGTGAATGTGGAGGCCCAGG + Intronic
1127187606 15:56495359-56495381 GGGAGGGAAAATGGTGGCCATGG - Intergenic
1127429439 15:58887867-58887889 GAGGCGGGGAGTGGTGGCTCAGG + Intronic
1127783961 15:62339929-62339951 GACAGGTGAAGTGTTGGCCATGG - Intergenic
1128064996 15:64759089-64759111 GAGAGGTCAAGAGGTGGCTCAGG - Intronic
1128080166 15:64852404-64852426 GAAAGGGGAAGAGATGGCCAAGG - Intronic
1128143194 15:65316588-65316610 GAGAAGGGAGGTGGTGGAGCTGG - Intergenic
1128224037 15:65989357-65989379 GAGAAGGGAGGTGGGGGCCTTGG - Intronic
1128329129 15:66744471-66744493 TGGAGTGGAAGTGGTGGCCATGG - Intronic
1128359789 15:66953976-66953998 GAGAGGGCACGTGATGGCACAGG + Intergenic
1128499110 15:68214757-68214779 GAGAAGGGAAGTATTAGCCCAGG - Intronic
1128589956 15:68887178-68887200 AAGGGGAGAAGAGGTGGCCCTGG + Intronic
1128704142 15:69826269-69826291 GAGAGGGAAAGGGATTGCCCAGG - Intergenic
1129255474 15:74331626-74331648 GAGCTGGGAAGTGTTGCCCCAGG - Intronic
1129539996 15:76341372-76341394 GAGAGGGGAGGGGGTGGCCTTGG + Intronic
1129624118 15:77179061-77179083 GAAAGGGAAACTGGTGGGCCTGG - Exonic
1130894552 15:88160056-88160078 GAGAGGGGCAGTGAGGGTCCCGG + Intronic
1131476222 15:92742465-92742487 CAGTTGGGAAGTGGTGGACCTGG + Intronic
1131872426 15:96776227-96776249 GAGAAGGGAAGTGATGGATCAGG - Intergenic
1132256670 15:100382422-100382444 GAGAGATGAAGTGGTTGACCCGG + Intergenic
1132503659 16:296376-296398 CAGCTGGGAAGTGTTGGCCCTGG - Intronic
1132547586 16:540376-540398 GAGGTGGGGAGGGGTGGCCCCGG + Intronic
1132622762 16:875568-875590 GAGAGGGGCAGTGGTGGAACTGG + Intronic
1132647576 16:1006309-1006331 GGGAGGGGAGGTGGTGGCACTGG + Intergenic
1132845258 16:1998261-1998283 GGGAGGGGAAGTCGTCGTCCCGG + Exonic
1133022913 16:2974680-2974702 GAAAGGGGCAGGGTTGGCCCTGG + Intronic
1133747288 16:8696819-8696841 CACAGGGGAAGTGGATGCCCTGG - Intronic
1133929762 16:10222743-10222765 AGGAGGGGAAGTAGGGGCCCTGG - Intergenic
1134023307 16:10936787-10936809 GAATGGGGAAGTGGAGGCCGAGG - Intronic
1134441721 16:14302664-14302686 GAGAGGGGAGGTGGCGGCGGGGG + Intergenic
1135775759 16:25256770-25256792 TGGAGAGGAAGCGGTGGCCCTGG - Exonic
1136177331 16:28526437-28526459 AAGAGGGGAGGGGTTGGCCCAGG - Intergenic
1136366377 16:29811045-29811067 GACAGAAGAAGTTGTGGCCCTGG + Exonic
1137274510 16:46924623-46924645 GGGAGCAGAAGTGCTGGCCCTGG + Intronic
1137494480 16:48959164-48959186 GAGAGGGTAATTAGAGGCCCAGG + Intergenic
1137676037 16:50304314-50304336 GAGAGGGGAGGAGGTGGCACAGG + Intronic
1138084104 16:54118181-54118203 GAGATGGGAAGTGCTGGCCTAGG + Exonic
1138329779 16:56204386-56204408 GAGAGTGGATGTGGTGTCCCTGG + Intronic
1138387630 16:56647223-56647245 GAGGGTGGAAGTGGTGCCGCGGG - Intronic
1138428361 16:56951418-56951440 GGGAGGGTGAGCGGTGGCCCTGG + Intergenic
1139638165 16:68271626-68271648 GAGAAGGTAAGGGATGGCCCTGG + Intronic
1140623347 16:76763175-76763197 GAGCAAGGAAGTGGTGCCCCAGG - Intergenic
1141703433 16:85652608-85652630 GAGAGGGGAGGCGCCGGCCCGGG + Intronic
1142148890 16:88504081-88504103 GAGAGGGTGAGTGAGGGCCCAGG - Intronic
1142211577 16:88811117-88811139 GAGAGCCCAAGAGGTGGCCCAGG - Intronic
1142224104 16:88869302-88869324 GAGAGGGGAAGGGGCGTCCAGGG - Intergenic
1142805748 17:2370252-2370274 GAGAGAGGAAGTGGAAGCACTGG - Intronic
1143090582 17:4447132-4447154 GGGTGTGGAAGTGGTGGCCGTGG + Intronic
1143217286 17:5234507-5234529 GAGAGGTGAAGTGATGCCTCAGG + Intronic
1143953745 17:10653406-10653428 GAAGGGGGAAGAGGTGGGCCGGG - Intronic
1144642218 17:16943845-16943867 CTGAGGGGAACAGGTGGCCCAGG - Intronic
1144873327 17:18383403-18383425 GAGAAGGGACGTGGTGGGCGGGG + Intronic
1145204669 17:20976785-20976807 AAGAGGGGAAGTTGTGCCCAGGG + Intergenic
1145770063 17:27486532-27486554 AGGATGGGAAGTGGGGGCCCTGG + Intronic
1145898705 17:28475844-28475866 GCTAGGGGAAGTGGGGACCCTGG - Intronic
1146503142 17:33381503-33381525 GATAGGGAAAATGCTGGCCCTGG + Intronic
1146547328 17:33750260-33750282 GAAAGAGGAAGGGGTTGCCCAGG - Intronic
1146790661 17:35748810-35748832 GAGAGGGAGGGTGGTGGCTCTGG + Intronic
1146885116 17:36465182-36465204 GAGAGTGGGAGTGCTGGGCCTGG + Intergenic
1146923499 17:36729051-36729073 GAGAGGGGAAGGGGTGTGTCTGG + Intergenic
1147716203 17:42510426-42510448 GAGAGTGGAAGAGGAGACCCTGG + Intronic
1147908799 17:43842226-43842248 GAGTGGGGAAGACGTGTCCCCGG - Intergenic
1147944680 17:44074226-44074248 AAGAGGGGAACTGGTGAACCTGG - Exonic
1147995875 17:44360082-44360104 GAGCGGGGAGCTGGTGCCCCTGG - Exonic
1148122329 17:45220697-45220719 GAGATGGGCAGTGGAGGGCCAGG + Intergenic
1148195287 17:45708666-45708688 GAGAGGGGGAGTGGTGGCAGAGG + Intergenic
1148630697 17:49106140-49106162 GAGAGTAGAAGTTGAGGCCCAGG + Intergenic
1148872951 17:50669158-50669180 GAAAGGGGCACTGGTGGCCGTGG + Exonic
1150004875 17:61463335-61463357 TAGAGGGGAATTGGTGGGCAGGG + Intronic
1150284841 17:63948883-63948905 GAGGGAGGAGGTGGGGGCCCTGG - Intronic
1151109950 17:71664339-71664361 GAGAGAGAAAGTGGTGGGCCAGG - Intergenic
1151747914 17:76021628-76021650 GAGAAGGGACGTGGTGGGCGGGG - Intronic
1151826451 17:76526938-76526960 GAGAGGGGATGGGGTGCCCTTGG + Intergenic
1151826483 17:76527023-76527045 GAGAGGGGATGGGGTGCCCTTGG + Intergenic
1151826516 17:76527109-76527131 GAGAGGGGATGGGGTGCCCTTGG + Intergenic
1152026361 17:77811980-77812002 GAGGAAGGAGGTGGTGGCCCTGG - Intergenic
1152072593 17:78141180-78141202 GAGAGGGGCGGTGGTCGCCAGGG - Exonic
1152132315 17:78484828-78484850 CGGAGGGGAAGGCGTGGCCCCGG - Intronic
1152247202 17:79191255-79191277 TAGAGAGGGAATGGTGGCCCGGG + Intronic
1152325608 17:79634135-79634157 GAGAGGTGTGGAGGTGGCCCTGG - Intergenic
1152892799 17:82892019-82892041 CAGGGGGGAAGTGGGGGGCCTGG - Intronic
1153744394 18:8162473-8162495 GAAAGAGGAATGGGTGGCCCTGG + Intronic
1154017986 18:10637417-10637439 GGGAGGGGCAGGGGTGGTCCCGG + Intergenic
1154186884 18:12192165-12192187 GGGAGGGGCAGGGGTGGTCCCGG - Intergenic
1155826352 18:30448254-30448276 GAGAAGGTAAGTGGTTGCACTGG + Intergenic
1157103076 18:44747454-44747476 GAAAGGAGAGGTGCTGGCCCAGG + Intronic
1157742890 18:50109093-50109115 GATAGGGGAAGTGGTGGGACGGG - Intronic
1158350554 18:56561172-56561194 GAAAGAGGAAGTGCTGCCCCAGG + Intergenic
1160569555 18:79807607-79807629 GAGGGAGGAAGGGCTGGCCCAGG - Intergenic
1160845421 19:1164070-1164092 GAGAGGGGCCGTGATGGCCGCGG - Intronic
1160893230 19:1390431-1390453 GAGAGGGGAGGGAGTGGCCAAGG + Intronic
1160975325 19:1790046-1790068 GGGAGGGGCAGTGGAGCCCCCGG - Intronic
1161248348 19:3267478-3267500 GGGATGGGAAGTGGTGTCCGGGG - Intronic
1161462017 19:4403094-4403116 GAGAGGGGAAACTGAGGCCCAGG + Intronic
1161659429 19:5536833-5536855 GAGAGGGGCAGAGATGTCCCGGG - Intergenic
1161750548 19:6092977-6092999 GGGAGGCGAGGAGGTGGCCCCGG + Intronic
1161954994 19:7488857-7488879 GAGAGGGGACGGGGTCGCCCAGG - Intronic
1162003529 19:7763344-7763366 GTAAGGGGAAGGGATGGCCCAGG + Intronic
1162301339 19:9846873-9846895 GAGAGAAGAACTGGTGTCCCTGG + Intronic
1162312707 19:9916539-9916561 CAGCAGGGAAGTGGGGGCCCAGG + Intronic
1163282110 19:16324595-16324617 GAGAGGGGGAGGCGCGGCCCTGG + Intergenic
1163521642 19:17795261-17795283 GGGTGGGGAAGTTGTGGCTCTGG + Intronic
1163701413 19:18788521-18788543 GAGAGTGTAAGTGGGTGCCCTGG + Intronic
1163747468 19:19056890-19056912 GAGTGGGGAACTGCTGGCCAGGG - Intronic
1164510783 19:28895421-28895443 GTGAGGGGAGAAGGTGGCCCAGG + Intergenic
1164564221 19:29314579-29314601 TAGAGGGAATCTGGTGGCCCTGG - Intergenic
1164756257 19:30691953-30691975 TGGAGGGGAGGTGGAGGCCCGGG - Intronic
1165076624 19:33283040-33283062 CAGCGGGGCAGTGGTGGCTCAGG + Intergenic
1165219135 19:34300613-34300635 CAGGGGGGCAGTGGTGGCCGTGG - Exonic
1165631421 19:37305027-37305049 GAGACGGACAGTGGTGTCCCGGG + Intergenic
1165849196 19:38839478-38839500 GACAGGGGAAGTGGAGGACGGGG - Intronic
1165905854 19:39194197-39194219 GAGAGGTGAAGTGACTGCCCTGG - Intergenic
1165993458 19:39828627-39828649 GAGAGGGCAGGTGGTGGCCTGGG + Intronic
1166294534 19:41882725-41882747 GAGAGGAGAGGTGGAGGCCAAGG + Intergenic
1166710835 19:44936137-44936159 GAGAGGGGCAGAGGTTGTCCTGG + Intergenic
1166765460 19:45250477-45250499 GAAAGGGCAAGTGCTTGCCCCGG + Intronic
1166773711 19:45299874-45299896 GAGAGGGGAAGTGGCAGTCAGGG - Intronic
1166895145 19:46018156-46018178 GAGAGGGGATGTGGAGTCCCAGG - Intronic
1167077578 19:47258679-47258701 GAGAGGGGATGGGGTCTCCCAGG - Intronic
1167115106 19:47484422-47484444 GAGATGGGAGGTGGTGGCCACGG + Intergenic
1167409738 19:49337867-49337889 GAGAGGGGGAGGGGTGGGGCGGG + Intronic
1167577342 19:50324103-50324125 GAGAGGGGGAGAGGTGACCTAGG + Intronic
1167577497 19:50324850-50324872 CAGAGGGGAGGTGGGGGTCCGGG + Intronic
1167641903 19:50686923-50686945 GAGAGGGGCAGTGAGGGGCCGGG + Intronic
1167674315 19:50874988-50875010 GAGAGGGAAGGTCCTGGCCCAGG + Intronic
1167780988 19:51598690-51598712 GCCAGGCGCAGTGGTGGCCCTGG + Intergenic
1167791758 19:51687933-51687955 GAGAGAGGAAGGGGTGGGGCAGG - Intergenic
1168141221 19:54388611-54388633 GAGAGAGGAAGGCGTTGCCCGGG - Intergenic
1168342960 19:55636207-55636229 GGGAGGGGAACTGGAGGCCAGGG + Intronic
925125291 2:1450371-1450393 GAGAGGGGAACTAGGGTCCCAGG + Intronic
925891505 2:8438645-8438667 GGGAGGGGAAGTGGGGGCAGAGG - Intergenic
925905042 2:8535194-8535216 GAGCGGGTGAGGGGTGGCCCAGG + Intergenic
925982640 2:9189633-9189655 CAGAGGGGAAGGGGTGGCATAGG + Intergenic
926108043 2:10164777-10164799 GGGAGGGGCAGTGGGGGCCCTGG - Intronic
926315851 2:11708962-11708984 TAGAGGGGAAATGGAGGCTCAGG + Intronic
928089196 2:28363738-28363760 GAGAGGGGCTGCGGTGCCCCAGG - Intergenic
928247712 2:29645656-29645678 GATAGGAGCAGTGGTGGCACAGG - Intronic
929260038 2:39856111-39856133 GAGAAGGGTAAAGGTGGCCCAGG + Intergenic
929864906 2:45709559-45709581 GAATGGGGATGGGGTGGCCCAGG - Intronic
931092431 2:58900367-58900389 GAGAGGGGAAGAGTTGGCCAAGG - Intergenic
932012653 2:67993914-67993936 GGGAGGGGAGATGGTGTCCCAGG - Intergenic
932436883 2:71707155-71707177 GAGTGGGGCAATAGTGGCCCTGG + Intergenic
933599606 2:84316159-84316181 GAGAGGGGAAGGGGTGCCCCTGG - Intergenic
934062254 2:88306055-88306077 GAAAGGGGAATTAGAGGCCCTGG - Intergenic
934557659 2:95296022-95296044 CAGAGGGGAGGTGGCAGCCCAGG - Intergenic
935205751 2:100895472-100895494 GAGAAAGGCAGTGGTGGCCTGGG - Intronic
935338918 2:102042514-102042536 GAGGGGAGAAGTGGTGTCCAGGG + Intergenic
935524598 2:104150387-104150409 GAGAAGGGAAGAGGTGACACAGG + Intergenic
935634240 2:105237623-105237645 GAGAGGGGAAAATGCGGCCCAGG - Intergenic
936045084 2:109181103-109181125 GTGAGGAGAAGTGATGGCTCAGG + Intronic
936146200 2:109981948-109981970 GAGAGAGGAGGGGCTGGCCCAGG - Intergenic
936198491 2:110389531-110389553 GAGAGAGGAGGGGCTGGCCCAGG + Intergenic
936527487 2:113251379-113251401 GAGGGGGGAAGGTGTGGCCCAGG + Intronic
937129560 2:119497326-119497348 GAGAGGGGAAGTGGGGGGAATGG - Intronic
937907834 2:127061011-127061033 GAGAGGGGCAGTAGAGGCCCAGG - Intronic
938236762 2:129711774-129711796 GACAGCGGCAGTGGTGGCCGGGG - Intergenic
938238099 2:129722700-129722722 GTGAGGAGCAGAGGTGGCCCAGG - Intergenic
938473779 2:131589706-131589728 GGGATGGGAGCTGGTGGCCCTGG - Intergenic
940897798 2:159097210-159097232 GAGAGGAGCAGTGGAGGCCTGGG + Intronic
941475158 2:165942519-165942541 GTGAGGAGGAGTGGTGGGCCTGG - Intronic
943022965 2:182597471-182597493 AAGAGAGGAACTGGTGGGCCAGG + Intergenic
944669569 2:201983889-201983911 GAGAGGGTAAGGGGTGGCGGTGG - Intergenic
946193705 2:218021230-218021252 CAGAGGGGAAACGGAGGCCCAGG + Intergenic
946771854 2:223096860-223096882 GAGAGGGGGCGAGGTGGTCCAGG - Intronic
947744340 2:232499896-232499918 GAGGTGGGAAATGGGGGCCCGGG + Intergenic
947813990 2:233023781-233023803 GAGTGGGGAAGTGGTGGCCTGGG - Intergenic
947912661 2:233811622-233811644 GGCAGAGGAAGTGCTGGCCCAGG + Intronic
947946005 2:234102823-234102845 AAGAGAGGAAGCAGTGGCCCAGG - Intergenic
948298139 2:236879747-236879769 GAGAGGGCATCAGGTGGCCCAGG - Intergenic
948544517 2:238717326-238717348 GGAAGGGGAAGAGGTGGCTCTGG + Intergenic
948815311 2:240507438-240507460 GGGAGGGGAGTGGGTGGCCCTGG - Intronic
948939166 2:241187647-241187669 GAGAGGGGAAGAGGAGGGGCGGG + Intergenic
949027175 2:241771792-241771814 GAGGGGAGAAGGGGTGGGCCGGG + Intergenic
1168769901 20:408288-408310 GAAAGTGAAAGTGGCGGCCCCGG - Exonic
1168789062 20:563781-563803 GGGATGGGAAGGGGTGGGCCAGG + Intergenic
1168841986 20:915510-915532 AAGAGGGCAAGTGGCGGCCCTGG - Intronic
1170613245 20:17930402-17930424 GACTGGGCAGGTGGTGGCCCAGG - Intergenic
1170728957 20:18955698-18955720 GAGAGGGGGAGTGGTCACACTGG - Intergenic
1170763972 20:19274654-19274676 GAGGGGAGCAGTGGAGGCCCTGG - Intronic
1171126113 20:22603466-22603488 GAGAGGAGTAGTTGGGGCCCAGG + Intergenic
1171968679 20:31549751-31549773 GAGAGGGGAAGAGGCTGCCTGGG - Intronic
1171973177 20:31577186-31577208 GGGAGGGGAGGTGGAGGCACTGG + Intronic
1172297885 20:33826381-33826403 ATGAGGGGTAGTGGTGGCTCAGG + Intronic
1172779296 20:37426252-37426274 GAGACCGAAGGTGGTGGCCCAGG - Intergenic
1172871688 20:38139667-38139689 GAAAGGGGAAGGGATGGGCCTGG + Intronic
1173014527 20:39213004-39213026 GAAAGAGGAAATGGAGGCCCAGG + Intergenic
1173410879 20:42808501-42808523 GAGAGGGGATGTGGAGGCCCAGG + Intronic
1173546176 20:43899815-43899837 GAGAGGCGAAGTGGCAGCTCTGG - Intergenic
1173587485 20:44193822-44193844 GAGATAGGAAGGGGTGGGCCAGG - Intergenic
1173614946 20:44396449-44396471 GAGACGGGAAGGGATTGCCCTGG - Intronic
1173812039 20:45962003-45962025 GGGTGGGGAAGTGGAGGCCCGGG - Intronic
1174107144 20:48170846-48170868 GAGAGGGTAAGGGGTTGGCCTGG - Intergenic
1174288469 20:49489425-49489447 GAGAGGGAGAGTGGTTGTCCTGG + Intergenic
1174348842 20:49952277-49952299 GACAGGGGAAGTGGGTCCCCAGG + Exonic
1175294495 20:57899094-57899116 AATAAGGGAAGTGGTGGGCCAGG - Intergenic
1175305720 20:57974219-57974241 CAGAGGGAACGTGGTGGCCAGGG + Intergenic
1175443084 20:59004332-59004354 GAGAGGGGAAGGAGTGGCCAGGG + Intronic
1175687014 20:61038829-61038851 GAGGTGGTAAGTGGTAGCCCAGG + Intergenic
1175926794 20:62475237-62475259 GAAAGGGAAGGCGGTGGCCCCGG + Exonic
1176111204 20:63411550-63411572 GAGAGGAGCAGTGGGGCCCCTGG + Intronic
1176198251 20:63847847-63847869 GAGAGGGGAAGTGGGGAGCAGGG - Intergenic
1176960599 21:15154762-15154784 GGGAGGGGAGGTGGTTGCCATGG + Intergenic
1177209072 21:18047383-18047405 GAGAGGGGAAGGGGACACCCAGG - Intronic
1178911825 21:36680880-36680902 CAGAGGGGAAGATGTGGCCAAGG + Intergenic
1179716458 21:43291156-43291178 GGCAGGGGCAGTGGTGGACCAGG + Intergenic
1180093280 21:45543093-45543115 GGGATGGGGACTGGTGGCCCCGG - Intronic
1180474089 22:15687683-15687705 GGGATGGGAGCTGGTGGCCCTGG - Intergenic
1180594224 22:16963070-16963092 GAGATGAGAAGTGCTGGCCAGGG - Intronic
1180638782 22:17281430-17281452 GAGAGCTGAAGTGTTGGCTCGGG - Intergenic
1181080094 22:20408122-20408144 GAGAGGGGAAGCTGAAGCCCAGG + Exonic
1181349533 22:22245133-22245155 GAGGGGGGACCTGGGGGCCCTGG - Exonic
1181514884 22:23404751-23404773 CTGTGGGGAAGTGGAGGCCCAGG - Intergenic
1181552612 22:23649357-23649379 AAGAGAGGAAGAGGTGGGCCAGG + Intergenic
1181625353 22:24119095-24119117 GAGAGGGGAAGTTATGGGCTGGG - Intronic
1181646557 22:24234367-24234389 GAGATGGGGAGTGGAGTCCCAGG - Intronic
1181671922 22:24429583-24429605 GGGAGGGGAGCTGGAGGCCCAGG + Intronic
1181998824 22:26903742-26903764 GAGATAGGCAGGGGTGGCCCTGG - Intergenic
1182090638 22:27592176-27592198 GAGAGGTGAAGTGGAGGGCCCGG - Intergenic
1182117351 22:27764482-27764504 CAGAGGGGAAGTAGAGGCACAGG - Intronic
1182321697 22:29481899-29481921 GAGAGGGCAAGTGTTGGTCAAGG - Intronic
1183513198 22:38247931-38247953 GAGGGGGGATGTGCTGGCCCCGG - Exonic
1183654458 22:39176721-39176743 GAGAGGGGAAGTGGCTGTCTGGG - Intergenic
1184097769 22:42325744-42325766 GAGCTGGGAAGTGGAGGCCGTGG + Intronic
1184368497 22:44067974-44067996 GAGAGGGGCACTAGTGCCCCTGG + Intronic
1184469001 22:44684931-44684953 GGGAAGGGAAGTGGCAGCCCGGG + Intronic
1184516538 22:44965908-44965930 TAGAGAGGAAGTGGTGGAGCAGG - Intronic
1184522587 22:45004093-45004115 GAGAGGGGAAGTGACAGCCAAGG + Intronic
1184746877 22:46461418-46461440 CAGAGGGGATCTGCTGGCCCAGG + Intronic
1185064041 22:48621776-48621798 GAGGTGGGGAGTGGTGGCCGAGG + Intronic
949576505 3:5343580-5343602 GAAAGGGGAACTGGAAGCCCAGG - Intergenic
949917650 3:8976987-8977009 CAGAGGGGATGTGGTGGGGCTGG + Intergenic
949929106 3:9064379-9064401 GAGAAGGTGAGTGGGGGCCCTGG - Exonic
949947709 3:9203331-9203353 GAGAGGTTAAGTGGTTTCCCAGG - Intronic
950127209 3:10517289-10517311 GGAAGGGGAAGGGGTGGCCGAGG - Intronic
951107562 3:18762715-18762737 GGGAGGGGTGGTGGTGACCCAGG - Intergenic
951843353 3:27058759-27058781 GGGAGAGGAAGTGCTGGGCCTGG - Intergenic
953697537 3:45171693-45171715 GAGAGGGGCAAATGTGGCCCAGG - Intergenic
953808210 3:46089803-46089825 GAGAGGGGCTGTGTTGGCCCAGG + Intergenic
953967703 3:47322709-47322731 GTGAGGTGATGTGGTGGGCCTGG + Intronic
954291898 3:49654277-49654299 GAGCGGGGAGGTGGAGGCACTGG - Exonic
954613712 3:51959141-51959163 GAGAGTGGAAATGGTGGGGCGGG - Intronic
954920049 3:54182727-54182749 CAGAGAGGAAGTGATCGCCCAGG - Intronic
955751676 3:62190030-62190052 GGGAGAGGAAGAGGTGGCTCGGG - Intronic
960236205 3:115285507-115285529 GAGTGGGGTAGTGGTGTGCCAGG - Intergenic
961339613 3:126209238-126209260 CAGAGGGAAAGTTGTGGTCCAGG + Intergenic
961678048 3:128579997-128580019 AAGAGGGGAAGGCTTGGCCCAGG + Intergenic
961739176 3:129022001-129022023 GTGAGGGGCAGAGGTGGCCGGGG + Intronic
962255723 3:133868910-133868932 GAGCTGGGAAGTGGTGGAGCTGG + Intronic
962320927 3:134389571-134389593 GAGAGGGGCTGTGTGGGCCCAGG - Intergenic
963049392 3:141128341-141128363 GAGAGGGGCTGTGGGGGGCCAGG + Intronic
963786472 3:149539642-149539664 GATGGGGGAAGTGGTGGTTCTGG - Intronic
963853169 3:150227633-150227655 AAGAGGGAAAGTGGTGGCAGTGG + Intergenic
966592187 3:181695591-181695613 GAGTGGGGAAGCGGAGGCGCGGG - Intergenic
966734637 3:183179306-183179328 GAGAGGCGGTGTGGGGGCCCGGG - Exonic
967171739 3:186827390-186827412 GAGAGGCGATGTGGGGGCCCGGG + Intergenic
967229945 3:187328187-187328209 GGAAGGAGAAGTGGTGGGCCGGG - Intergenic
967608083 3:191471934-191471956 GAGAGGTGAAAGCGTGGCCCGGG + Intergenic
968534402 4:1113960-1113982 GAGAGTGGGCGTGGGGGCCCTGG + Intergenic
968661551 4:1800799-1800821 GAGAGGGGTGGTGGGAGCCCTGG + Intronic
968833025 4:2942953-2942975 GAGAGGGGAAGGCGTGGGTCAGG + Intronic
968867363 4:3222031-3222053 GAGTGGGGCAGAAGTGGCCCTGG + Intronic
969148071 4:5141640-5141662 GGGAGAGGAGGTGGTGGCCTGGG + Intronic
969183023 4:5456387-5456409 GACAGGGAAAGTGGCGGCCAAGG + Intronic
969293415 4:6254931-6254953 CAGAGGGTGTGTGGTGGCCCGGG + Intergenic
969466716 4:7361674-7361696 GAGAAGGGGTGTGGGGGCCCGGG + Intronic
969657458 4:8506569-8506591 GAGGGGGGAAGGGGCTGCCCAGG - Intergenic
969718575 4:8880501-8880523 GAGAGGCCAAGTGGAGGCTCAGG - Intergenic
969738837 4:9009553-9009575 GAAGGGGGAAGTGCGGGCCCAGG + Intergenic
970447886 4:16139428-16139450 GGGAGGGGAAGGGGTGTCCATGG + Intergenic
972791374 4:42374401-42374423 GAGAGAGGAGGTGGTAGCTCAGG - Intergenic
973073967 4:45899862-45899884 GACAACGGAAGTGGTGGCCATGG + Intergenic
973257717 4:48129767-48129789 GAGTGGGGAAGTTGTGGGCAAGG - Intronic
974766162 4:66348956-66348978 GAGAAGGCAAGTGTAGGCCCAGG - Intergenic
976100673 4:81559596-81559618 GAAAGGAGAAGTGGCAGCCCAGG - Intronic
978194282 4:105952915-105952937 GAGAGGAGAAGGGGAGGCCGAGG + Intronic
979133984 4:117085479-117085501 GGGATGGGAAGTGGAGCCCCCGG - Exonic
979156096 4:117392469-117392491 GCTTGGGGAAGTGGTGGCCATGG + Intergenic
979358002 4:119728628-119728650 GAGAGGGAGATTGGAGGCCCAGG + Intergenic
981425456 4:144597383-144597405 GAAAGGGGAAGTTGGGGGCCTGG + Intergenic
981749674 4:148081893-148081915 GAAGGGGCAAGTGCTGGCCCAGG + Intronic
983674662 4:170278754-170278776 GAGAGGAGAAGTGGGTGCCTGGG - Intergenic
985083624 4:186291750-186291772 GAATGAGGAAGTGTTGGCCCTGG + Intergenic
985574301 5:666428-666450 GGGCGGGGCTGTGGTGGCCCCGG - Intronic
985577115 5:678626-678648 GGGAGGGTGCGTGGTGGCCCTGG + Intronic
985592034 5:770679-770701 GGGAGGGTGTGTGGTGGCCCTGG + Intergenic
986361550 5:6983066-6983088 AGGAGGGGAACAGGTGGCCCAGG - Intergenic
987248952 5:16079507-16079529 GAGAGGTGAAGTGGTGAGACTGG - Intronic
988621721 5:32830034-32830056 TAAAGGGGAAGAGGTGGCCCAGG + Intergenic
989199634 5:38750651-38750673 GGGAGGGGAAGTGAAGGCGCTGG - Intergenic
991474369 5:67004147-67004169 GGGAGGGGGAGCGGCGGCCCAGG + Intronic
992627621 5:78649029-78649051 GAGAGGGGGTGTGGGGGCCTGGG + Intronic
992781950 5:80135945-80135967 GAGAGGGGAAGTGGGGAACAGGG + Intronic
995439678 5:112176476-112176498 GAGATGGGAAGGGATGGGCCAGG - Intronic
996500182 5:124207977-124207999 GTGAGGGGATGTGGATGCCCAGG - Intergenic
997206855 5:132055240-132055262 GAGAGGGGAAGGGCCGGCCTGGG - Intergenic
997347449 5:133202242-133202264 GAAAGAGGAAGTGGTGGGACAGG + Intronic
997782605 5:136675269-136675291 GAGAGGGGAGGCCGTGGGCCAGG + Intergenic
998162946 5:139823600-139823622 GAGAGGGCCAGTGCTTGCCCGGG - Intronic
998652373 5:144135321-144135343 AAGATGGGTAGGGGTGGCCCAGG + Intergenic
999046539 5:148475660-148475682 GAGCGGGGAAGTGGTGGAAGTGG - Intronic
999089213 5:148920809-148920831 GAGTGGGGTAGTGGTGGGCTTGG + Intergenic
999961139 5:156756849-156756871 GAGAGGGTCAGTGGTTGCCAGGG - Intronic
1001483142 5:172102165-172102187 GTGAGAGGTGGTGGTGGCCCAGG + Intronic
1002437762 5:179242648-179242670 GAGAGAGCAAGTGATGGCTCAGG - Intronic
1002463152 5:179386967-179386989 GAGGGTGGAGCTGGTGGCCCAGG - Intergenic
1002773434 6:308516-308538 AAGAGGGGAGGTGCTGGCCCCGG + Intronic
1003476002 6:6483520-6483542 GAGATGGTAAGTGTTGGCCAGGG + Intergenic
1004255223 6:14057587-14057609 GCCAGGGGAAGAGGTGGCCAAGG + Intergenic
1005109736 6:22267491-22267513 GAGAGGGTAAAATGTGGCCCAGG - Intergenic
1005862510 6:29912347-29912369 GAGAGGGTGATTGCTGGCCCTGG - Intergenic
1006082076 6:31573440-31573462 GAGTGGGGAGGAGGTGGCCTTGG - Exonic
1006296550 6:33172490-33172512 CAGAGGGGAAGTGGGGGAGCTGG - Intronic
1006302131 6:33199329-33199351 GAAGGGGGTAGGGGTGGCCCAGG + Exonic
1006374018 6:33662142-33662164 GAGAGGGGCAGCCATGGCCCCGG + Intronic
1006378506 6:33684711-33684733 GAGAGTGGAAGGGAGGGCCCGGG - Intronic
1006453723 6:34120319-34120341 GAGGGAGGAAGTCCTGGCCCAGG + Intronic
1007040181 6:38714878-38714900 GAGAGGGGAGGGGGTGGACTTGG + Intergenic
1007240196 6:40419391-40419413 GAGAGGGGTAGTGGTTCTCCAGG - Intronic
1008051502 6:46904370-46904392 AAGAGGGGAAGTGCTGACACAGG + Intronic
1008200931 6:48589263-48589285 AAGAGGAAAAGTGGAGGCCCAGG + Intergenic
1011502336 6:88004847-88004869 GAGAGGGGAGGTGGTGGCTCAGG + Intergenic
1014844450 6:126258293-126258315 GGGCGGGGCAGTGGTGGCTCAGG - Intergenic
1015020004 6:128461776-128461798 GAGATGGGAAGTGGTTGCCTAGG - Intronic
1015990434 6:138935868-138935890 GCGCGGGGGAGTGGTGGCCAGGG + Intronic
1016448677 6:144158356-144158378 AAGAGGGAGAGTGGTGTCCCTGG + Intronic
1017659222 6:156657487-156657509 GAGTGGGTGAGGGGTGGCCCTGG - Intergenic
1017907314 6:158765637-158765659 GTGAGGGGCCGTGGTGTCCCTGG - Intergenic
1017929275 6:158938369-158938391 GGGAGGGCAGGTGGGGGCCCAGG + Intergenic
1018078928 6:160242135-160242157 GAGAGGTGAACTGCTGGGCCTGG + Intronic
1018296831 6:162356355-162356377 GAAAGAGGAAATGATGGCCCTGG - Intronic
1018389448 6:163331342-163331364 GAGAGGGAAGGTGGTGTCTCCGG + Intergenic
1018584057 6:165335945-165335967 AAGGGGAGAAGTCGTGGCCCTGG + Intronic
1019048164 6:169163586-169163608 GAGGTGGGAACTGCTGGCCCGGG + Intergenic
1019056005 6:169223999-169224021 GAGTGGGGATGAGGTGGGCCTGG + Intronic
1019282478 7:207463-207485 GCGAGGGGCAGGGCTGGCCCCGG - Intronic
1019300485 7:300677-300699 GAGAGGGGACCTGCTGGTCCTGG - Intergenic
1019474134 7:1236023-1236045 GCGAGTGCAAGTGGCGGCCCTGG - Exonic
1019479654 7:1260592-1260614 GAGAGGGGAGGTGGGCGCCGAGG - Intergenic
1019897317 7:3992403-3992425 GAGAGGGGCAGTAGTGTCCTAGG + Intronic
1020280487 7:6647715-6647737 GAGATGGGCAGAGGTTGCCCAGG + Intronic
1020475402 7:8588429-8588451 GACAGGGAAAGTTGTGTCCCAGG + Intronic
1021553257 7:21894392-21894414 GGAAGGGGAAGTGCTGGCACTGG + Intronic
1021596766 7:22325414-22325436 GAGTGGGGCAGTGGTGGCGATGG - Intronic
1022383983 7:29884791-29884813 GAGAGGCCAAGTGGTCGCCCAGG - Intronic
1022476064 7:30710680-30710702 GAGAGGGGAAGGGCTTGCTCAGG + Intronic
1022574456 7:31483967-31483989 GAGAGGGGTTGGGATGGCCCTGG - Intergenic
1022589358 7:31646441-31646463 GAAAGAGTAAGAGGTGGCCCTGG + Intronic
1023057890 7:36304256-36304278 GAGAGGGGCAGTGTTTGCCAAGG + Intergenic
1023294761 7:38702982-38703004 GAGAGTGAAGGTGATGGCCCAGG + Intergenic
1023615123 7:42011986-42012008 GAGAGGAGAGATGATGGCCCCGG - Intronic
1023663406 7:42493934-42493956 GAGAGGGGATGTAGGGACCCTGG - Intergenic
1023980414 7:45066596-45066618 GAGTGGGGAAGTTGGGGGCCAGG + Intronic
1023994902 7:45153390-45153412 GAGAGGGGAGGTTGTGCTCCAGG + Intergenic
1024054109 7:45648529-45648551 GGGCGGGAAGGTGGTGGCCCAGG + Intronic
1025249259 7:57341115-57341137 GAGAGGTGAAGAGGCTGCCCAGG + Intergenic
1025944028 7:66092740-66092762 GAGAGAGGAAGAGGTGGGCCAGG - Intronic
1026461376 7:70618225-70618247 GAGAGGCCAAGTGGTTGCCGTGG + Intronic
1026972238 7:74475541-74475563 GGGAGGGGAGGGTGTGGCCCGGG + Intronic
1027222696 7:76224006-76224028 GAGAGGGGAAGTGGGGGCAGGGG - Intronic
1027222706 7:76224028-76224050 GAGAGGGGAAGTGGGGGCAGGGG - Intronic
1029496089 7:100895987-100896009 GAGAGGGGAGGTGGCCACCCGGG - Intronic
1029638706 7:101804266-101804288 CAGAGGGGAAGAGGCGGCGCAGG + Intergenic
1029714246 7:102317443-102317465 GAGAGGGGTCATGGTGACCCCGG + Intronic
1029960481 7:104684897-104684919 AAGAGGGCAAGTGGTGCCCTGGG - Intronic
1031887237 7:127254624-127254646 GAAAGGGGAAGAGGTGCCCTGGG - Intergenic
1032094236 7:128929627-128929649 GGGAGGGGCAGAGCTGGCCCGGG - Intergenic
1033146139 7:138871344-138871366 GAACTGGGCAGTGGTGGCCCTGG + Exonic
1033414471 7:141149939-141149961 GAGATGGGGAGAGGTGGCCTGGG + Intronic
1033442888 7:141396113-141396135 GAGAGGGGAGGTGGGGAGCCAGG + Intronic
1034174162 7:149087675-149087697 GAGATGGAAAGTTGTGACCCCGG - Intronic
1034294392 7:149959102-149959124 GAGAGGAGAAGTGGAGGTCATGG + Intergenic
1034366320 7:150551623-150551645 GAGTGGGGCACTGGGGGCCCAGG - Intergenic
1034528962 7:151683699-151683721 GTGAGGGGGAACGGTGGCCCAGG + Intronic
1034534223 7:151716949-151716971 AAGAGGGAAAGAGGTGGGCCGGG + Intronic
1034811677 7:154137770-154137792 GAGAGGAGAAGTGGAGGTCATGG - Intronic
1034829715 7:154298728-154298750 GGGAGGGAAAGCTGTGGCCCCGG + Intronic
1036128416 8:6085194-6085216 GAGAGGGGACGTGATGTGCCTGG - Intergenic
1036256865 8:7213146-7213168 GAGGGGGGCAGTGCGGGCCCAGG - Intergenic
1036308915 8:7671745-7671767 GAGGGGGGCAGTGCGGGCCCAGG - Intergenic
1036360624 8:8074366-8074388 GAGGGGGGCAGTGCGGGCCCAGG + Intergenic
1036441896 8:8789118-8789140 GACGGGGGAAGTGGTGGCTGGGG + Intronic
1036890346 8:12592600-12592622 GAGGGGGGCAGTGCGGGCCCAGG - Intergenic
1036968789 8:13330694-13330716 GAGAGGGGATGAGGTGACCAGGG + Intronic
1037111490 8:15168629-15168651 AAGAGGGGAACAGGTGTCCCTGG - Intronic
1037298114 8:17422695-17422717 CAGAGGGAGAGTGGTGGCTCTGG - Intergenic
1037674270 8:21040960-21040982 GGGCGGGGAAGTGGAGGCCAAGG - Intergenic
1038272935 8:26090745-26090767 CAGAGGTGAAGTCTTGGCCCAGG - Intergenic
1040047050 8:42975032-42975054 GCGACGGGAAGGGGTGGCTCTGG + Intronic
1041939092 8:63367111-63367133 CAGATGGGAAGAGGTGGCCTAGG + Intergenic
1042203446 8:66304228-66304250 GAGTGGTGAAGTGTTGGTCCTGG - Intergenic
1045416954 8:101976928-101976950 GAAAGAGGAAGTGGGGGCCAGGG + Intronic
1046012942 8:108572564-108572586 GGGAGGCGAAGTGGTGGCCCAGG - Intergenic
1046759625 8:118007913-118007935 GAGAGGGGCAGTGCTGGCAGAGG + Intronic
1047352379 8:124088294-124088316 GACTGGGGCAGTGGTGGCCATGG - Intronic
1047498313 8:125424197-125424219 GAGATGGAAACTGGGGGCCCTGG + Intergenic
1048042577 8:130745642-130745664 GGGAGAGGATGTGATGGCCCAGG + Intergenic
1048163507 8:132041673-132041695 GCCAGGTGAAGTGGGGGCCCAGG + Exonic
1048176064 8:132153895-132153917 AAGAGGGGAATAGGTGTCCCTGG - Intronic
1049009050 8:139875240-139875262 CAGATGGGATGAGGTGGCCCTGG + Intronic
1049096013 8:140548531-140548553 GTGTGGGGAAATGGTGACCCTGG + Intronic
1049264658 8:141661009-141661031 GAGCTGGGAAGTGGTGGGACTGG - Intergenic
1049269122 8:141684811-141684833 CAGATCGGAAGTGGTGGCACTGG - Intergenic
1049271321 8:141697768-141697790 GGGAGGGGGAGTGCTGGGCCTGG + Intergenic
1049361830 8:142215661-142215683 GAGAGGGGAAGGGCAGGCCAAGG + Intronic
1049498489 8:142947960-142947982 GAGAGGGGAATGGGTTGCCCAGG + Intergenic
1049688806 8:143949910-143949932 GAGAGGGGAGGGGGCGCCCCGGG + Intronic
1051394198 9:16601630-16601652 GAGAGGGGAAGAGGAAGCCAGGG + Intronic
1053379631 9:37637679-37637701 GAGAGATTAAGTGATGGCCCTGG - Intronic
1053512730 9:38702587-38702609 GTGAGGGTAGGTGCTGGCCCTGG + Intergenic
1055266159 9:74498070-74498092 GAAAGGGAAAGAGGTTGCCCAGG + Intronic
1055596192 9:77867161-77867183 GCGGGGGGAAGTGGGGGCCAGGG - Intronic
1056588385 9:87944300-87944322 GGGAGGGGAAGTCGTCGTCCCGG + Intergenic
1057216997 9:93234647-93234669 GTGAGGGGCAGGGCTGGCCCTGG + Intronic
1057423606 9:94930829-94930851 GAGAGGGGGTGTGTTGGCCCAGG + Intronic
1058174165 9:101719121-101719143 GAGAATAGAAGTGGTGGGCCGGG + Intronic
1059456481 9:114403186-114403208 GAGATGGCAAGTGGGGCCCCTGG + Intronic
1060295964 9:122343081-122343103 GAGTTGGGGAGTGGGGGCCCTGG + Intergenic
1060618703 9:125043811-125043833 CAGTGGGGAAGTTGTGGCCAGGG + Intronic
1061003271 9:127914721-127914743 CTGTGGGGAAGTGGTGGTCCAGG + Exonic
1061130795 9:128706656-128706678 GATGGGGGAAGCTGTGGCCCAGG + Intronic
1061237574 9:129351610-129351632 GAGAGGGGAAGAGGAGGCTAGGG + Intergenic
1061609521 9:131737264-131737286 GAGAGGGGAAGGGGCTGACCAGG - Intronic
1061889117 9:133608531-133608553 GAGTGGGGAAGTGGTGGAGATGG - Intergenic
1061993966 9:134174813-134174835 GAGAAGGGAAAGGGTGGCCCTGG - Intergenic
1062123131 9:134844951-134844973 GAGAAAGGAAGGGATGGCCCCGG + Intergenic
1062520257 9:136954665-136954687 GTGAGGGGAGGAGGTGGCCCAGG - Intronic
1062711295 9:137976463-137976485 GCTGGGGGAGGTGGTGGCCCTGG + Intronic
1187046609 X:15653593-15653615 GAGAAGGGAAGAGATGGTCCTGG - Intronic
1187400448 X:18954876-18954898 GAGAGGGAAAGTGGCTTCCCTGG - Intronic
1188893880 X:35643206-35643228 GAGAGGGGATGTAGGGGCACGGG - Intergenic
1189332384 X:40151973-40151995 GAGAGGGGAAGAGGTGGAGCGGG + Intronic
1189349202 X:40264413-40264435 GAGAGGGGTTGTGGTGGCAGTGG + Intergenic
1190248441 X:48705773-48705795 GAGAGGGGAAGAAGAGACCCAGG - Intronic
1190911400 X:54775298-54775320 GTGATAGGAAGTGGGGGCCCTGG - Intronic
1190919816 X:54840917-54840939 GTGATAGGAAGTGGGGGCCCTGG + Intergenic
1190939606 X:55027783-55027805 GAGAGGGGGAGAGGTTGCTCTGG - Intronic
1191884477 X:65874515-65874537 GAGAGGGGAAGAGGTGAGACTGG + Intergenic
1192173941 X:68874375-68874397 GAGAGGGGCAGGGGTGGCAGGGG + Intergenic
1193091831 X:77502148-77502170 GAGAGGGGAAAAGGTGCCCTAGG - Intergenic
1195733787 X:107992512-107992534 GAGAGGGGAAGAGGAGGTTCTGG + Intergenic
1196185410 X:112739919-112739941 GGGAGGGGGAGTGGGGGACCAGG + Intergenic
1196972156 X:121121553-121121575 GAGAGGGGAAGAGGAGGCCTAGG - Intergenic
1197753248 X:129979909-129979931 GGGTGGGGAAGTGGGGGGCCGGG + Intergenic
1199677730 X:150201695-150201717 CAGAGTGGAAGTGGAGGGCCAGG + Intergenic
1199983388 X:152933460-152933482 GAGAGGAAAAGCGGTAGCCCTGG + Intronic
1200003682 X:153074323-153074345 GAGAGGAGGAGAGGAGGCCCCGG - Exonic
1200004041 X:153075686-153075708 GAGAGGAGGAGAGGAGGCCCCGG + Intergenic