ID: 903189006

View in Genome Browser
Species Human (GRCh38)
Location 1:21646024-21646046
Sequence CGCTCAGAGAGGGGAAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 329}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189006_903189017 19 Left 903189006 1:21646024-21646046 CCACCACTTCCCCTCTCTGAGCG 0: 1
1: 0
2: 3
3: 34
4: 329
Right 903189017 1:21646066-21646088 AATGGGGATGGACAGTAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 172
903189006_903189016 7 Left 903189006 1:21646024-21646046 CCACCACTTCCCCTCTCTGAGCG 0: 1
1: 0
2: 3
3: 34
4: 329
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189006_903189011 1 Left 903189006 1:21646024-21646046 CCACCACTTCCCCTCTCTGAGCG 0: 1
1: 0
2: 3
3: 34
4: 329
Right 903189011 1:21646048-21646070 CAGTTCCCTCATCTGTAAAATGG 0: 37
1: 931
2: 4071
3: 9755
4: 16832
903189006_903189012 2 Left 903189006 1:21646024-21646046 CCACCACTTCCCCTCTCTGAGCG 0: 1
1: 0
2: 3
3: 34
4: 329
Right 903189012 1:21646049-21646071 AGTTCCCTCATCTGTAAAATGGG 0: 30
1: 766
2: 3523
3: 8849
4: 15187
903189006_903189013 3 Left 903189006 1:21646024-21646046 CCACCACTTCCCCTCTCTGAGCG 0: 1
1: 0
2: 3
3: 34
4: 329
Right 903189013 1:21646050-21646072 GTTCCCTCATCTGTAAAATGGGG 0: 23
1: 594
2: 2828
3: 6721
4: 11858
903189006_903189018 20 Left 903189006 1:21646024-21646046 CCACCACTTCCCCTCTCTGAGCG 0: 1
1: 0
2: 3
3: 34
4: 329
Right 903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189006 Original CRISPR CGCTCAGAGAGGGGAAGTGG TGG (reversed) Intronic
900206680 1:1434692-1434714 AGCTCAGAGCTGGGAGGTGGGGG - Intergenic
900522565 1:3112809-3112831 CGCTCAGGGAGGCAAAGGGGTGG + Intronic
900849372 1:5130430-5130452 CTCTAAGAGTGGGGAAGTTGAGG + Intergenic
900974363 1:6007934-6007956 CGCTGAGGCAGGGGCAGTGGTGG + Intronic
901018313 1:6243917-6243939 TCCTCAGACTGGGGAAGTGGTGG + Intergenic
901114348 1:6829704-6829726 CAGTCAGAGCCGGGAAGTGGGGG + Intronic
901158146 1:7154460-7154482 TGCCCAGAGATGGGAAGTGATGG - Intronic
901769574 1:11523462-11523484 GGCACAGAGAGGGCAAGCGGGGG + Intronic
901850358 1:12011090-12011112 CTCTCAGAAAGGGGGAATGGGGG + Intronic
902047845 1:13539319-13539341 CGCTCAGACCTGGGAAGCGGAGG - Intergenic
902431533 1:16367275-16367297 CGCTGAGAGCTGGGAAGAGGCGG + Exonic
902671429 1:17977126-17977148 AGAGGAGAGAGGGGAAGTGGAGG - Intergenic
902763237 1:18598013-18598035 CGCTCATAGTTTGGAAGTGGGGG + Intergenic
902763271 1:18598227-18598249 CGCTCATAGTTTGGAAGTGGGGG + Intergenic
903016808 1:20366746-20366768 CGCTCGGAGAGGGGAAACCGAGG - Intergenic
903189006 1:21646024-21646046 CGCTCAGAGAGGGGAAGTGGTGG - Intronic
903193358 1:21668794-21668816 TCCTCAGAGGAGGGAAGTGGGGG - Intronic
903878218 1:26490822-26490844 TGGTCAGAGAGGGGAAGTTGGGG - Intergenic
903950060 1:26991510-26991532 GACTCAGTGAGGGGAAGGGGAGG - Intergenic
903957746 1:27036771-27036793 CTCTCAGAGAGTGGAATTTGGGG - Intergenic
904294005 1:29505988-29506010 AGCTCGGGGAGGGGAAGTGGAGG - Intergenic
904329736 1:29750702-29750724 AGCTAAGAGATGGGAAGAGGAGG + Intergenic
904334555 1:29788160-29788182 AGGCCAGGGAGGGGAAGTGGAGG - Intergenic
904658419 1:32066733-32066755 GGCTCAGGGAGGGGAAGTGAGGG + Intergenic
904966999 1:34381912-34381934 GACTGAGAGAAGGGAAGTGGGGG - Intergenic
904995410 1:34627698-34627720 CTCTCAGAGTGGGGAAGGGGAGG + Intergenic
905109332 1:35583786-35583808 CGGTCACAGAAGGGCAGTGGTGG - Intronic
905407465 1:37744823-37744845 CATTCTGAGATGGGAAGTGGTGG - Intronic
906299332 1:44670718-44670740 ATCACAGAGAGGGGAAGTGAGGG - Intronic
906513009 1:46422235-46422257 CGCACAGAGGGGGGAAGTCAAGG + Intergenic
906745079 1:48215816-48215838 CGCTCAGAGAGCTGAAGGTGAGG + Intergenic
907341933 1:53741189-53741211 AGCTCACTGAGGGGAAGGGGAGG - Intergenic
907564030 1:55417815-55417837 AGCTGAGAGAGGGGAGTTGGTGG + Intergenic
907733847 1:57092721-57092743 TGCCCTGAGAGGGGAAGTGCAGG + Intronic
907868673 1:58423406-58423428 CTCCAAGAGAGGGGAAGAGGTGG + Intronic
908649022 1:66311872-66311894 TGCTCAGAGCGGGGAAGTGGCGG - Intronic
910163611 1:84299304-84299326 CGCTCAGATAGGGAGAGGGGAGG - Intronic
911085959 1:93977736-93977758 CACTAAGAGGGAGGAAGTGGAGG - Intergenic
911112426 1:94204370-94204392 CCTTCAGAGAGGTGAAATGGAGG - Intronic
911184271 1:94887712-94887734 AGCTTAGAGTGGGGAAGTGATGG + Intronic
911733850 1:101316091-101316113 CCCTTGGAGAGGGGAATTGGGGG + Intergenic
913088035 1:115457112-115457134 CACCAAGAGAGGGGAAGGGGAGG + Intergenic
914901720 1:151714719-151714741 CTTTCAGAGAGGGGAGATGGAGG - Intronic
915555532 1:156658836-156658858 GCCTCAGAGAGGGGCAGTGATGG - Intronic
915561831 1:156692328-156692350 GGCTCAGGAAGGGGAAGTGGGGG + Intergenic
916764876 1:167850590-167850612 TGGTCAGAGAGGGGAACAGGAGG + Intronic
917456320 1:175189019-175189041 AGTTCAGGGAGGGGAAGTGTGGG - Intronic
919794254 1:201311697-201311719 CTCTCAGGGAGGGGCAGGGGTGG + Intronic
921184116 1:212655627-212655649 GGCACAGAGTGGGGAATTGGTGG - Intergenic
921866654 1:220094096-220094118 CGCTCCGGGAGCGGAAGGGGCGG - Exonic
922218528 1:223540164-223540186 GGCTCCCAGAGGGGAAGTGCAGG + Intronic
923506629 1:234610397-234610419 CGCGAAGTGAGGGAAAGTGGAGG - Intergenic
923762259 1:236857749-236857771 TGCTGTGAGAGGGGAAGTGCAGG + Intronic
1068171212 10:53397138-53397160 GGCCCAGTAAGGGGAAGTGGGGG + Intergenic
1069001290 10:63269240-63269262 CACTGAGAGAAGGGAAGAGGCGG + Intronic
1072687895 10:97549699-97549721 AGCTCAGGGAGGGAAAGGGGTGG - Intronic
1073121843 10:101126739-101126761 CTTTCAGAGCGGGGAAGAGGAGG + Intronic
1075552679 10:123403645-123403667 GGCTCAGAGCTGGGAAGTGGTGG + Intergenic
1075626329 10:123966741-123966763 CGCTCAGTGGGGGGATGGGGTGG - Intergenic
1076000227 10:126907257-126907279 CGCAGAGAGAGAGGAAGAGGTGG + Intronic
1076647787 10:131965289-131965311 CCCGCAGAGACAGGAAGTGGCGG + Intergenic
1076848883 10:133083333-133083355 CCCGCCGAGAGGGGAAATGGCGG - Intronic
1077119788 11:901582-901604 CGCTGAGAGAGGGACAGAGGAGG + Intronic
1077192467 11:1261151-1261173 GGTTCAGACAGGGGAAGTGCAGG + Intronic
1077208891 11:1359038-1359060 GGCTCAAGGAGGGGAAGTGGTGG + Intergenic
1077286560 11:1768548-1768570 GGCACAGAGAGGGGCAGGGGAGG + Intergenic
1079016600 11:16874152-16874174 AGCTCAGAGAGGTGAATGGGGGG + Intronic
1080568256 11:33532131-33532153 AGCTCAGAGAGGGCAAGGGCTGG - Intergenic
1081307913 11:41536076-41536098 CTAACAGAGAGGGGAAGAGGTGG - Intergenic
1081611236 11:44564853-44564875 GGCTCAGAGAAGGGAAGTCGAGG - Intronic
1081740652 11:45437499-45437521 TGCTCAGATCTGGGAAGTGGGGG - Intergenic
1081750193 11:45505121-45505143 GGCTCAGAGAGGGTAAGTGATGG + Intergenic
1083474347 11:62906333-62906355 CTCTCAGAACGGGGCAGTGGTGG + Intergenic
1083681811 11:64354890-64354912 AGGTCAGAGAAGGGAAGTGGGGG - Intronic
1083681850 11:64355021-64355043 AGGTCAGAGAAGGGAAGTGGGGG - Intronic
1083842674 11:65313809-65313831 AGCCCAGAGAAGGGAAATGGGGG - Intergenic
1084045344 11:66564803-66564825 AGCTCTGAGATGGGAAGGGGTGG + Exonic
1084970802 11:72771104-72771126 GGCTCAGAAAAGTGAAGTGGAGG + Intronic
1085036052 11:73300733-73300755 CATTCAGAGAGGGGCAATGGAGG + Intergenic
1085848947 11:80097898-80097920 CTCTCAGAGAGGGGAAGAGAGGG + Intergenic
1087219748 11:95533444-95533466 TGCTCTGGGAGGGAAAGTGGTGG - Intergenic
1088741021 11:112766813-112766835 AGCTCAGAGAGGGGAAGTGATGG - Intergenic
1089138168 11:116266027-116266049 AGCCCAGAGAGGGGAAGGGAAGG - Intergenic
1089982154 11:122781177-122781199 CGCTGAGGGAGAGGAAGAGGTGG - Intronic
1090404159 11:126467247-126467269 CCCTTAGGGAGGGGCAGTGGGGG - Intronic
1090458838 11:126871912-126871934 CCATCAGAGAGTGGAAGAGGAGG + Intronic
1091388271 12:108957-108979 CGCTCTGGGAGGGGACTTGGTGG + Intronic
1094396066 12:30006831-30006853 CTCTCTGACAAGGGAAGTGGGGG - Intergenic
1096845663 12:54405131-54405153 GGCTCAGAGAGTGAAAGAGGAGG - Intronic
1097044347 12:56176325-56176347 CCCCCAGAGAGGGGAAGCTGTGG + Intronic
1097183604 12:57184628-57184650 CGCTCAGAAGTGGGGAGTGGGGG + Intronic
1097245366 12:57604950-57604972 CGCGCGGGGAGGGGAGGTGGAGG - Intronic
1101834596 12:108286526-108286548 CTCACAGTGACGGGAAGTGGTGG - Intergenic
1103371322 12:120421739-120421761 GGCTCAGAGAGGAGAAATGAAGG + Intergenic
1103573105 12:121857780-121857802 AGGTCACAGAGTGGAAGTGGAGG + Exonic
1103721009 12:122975415-122975437 TGGGCAGAGAGGGGTAGTGGAGG + Intronic
1104465600 12:128987815-128987837 GAATCAGAGAGGGGAAGTGAGGG - Intergenic
1104702663 12:130918778-130918800 CACTCAGAGAAGGGAGCTGGTGG + Intergenic
1106553133 13:30788467-30788489 TTCTCAGAGAGGGGCATTGGAGG + Intergenic
1107904662 13:45050969-45050991 CGCCCAGAGAGAGGAAGAGCAGG - Intergenic
1109337742 13:61013991-61014013 TGCTCAGAGGGAGGAAGTGAAGG - Intergenic
1111979449 13:95001795-95001817 TGCTCAGAGAGGAGCAGTAGGGG - Intergenic
1112290573 13:98142250-98142272 CGCTTAGAGAGAGGGACTGGAGG + Intergenic
1112739536 13:102457410-102457432 CGTTTAGAGAGGGGACATGGAGG + Intergenic
1113037901 13:106071133-106071155 CACTCAGAGAAGGGACGAGGAGG + Intergenic
1113791581 13:113031629-113031651 CCCTCAGAGAAGGGACGAGGTGG + Intronic
1113939205 13:114009869-114009891 CGCTCTGAGGTGGGAAGAGGGGG + Intronic
1114549487 14:23524808-23524830 GGCAGAGAGAGGGGAAGAGGAGG - Exonic
1117701200 14:58415209-58415231 TGCTCCATGAGGGGAAGTGGTGG - Intronic
1118918998 14:70132897-70132919 AGCAGAGAGAGGGGAATTGGTGG - Intronic
1120949038 14:90024034-90024056 GGCCCAGGGAGGTGAAGTGGGGG - Intronic
1121112411 14:91321344-91321366 GGGGCAGAGAGTGGAAGTGGAGG - Intronic
1121190711 14:92026941-92026963 GATTCTGAGAGGGGAAGTGGAGG - Intronic
1121329786 14:93042657-93042679 CGCTCAGAGGGAGAAACTGGTGG + Intronic
1121645991 14:95517088-95517110 CCCTCACAGAGCGGAGGTGGGGG + Exonic
1121735847 14:96217636-96217658 GGTTCAGAGAGGTGAAGTGGGGG + Intronic
1122031887 14:98918392-98918414 CTCTCAGAGTGGGGAAATTGAGG + Intergenic
1122116251 14:99528651-99528673 AGCTCAGAGAGGCCAGGTGGGGG + Intronic
1122301085 14:100731545-100731567 CCATCAAAGAGGGGCAGTGGGGG - Intronic
1122623583 14:103073244-103073266 GGCTCAGACAAGGGAGGTGGTGG - Intergenic
1123628153 15:22241709-22241731 GGCTCAGAGAGGTGAAGCGAGGG + Intergenic
1124617499 15:31252224-31252246 GGCTCAGAGACTTGAAGTGGTGG + Intergenic
1125198510 15:37076529-37076551 GACTCAGGGAGGGGAAGTGAGGG - Intronic
1127387375 15:58477435-58477457 CACTGAGAGAGGGGAAGTGTGGG + Intronic
1128087180 15:64894403-64894425 GGCTCCGCGAGGGGATGTGGCGG + Intronic
1128143196 15:65316594-65316616 GGCTCCGAGAAGGGAGGTGGTGG - Intergenic
1128309317 15:66620680-66620702 TGCACAGAGAGGGGAAGCTGAGG + Intronic
1128346984 15:66860500-66860522 GGCACAGAGAGGTTAAGTGGTGG - Intergenic
1128529265 15:68432665-68432687 GGCTCAGGGAGTGGCAGTGGAGG - Intergenic
1128729918 15:70014147-70014169 GCCTCAGGGAGGGGAACTGGAGG - Intergenic
1129692745 15:77723059-77723081 AGCTCAGAGAGGGAAAGCGATGG - Intronic
1130258099 15:82335107-82335129 CGGGCAGAGAGGGGAAGAGCAGG + Intergenic
1130596832 15:85254855-85254877 CGGGCAGAGAGGGGAAGAGCAGG - Intergenic
1130935823 15:88469488-88469510 CGGTTGGAAAGGGGAAGTGGGGG + Intronic
1132519625 16:381388-381410 CGCCCGGCGCGGGGAAGTGGAGG - Intronic
1133311027 16:4847102-4847124 CGCGGAGAGAGGGGAAGAGAAGG - Intronic
1133752329 16:8734503-8734525 GGCACAGAGAGGTTAAGTGGTGG - Intronic
1133890280 16:9872775-9872797 CACTTAGAGAGGCCAAGTGGAGG + Intronic
1134023308 16:10936793-10936815 GGCACAGAATGGGGAAGTGGAGG - Intronic
1135412808 16:22247933-22247955 GGCCCAGGGAGGGGAGGTGGTGG - Intronic
1136080811 16:27851557-27851579 AGCTGAGAGTGGGGAAGTGGGGG + Intronic
1137785535 16:51134672-51134694 CGCCCAGCGATGGGAAGTTGTGG + Intergenic
1138084103 16:54118175-54118197 TGCTGAGAGATGGGAAGTGCTGG + Exonic
1138491746 16:57381138-57381160 GGCTCAGAGAGGTGAAGTAAAGG - Intronic
1139310741 16:66025996-66026018 GGCAGAGAGAGGGAAAGTGGGGG + Intergenic
1139467858 16:67163858-67163880 CGCTCTGAGAGGGAACGGGGGGG + Exonic
1139699348 16:68698108-68698130 GGCTCACAGAGAGGAAATGGAGG + Intronic
1140471614 16:75218684-75218706 TGTTCCCAGAGGGGAAGTGGAGG - Intergenic
1141214631 16:82011671-82011693 CGCACAGACAGGGGACGTGGGGG - Intergenic
1141631166 16:85288837-85288859 CCCTGAGAGAGAGGGAGTGGGGG + Intergenic
1141660637 16:85439306-85439328 TGGCCAGAGAGGGGCAGTGGGGG + Intergenic
1141715935 16:85726905-85726927 GGCACAGAGCGGGGAAGGGGTGG - Intronic
1142149727 16:88507325-88507347 AGCTCAGAGATGGGAAGCTGAGG + Intronic
1142354186 16:89594357-89594379 GGCTCAGAGAGGGGGAGATGGGG + Intronic
1142995987 17:3760819-3760841 GGCTCAGAGAGTGGTAGTGATGG - Intronic
1144794807 17:17883848-17883870 TTCTCAGAGATGGGCAGTGGGGG + Intronic
1146987513 17:37234540-37234562 TGGTCAGAGAGGGGGAGTGCTGG + Intronic
1147462541 17:40582618-40582640 CTCTCTGAGGGGAGAAGTGGGGG + Intergenic
1148551410 17:48552579-48552601 GGGGCAGAGAGGGGAGGTGGGGG - Exonic
1149610795 17:57956374-57956396 CGCTCAGAGGAGGGGAGAGGGGG - Intergenic
1150567175 17:66351940-66351962 CCCTAAGAGCAGGGAAGTGGAGG - Intronic
1151421263 17:73999459-73999481 CACTCAGAGAAGGGAACAGGAGG - Intergenic
1151986862 17:77549160-77549182 GGCTCAGAAAGGGGAAGTCTTGG - Intergenic
1152533710 17:80938037-80938059 AGCTCAGATTAGGGAAGTGGCGG + Intronic
1153442297 18:5133358-5133380 CTCTGAGATAGTGGAAGTGGTGG + Intergenic
1153515450 18:5896371-5896393 GAATCAGAGAGGGGAGGTGGGGG + Intergenic
1154940701 18:21111046-21111068 CCCTCAGTGAGGGGAAGACGGGG - Exonic
1157319626 18:46624223-46624245 CTCTCAGTGAGCGGAAGTGAGGG - Intronic
1157794454 18:50560769-50560791 CCCTGGGAGAGGGGGAGTGGGGG + Intronic
1158125305 18:54094179-54094201 CGCTCAAACAGGGTAGGTGGAGG - Intergenic
1158557880 18:58490336-58490358 GGCCCAGGGAGGGGCAGTGGTGG - Intronic
1160749237 19:726218-726240 TGGTCAGGGTGGGGAAGTGGGGG + Intronic
1160819242 19:1050008-1050030 AGCTCACAGGGAGGAAGTGGTGG - Intronic
1161095466 19:2387893-2387915 AGCTCACAGAGGGGCAGGGGAGG + Intergenic
1161319881 19:3636247-3636269 TGGGCAGACAGGGGAAGTGGGGG + Intronic
1162018491 19:7858086-7858108 GGCCCAGAGAGTGGAGGTGGGGG - Intronic
1162479886 19:10921932-10921954 CGCTCAGGGCCGGGAGGTGGGGG - Exonic
1162798369 19:13098134-13098156 CGGTCAGGGTGGGGGAGTGGTGG - Intronic
1163513792 19:17751138-17751160 CGCTCAGAAAGGGGAAGACATGG - Intronic
1164667926 19:30053684-30053706 CGCTGAGAGGGAGGAGGTGGTGG + Intergenic
1164969414 19:32518483-32518505 TGCAAAGAGAAGGGAAGTGGAGG - Intergenic
1165993456 19:39828621-39828643 GGCTCAGAGAGGGCAGGTGGTGG + Intronic
1166148153 19:40851151-40851173 CAATCAGAGATGGGCAGTGGAGG - Intronic
1166164667 19:40978896-40978918 GGCTCAGTGAGGGGAAATAGGGG + Intergenic
1166707047 19:44913837-44913859 TGCTGAGAGAGGGGAAGTGAGGG + Intergenic
1166709218 19:44926393-44926415 TGCTGAGAGAGGGGAAGTGAGGG + Intergenic
1166913585 19:46178642-46178664 CGTTCAGATAAGGGAAGTTGTGG - Intergenic
1167010463 19:46803669-46803691 CTCTCAGAAAGGAGAAGTGGAGG - Intergenic
925034623 2:676342-676364 CGCTCAAGGAGGGGATGGGGAGG - Intronic
927187498 2:20492279-20492301 CCCTCAGAGAGTGGAAGGGCGGG - Intergenic
927923057 2:26988740-26988762 CCCTCAGAGAGGGACAGTTGTGG - Intronic
930186255 2:48415147-48415169 CGCTCAGAAAGGGAAAGAGGGGG + Intergenic
931114586 2:59150827-59150849 TGCTCAGAGAAAGGAAGAGGTGG - Intergenic
931146439 2:59524760-59524782 TGCTGAGAGATTGGAAGTGGGGG - Intergenic
932403770 2:71500244-71500266 TGCTCAGGGAGGAGAGGTGGGGG - Intronic
932455307 2:71845798-71845820 GGCTTAGACAGGGGTAGTGGTGG + Intergenic
933776873 2:85776454-85776476 CACTCAGAGAGGGTCACTGGAGG + Intronic
934863039 2:97780345-97780367 GGCTCAGGGAGTGGCAGTGGAGG - Intronic
935817954 2:106864923-106864945 CTCTCAGGGAGGGGGAGTGGAGG + Intronic
935939151 2:108220509-108220531 GGCTCAGAGAGATGAAGTGGTGG - Intergenic
937782378 2:125853866-125853888 CTGTCAGAGAGTGGAAATGGTGG - Intergenic
938410429 2:131059286-131059308 AGCTCAGAGAGGGGCAGGTGGGG + Intronic
938422424 2:131155526-131155548 CCCGCAGAGAGCGGAAGTAGCGG - Intronic
940854976 2:158722768-158722790 AGCTCAGAGAGGTGAAGCAGTGG + Intergenic
941469862 2:165871197-165871219 AGCTCAGAGACAGGAAGCGGGGG + Intronic
944662095 2:201929667-201929689 AGCTCAGAGAGGGCAAGTAATGG - Intergenic
947546793 2:231016038-231016060 GGCACAGACAGGGAAAGTGGGGG - Intronic
947584184 2:231342446-231342468 CGCTGACAGTGGGGAAGTGGAGG + Intronic
947874530 2:233459519-233459541 TGCTCAGTGAGGGGATGGGGCGG + Intronic
949003024 2:241628223-241628245 CGCTGAGAGAGGGGCAGCCGAGG - Intronic
1168961382 20:1872347-1872369 GGCTCAGAGAGGCAAAGTGATGG - Intergenic
1169205255 20:3736225-3736247 AGCACAGAGAGGGGGAGGGGAGG - Intronic
1169405928 20:5321253-5321275 CCCTCAGAGAGAGGCGGTGGTGG + Intergenic
1169570288 20:6898794-6898816 TGCCCAGGGAGGGGAAGTGCTGG - Intergenic
1170036485 20:11995451-11995473 AGGGCAGAGAGGTGAAGTGGAGG - Intergenic
1170800192 20:19584283-19584305 GGATCAGAGAGTGGGAGTGGGGG - Intronic
1171907864 20:30915171-30915193 AGGTCAGAGAGGGGACCTGGAGG + Intergenic
1172765778 20:37350035-37350057 GGCCCAGAGCAGGGAAGTGGTGG - Intronic
1172773342 20:37393888-37393910 TGCTCAGAGAGGGAGACTGGTGG + Exonic
1172845553 20:37928012-37928034 CACTGGAAGAGGGGAAGTGGAGG + Intronic
1173303849 20:41829136-41829158 CGCTCAGCGAGTGGAAGGGAGGG - Intergenic
1173751425 20:45479845-45479867 AGCCCAGTGAGGGGCAGTGGGGG + Intronic
1173851642 20:46222329-46222351 GGCTGTGAGAGGGGCAGTGGAGG - Intronic
1173852809 20:46229351-46229373 GGCACAGAGTGAGGAAGTGGTGG + Intronic
1173868975 20:46330181-46330203 CGCACAGGGAGGGGCAGAGGGGG - Intergenic
1174291636 20:49513115-49513137 GGCTCAGGAAGGGGAAGAGGAGG + Exonic
1175173166 20:57093747-57093769 CGCTCTGAGAGGCGAAGATGGGG - Intergenic
1176074341 20:63241672-63241694 GGCACAGAGAGAGGCAGTGGGGG - Intronic
1178121475 21:29474227-29474249 CTGTCAGCCAGGGGAAGTGGTGG + Intronic
1178383985 21:32134712-32134734 GGCTCAGAGAGGGGATGGGGAGG - Intergenic
1179171564 21:38976919-38976941 AGCTCAGAGATGGGTTGTGGTGG + Intergenic
1180683914 22:17649952-17649974 CGCTCAGAGCAGGGAGGCGGAGG - Intronic
1181122836 22:20683652-20683674 GGCTGAGAGAGGATAAGTGGAGG - Intergenic
1181179589 22:21057437-21057459 GGCTGAGAGAGGATAAGTGGAGG + Intronic
1181785629 22:25224713-25224735 CGCTCAGAGAGGAGAAATGCAGG + Intronic
1183163480 22:36130508-36130530 CGCTCAGACAGGGGAGCTGTGGG - Intergenic
1183165888 22:36147251-36147273 CGCTCTCAGATGGGCAGTGGAGG + Intronic
1183335763 22:37244941-37244963 GGCACATTGAGGGGAAGTGGCGG + Intergenic
949585383 3:5431915-5431937 GGTTCAGAAAGGGGATGTGGGGG - Intergenic
950473842 3:13203657-13203679 CGCGCACAGAGAGGACGTGGTGG + Intergenic
950609958 3:14120115-14120137 TGGTCAGAGTGGGGAACTGGAGG + Intronic
950663192 3:14479649-14479671 AGCTTAGAGAGGGGAAGTCCTGG + Intronic
953798840 3:46005928-46005950 TGCTGACAGAGGGGCAGTGGTGG - Intergenic
954212255 3:49104504-49104526 CGCTCAGTGAGAGGAAAGGGCGG + Intronic
954835591 3:53464557-53464579 AGCCAACAGAGGGGAAGTGGGGG - Intergenic
956700012 3:71950669-71950691 GGCTCAGAGAGGTGAAGTGGAGG - Intergenic
960823163 3:121755917-121755939 TGCTGAGAGGTGGGAAGTGGGGG + Intergenic
961041140 3:123679338-123679360 TGCCCAGAGATGGGAAGTGAAGG - Intronic
962637446 3:137345597-137345619 GGCTGAGAGAGGAGAAGGGGTGG + Intergenic
963870238 3:150408524-150408546 CTCTCAGAGAGGGGCGGCGGCGG - Exonic
964708691 3:159648168-159648190 CTTTCAGAGAAGGGAAGTTGAGG - Intronic
966169594 3:177063838-177063860 ACCTCAGAGAGGGGCAGTGATGG + Intronic
967229948 3:187328193-187328215 GGCTCAGGAAGGAGAAGTGGTGG - Intergenic
969197454 4:5574293-5574315 CACTCAGAGAGGTGTAGTGTGGG + Intronic
969718576 4:8880507-8880529 GGCTCGGAGAGGCCAAGTGGAGG - Intergenic
970650732 4:18174914-18174936 AGGTCAGGGAGGGGAAGAGGTGG + Intergenic
970920430 4:21387957-21387979 AGCTCAGAGAGGGGAATGAGTGG + Intronic
972425699 4:38930483-38930505 TGCTCAGAGGGGGCATGTGGTGG + Intronic
976634109 4:87270613-87270635 GGCTAAGAGAGGTGAAATGGTGG - Intergenic
979354003 4:119681056-119681078 CGCTCGGACCCGGGAAGTGGAGG + Intergenic
980108846 4:128615240-128615262 TGCTCAGGTAGGGGCAGTGGTGG - Intergenic
982374330 4:154672978-154673000 GGCTTAGAGAGGTGAAGTGGGGG + Intronic
982603372 4:157481689-157481711 AGCTCAGAGAGAGGAATTGTAGG + Intergenic
985412040 4:189695664-189695686 GGCTCATAGTGCGGAAGTGGCGG - Intergenic
985869007 5:2539000-2539022 CCCTCACACAGGAGAAGTGGTGG + Intergenic
985891353 5:2717579-2717601 AGCTCAAAGAGGGAAAGGGGAGG - Intergenic
985995044 5:3593104-3593126 CCATCAGAGAGGGGGAGGGGCGG - Intergenic
990456689 5:55995252-55995274 CGCCCACAGAGGGGAGGTGGGGG - Intergenic
990820978 5:59840038-59840060 TGCTCAGAGGGGGAAAGTGTTGG - Intronic
995250175 5:109984194-109984216 CGCGCAGGCAGGGGTAGTGGTGG + Intergenic
996738582 5:126778367-126778389 CGGGCAGAGAGAGGAAGGGGAGG + Intronic
997381944 5:133444621-133444643 GGCTCAGAGAGGGGAAGCCAGGG - Intronic
997715070 5:136036486-136036508 AACTCAGAGAGAGGAAGAGGTGG + Intronic
998681455 5:144472321-144472343 TGTTCAGAGGGTGGAAGTGGAGG + Intronic
999008967 5:148014061-148014083 CGCTCTGAGAAGCCAAGTGGAGG + Intergenic
999085230 5:148882444-148882466 GGCTCATAAAGGGGAAGTGCAGG + Intergenic
999245629 5:150153067-150153089 AGCCCAGAGATGGGATGTGGGGG + Intronic
999467523 5:151821870-151821892 GGCTCAGAGAGGGGCAATTGTGG + Intergenic
1000023355 5:157337967-157337989 CATTCAGAGAGGGGAAATTGAGG - Intronic
1000370772 5:160534274-160534296 AGCCCAGAGAGGGAAAGTGATGG + Intergenic
1001490157 5:172149364-172149386 GGCTCAGGGAGGGAAAGTGGGGG - Intronic
1002108762 5:176893980-176894002 TGCTCAGAGAGGTGAGGTGATGG - Intronic
1002704522 5:181151270-181151292 AGCTGCGGGAGGGGAAGTGGGGG + Intergenic
1002772607 6:302538-302560 AGCTCACACAGGGAAAGTGGAGG - Intronic
1003366023 6:5475817-5475839 GACACAGAGAGGGGAATTGGAGG - Intronic
1003392791 6:5727932-5727954 CGCTGTTAGAGGGGAAGTGTTGG + Intronic
1003889962 6:10555479-10555501 TGCTCAGACAGGGGATTTGGTGG - Intronic
1004549576 6:16633586-16633608 ACCTCAGGGAGGGGAGGTGGCGG - Intronic
1005959892 6:30687156-30687178 CGTCCAGAGAGAGGAAGAGGAGG + Exonic
1006456459 6:34134730-34134752 CTCTCAGAGGGAGGAAGTGGGGG - Intronic
1007502516 6:42309342-42309364 GGCTCAGAGAGGCGAAGTAAAGG + Intronic
1007605564 6:43115633-43115655 CCTTCAGAAAGGGGCAGTGGGGG + Intronic
1007718189 6:43869528-43869550 CCCTCAGAGAGGGGAGGGGAGGG - Intergenic
1007782889 6:44264401-44264423 TGCTAAGAAAGGGGAAGTGAGGG - Intronic
1009971085 6:70626500-70626522 GGCTTAGAGAGGGTAAGTGTGGG + Intergenic
1010072671 6:71762239-71762261 TGTTCATAGAGGGGAAGTTGGGG + Intergenic
1013427986 6:110032512-110032534 CCCTGAGAGAGGGGAGGAGGTGG + Intergenic
1014094664 6:117446854-117446876 CGCTCAGGGAGGGAAGGGGGTGG - Intronic
1014493807 6:122094313-122094335 GCCTCAGAAAGGGGAGGTGGAGG + Intergenic
1017526088 6:155242429-155242451 CGCTCAGAGAAGGGAGATGATGG - Intronic
1017542849 6:155421000-155421022 AGCTCAGAGAGGTGAACTGCAGG + Intronic
1018649414 6:165979714-165979736 CTCTCAAAGAGTGGGAGTGGTGG - Intronic
1018741660 6:166733721-166733743 CACTCTAAGTGGGGAAGTGGAGG + Intronic
1019699295 7:2466074-2466096 CACTCAGGGAGAGGGAGTGGGGG - Intergenic
1021798743 7:24284079-24284101 CACTCAGGGGCGGGAAGTGGCGG + Intergenic
1022202679 7:28132844-28132866 GGCTCAGAGATGGGTAGGGGTGG - Intronic
1022471224 7:30682830-30682852 CGCTCAGGGAGGGGAAGCTCAGG - Intronic
1023995251 7:45155796-45155818 GGCACAGAGAGGAGAAGTGAGGG + Intergenic
1024007793 7:45240308-45240330 CGCCCAGTGAGGGGTAGTGGCGG - Intergenic
1024254745 7:47532137-47532159 CGCTCTGAGATGAGAGGTGGGGG - Intronic
1026099007 7:67369232-67369254 CACTGAGAGAGGGGAAGGGCTGG + Intergenic
1026212513 7:68318339-68318361 CTGTCAGGGAGGGGGAGTGGTGG + Intergenic
1026807682 7:73438123-73438145 AGCGCAGAGAGGGGCAGTGCAGG + Intergenic
1027420236 7:78011587-78011609 TGCTAACAGAGGGGCAGTGGTGG - Intergenic
1029147735 7:98458689-98458711 AGCTCAGAGAGGGAAGGCGGTGG - Intergenic
1029556789 7:101275948-101275970 AGATCAGAGACTGGAAGTGGGGG + Intergenic
1030106319 7:105990405-105990427 AGCTCAGAGGTGGGACGTGGAGG - Intronic
1030267128 7:107632011-107632033 CAGTTAGAGTGGGGAAGTGGTGG + Intergenic
1031765378 7:125770974-125770996 TGCTGACAAAGGGGAAGTGGTGG + Intergenic
1031967876 7:128041096-128041118 TGCTCAAAGATGGGAAGGGGTGG - Intronic
1032371361 7:131356513-131356535 TGCTGACAGAGGGGCAGTGGTGG + Intronic
1032394845 7:131581893-131581915 CACTCAGAGAGGGAAAGGAGAGG + Intergenic
1032550335 7:132778767-132778789 CGCTCAGGGAGGGGGAATAGAGG - Intergenic
1032921066 7:136548740-136548762 AGCTCAGAGAGGGTAAGAGTTGG + Intergenic
1034289218 7:149914961-149914983 CGCTCAAACATGGGAGGTGGAGG - Intergenic
1034294390 7:149959096-149959118 CCCTGTGAGAGGAGAAGTGGAGG + Intergenic
1034338371 7:150337685-150337707 GGGGCAGAGAGGGGAACTGGGGG - Exonic
1034661855 7:152777864-152777886 CGCTCAAACATGGGAGGTGGAGG + Intronic
1034811679 7:154137776-154137798 CCCTGTGAGAGGAGAAGTGGAGG - Intronic
1036678236 8:10852141-10852163 CGCGCAGGGAGGGGAAGGGGAGG + Intergenic
1040877474 8:52168176-52168198 CCCTCAGAGAGGGGCAATGCAGG + Intronic
1041871032 8:62634620-62634642 TTCTCAGAGATGGGAAGAGGTGG + Intronic
1042879808 8:73474533-73474555 TGCTCAGAGATAGAAAGTGGTGG - Intronic
1042952899 8:74219923-74219945 GTCCCAGTGAGGGGAAGTGGTGG + Intergenic
1042988127 8:74606018-74606040 GGTTCAGAAAGGGGAGGTGGGGG + Intronic
1045482053 8:102600671-102600693 GGCTGAGAGACGGGAAGAGGTGG - Intergenic
1046547476 8:115669256-115669278 CGTTCACAGACGGGAGGTGGGGG - Intronic
1046967271 8:120181729-120181751 TGCTCAGAGAGCAGAAGTGAGGG - Intronic
1047718786 8:127619806-127619828 GGCTGAGAGAGGGTAAGGGGAGG - Intergenic
1048988046 8:139745804-139745826 AGCTCAGAGAGGTGAAGTCTTGG - Intronic
1049940805 9:544617-544639 CGCTCTGATAGGGGAAGTACGGG + Intronic
1050651247 9:7779153-7779175 GACTCAGAGGGTGGAAGTGGAGG + Intergenic
1051515832 9:17929545-17929567 AGCTGAGTGAGGGGAAGAGGAGG - Intergenic
1052026166 9:23575892-23575914 CAATCAGACAGGGGGAGTGGGGG - Intergenic
1052977370 9:34421184-34421206 AGGTCAGAGAGGGGAAGGGGAGG + Intronic
1055497734 9:76872216-76872238 AGCTCAGGGAGGGGATGCGGTGG - Intronic
1056823316 9:89859763-89859785 CTCTCAGAGAGGCCAGGTGGTGG - Intergenic
1056928785 9:90857710-90857732 AGCTGGGAGAGGGGAAGAGGAGG - Intronic
1058347294 9:103979404-103979426 TAATCAGAGAGGGGAAGAGGGGG + Intergenic
1059765804 9:117382749-117382771 AGCACAGAGAGAGGCAGTGGTGG + Intronic
1060273901 9:122167641-122167663 CTCTCAGGGAGGTGAAGTCGTGG - Intronic
1060698341 9:125729359-125729381 CGGTTGGAGAGGGGAAGTGACGG - Intergenic
1060884864 9:127144015-127144037 GGCTCAAAGAGGGGATCTGGGGG - Intronic
1061039638 9:128132520-128132542 CTCTCAGAGAGGCCAGGTGGTGG + Intergenic
1061889118 9:133608537-133608559 ATCACAGAGTGGGGAAGTGGTGG - Intergenic
1062018064 9:134301702-134301724 CCCTCACAGAGAGGAACTGGAGG - Intergenic
1062319581 9:135984218-135984240 CGCTAAGAGGCGGGAACTGGAGG + Intergenic
1062590614 9:137272909-137272931 CCCTCAGAGCGGGGCAGGGGCGG - Exonic
1203670554 Un_KI270755v1:7317-7339 GGCTCATAGTGCGGAAGTGGCGG + Intergenic
1189163790 X:38838716-38838738 CCCTCAGAGAGGGGAAGGTAAGG + Intergenic
1194496103 X:94619115-94619137 TGCTCAGAGGAGGGAAGGGGAGG + Intergenic
1195063661 X:101219958-101219980 AGCTCTGAGAGGGGAGGAGGAGG + Exonic
1196156832 X:112439437-112439459 GACTCAGAGAGGGCAAGTGATGG - Intergenic
1197745172 X:129927985-129928007 GGCTTAGAGGGGGGAAGTGATGG - Intronic
1197753243 X:129979903-129979925 CGCCCAGGGTGGGGAAGTGGGGG + Intergenic
1198637305 X:138713660-138713682 CTATCTGAGAGGAGAAGTGGAGG - Intronic
1200213458 X:154357033-154357055 GGCCCAGAGAGGGGAAGAGCTGG + Intronic