ID: 903189007

View in Genome Browser
Species Human (GRCh38)
Location 1:21646027-21646049
Sequence TGACGCTCAGAGAGGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1079
Summary {0: 1, 1: 8, 2: 50, 3: 242, 4: 778}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189007_903189013 0 Left 903189007 1:21646027-21646049 CCACTTCCCCTCTCTGAGCGTCA 0: 1
1: 8
2: 50
3: 242
4: 778
Right 903189013 1:21646050-21646072 GTTCCCTCATCTGTAAAATGGGG 0: 23
1: 594
2: 2828
3: 6721
4: 11858
903189007_903189016 4 Left 903189007 1:21646027-21646049 CCACTTCCCCTCTCTGAGCGTCA 0: 1
1: 8
2: 50
3: 242
4: 778
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189007_903189011 -2 Left 903189007 1:21646027-21646049 CCACTTCCCCTCTCTGAGCGTCA 0: 1
1: 8
2: 50
3: 242
4: 778
Right 903189011 1:21646048-21646070 CAGTTCCCTCATCTGTAAAATGG 0: 37
1: 931
2: 4071
3: 9755
4: 16832
903189007_903189017 16 Left 903189007 1:21646027-21646049 CCACTTCCCCTCTCTGAGCGTCA 0: 1
1: 8
2: 50
3: 242
4: 778
Right 903189017 1:21646066-21646088 AATGGGGATGGACAGTAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 172
903189007_903189012 -1 Left 903189007 1:21646027-21646049 CCACTTCCCCTCTCTGAGCGTCA 0: 1
1: 8
2: 50
3: 242
4: 778
Right 903189012 1:21646049-21646071 AGTTCCCTCATCTGTAAAATGGG 0: 30
1: 766
2: 3523
3: 8849
4: 15187
903189007_903189018 17 Left 903189007 1:21646027-21646049 CCACTTCCCCTCTCTGAGCGTCA 0: 1
1: 8
2: 50
3: 242
4: 778
Right 903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189007 Original CRISPR TGACGCTCAGAGAGGGGAAG TGG (reversed) Intronic
900922152 1:5679784-5679806 TGAAGCTCTGAGAGGGTAAGAGG - Intergenic
901066260 1:6496154-6496176 TGAGGCTTAGCCAGGGGAAGTGG - Intronic
901240696 1:7691467-7691489 GGAGGCTCAGAGAGGGTGAGGGG + Intronic
901736232 1:11313855-11313877 TGAGGCACAGGGAGGGTAAGTGG + Intergenic
901758757 1:11457212-11457234 AGCAGCTCAGAGAGGTGAAGAGG + Intergenic
901786716 1:11629688-11629710 GGAAGCTGAGAGAGGGGAGGAGG - Intergenic
901790547 1:11651548-11651570 TGAGGCACAGAGAGGTGAAACGG + Intronic
901812370 1:11775310-11775332 GGAGGCTCAGAGAGATGAAGTGG + Intronic
901863208 1:12087858-12087880 TGGGCCTTAGAGAGGGGAAGTGG - Intronic
902179397 1:14676416-14676438 TGAGGCTCAGGGACGTGAAGTGG - Intronic
902374622 1:16024527-16024549 TGAGGCTCAGAGAGGCTGAGTGG + Intronic
902375498 1:16028354-16028376 TGAGGCTCAGTGAGGGGGTGGGG - Intronic
902379566 1:16046299-16046321 TGAGGCTCAGAGAGGCTGAGTGG + Intronic
902386044 1:16076506-16076528 TGGCACTCAGAGAGGGGCAGGGG + Intergenic
902554505 1:17239008-17239030 TGAGGCTCAGAAAGGTGAATTGG + Intronic
902613986 1:17613850-17613872 CGAGGCTCAGAGAGGCCAAGGGG - Intronic
902665541 1:17935170-17935192 TGAGGCCCAGAGAGGTGAAGTGG + Intergenic
902710858 1:18238842-18238864 TGGAGCTCAGAGAGGGGTTGTGG - Intronic
902752586 1:18527699-18527721 TGAGGCACAGAGAGGTGAAGCGG - Intergenic
902797128 1:18807213-18807235 TGAGGCACAGCCAGGGGAAGAGG + Intergenic
902809766 1:18881536-18881558 GGAAGCTCAGAGAGGTGAAGTGG + Intronic
902834838 1:19040358-19040380 TGAGGCTCAGAGAGGATAAGGGG + Intergenic
902936375 1:19767759-19767781 TGAGGCCCAGAGAGGGGAAGGGG - Intronic
903021671 1:20399502-20399524 TGAGGCTCAGAGAGGGTCCGTGG - Intergenic
903134693 1:21301956-21301978 TGAGGCTCAGAGAGGTGACATGG + Intronic
903164863 1:21513211-21513233 TGAGGCCCAGAGAGGAGAAGAGG + Intronic
903189007 1:21646027-21646049 TGACGCTCAGAGAGGGGAAGTGG - Intronic
903283189 1:22261822-22261844 TGAAGCTCAGAGAGGGGCAGAGG - Intergenic
903326212 1:22570003-22570025 TGAGACTCAGAGAGGTGAAATGG - Intronic
903361435 1:22779713-22779735 TGAAGCACAGGGATGGGAAGGGG - Intronic
903459931 1:23513779-23513801 TGAAGCCCAGAGAGGAGCAGAGG - Intronic
903603719 1:24559799-24559821 TGAGGCTCAGAGAGGTGATGTGG - Intronic
903653514 1:24935058-24935080 TGAGGCCCAGAAAGGGGAAAGGG + Intronic
903680913 1:25096174-25096196 TGAGCCTCACAGAGGGCAAGTGG + Intergenic
903758963 1:25684505-25684527 TGAGGCCCAGAGATGAGAAGTGG - Intronic
903760154 1:25692067-25692089 CAAGGCTCAGAGAGGGGAAAGGG + Intronic
903859628 1:26356961-26356983 TGAGGCCCAGAGAGGTGAAATGG + Intergenic
903950061 1:26991513-26991535 GGAGACTCAGTGAGGGGAAGGGG - Intergenic
903968747 1:27105723-27105745 TGAGGCCCAGAAAGGGGGAGTGG + Intronic
904111183 1:28127789-28127811 TGATACTAAGAAAGGGGAAGTGG + Intergenic
904210569 1:28884420-28884442 TGAGGCTCAGAGAGCTAAAGTGG - Intergenic
904271644 1:29354135-29354157 TGAGGTCCAGAGAGGGGGAGTGG - Intergenic
904280467 1:29415053-29415075 TGAGGCCCAGAAAGGGCAAGGGG - Intergenic
904299877 1:29547363-29547385 TGAGGCTCAGAGAGGGAAAGTGG - Intergenic
904405399 1:30285120-30285142 TGAGGCTCAGAGAGGAAAAGTGG + Intergenic
904431937 1:30469998-30470020 GGAGGCCCAGAGAGGGCAAGGGG - Intergenic
904538248 1:31215483-31215505 TGAGGCTCAGACAGGTGTAGGGG + Intronic
904601307 1:31674112-31674134 TGCCGTTCAGAGCAGGGAAGGGG + Intronic
904623087 1:31787289-31787311 TGAGGCTCAGAAAGGGCAAGGGG + Intergenic
904868941 1:33604499-33604521 TGAAGCTTAGAGAGGCAAAGGGG + Intronic
905004433 1:34698529-34698551 TGAGGATCTGAGAGGGGAACAGG - Intergenic
905213281 1:36389176-36389198 TGAGGCTCAGAGAGGGAAAGGGG - Intergenic
905241629 1:36585380-36585402 TGAGGATCAGAGAGGTGAATTGG + Intergenic
905416403 1:37807696-37807718 TGAGGCGCAGAGAGCGGGAGGGG - Intronic
905881426 1:41466675-41466697 TGAAGCTCAGAGAGGTTAAAGGG + Intergenic
905885998 1:41492309-41492331 TGATGCTCAGACAGGAGAAGGGG - Intergenic
905931127 1:41788378-41788400 ATAGGCTCAGAGAGGCGAAGTGG + Intronic
906065101 1:42975033-42975055 AGAAGCCCAGGGAGGGGAAGAGG + Intergenic
906530364 1:46520311-46520333 TGTCGCTCTGAGAGGGGACCTGG + Intergenic
906804572 1:48768006-48768028 TGAGGCTCAAAGAAGTGAAGTGG + Intronic
906948785 1:50317744-50317766 TGAGGCCCAGAGAGGAAAAGGGG + Intergenic
907237652 1:53062789-53062811 TGAGGCCCAGAGAGGGGCAGAGG + Intronic
907271211 1:53292339-53292361 TGAGGCCCAGAAAGGGAAAGGGG + Intronic
907273917 1:53306537-53306559 TGAGGCCCAGAGAGGGGGAGTGG - Intronic
907317013 1:53578893-53578915 TGAAGCCCAGAGAAGGGAAGGGG + Intronic
907412461 1:54292369-54292391 TGGGGCTCTGAGAAGGGAAGGGG - Intronic
907567240 1:55446794-55446816 TGAGGCTCAGAGGGGAGAAGAGG + Intergenic
907583143 1:55590208-55590230 TGAAGCTCAGAGGGGTGAAGGGG - Intergenic
907612387 1:55885551-55885573 TGAAGCCCAGAAAGGGGAAATGG - Intergenic
907710168 1:56873394-56873416 AGAAGCTCAGAAAAGGGAAGTGG + Intronic
907844499 1:58191508-58191530 TGAGGCCGAGAGAGGGGAACAGG + Intronic
907908998 1:58810771-58810793 TGAGACTCAGAGATGTGAAGTGG - Intergenic
908480797 1:64537061-64537083 TGACCCTCACAGAGGGCAACAGG - Intronic
908501322 1:64745624-64745646 TGAGGCTCTGAGTGGCGAAGCGG + Intronic
908572965 1:65428379-65428401 GGAGACACAGAGAGGGGAAGGGG - Intronic
908649023 1:66311875-66311897 CGGTGCTCAGAGCGGGGAAGTGG - Intronic
908793597 1:67808478-67808500 AGACACACAGATAGGGGAAGAGG + Intronic
909717850 1:78731443-78731465 TGAGGCTCAGAGAGGTTAAATGG + Intergenic
910286765 1:85564410-85564432 TGAAGTGCAGAGAGGGGTAGTGG + Intronic
910452643 1:87362680-87362702 AGAAGGTCAGAGAGGTGAAGTGG - Intergenic
911330347 1:96519400-96519422 TGAAACCCAGAGAGGGTAAGTGG - Intergenic
911334590 1:96566246-96566268 GGAGGCTCAGAGAGGTTAAGTGG - Intergenic
911380595 1:97109036-97109058 TGAGGCTTACAGAGGGCAAGTGG - Intronic
911757513 1:101576267-101576289 TGAGTCACAGAGAGGTGAAGTGG - Intergenic
912674461 1:111664576-111664598 TGAAGCCCAGGGAGAGGAAGGGG - Intronic
913178875 1:116299895-116299917 TGAAGCTGAGAGAAAGGAAGGGG - Intergenic
913225588 1:116695502-116695524 AGAGGCCCAGAGAGGTGAAGTGG + Intronic
913314782 1:117540662-117540684 TGAGCCTCAGAGAGGCTAAGGGG + Intergenic
914887322 1:151596034-151596056 CGAGACTCAGAGAGGTGAAGGGG - Intergenic
914990825 1:152498255-152498277 TGAGGTTCAGAGAGGAGAATTGG - Intergenic
915294818 1:154912492-154912514 TGAGGCTCAGAGAGGGGAAGTGG - Intergenic
915512656 1:156394845-156394867 TGAGGTTCGGAGAGGGGACGTGG + Intergenic
915522529 1:156456246-156456268 TGACGCTCAGGAAGGTGAAGGGG - Intergenic
915543421 1:156582743-156582765 TGAAGCTCGGAGAGTGAAAGTGG - Intronic
915561828 1:156692325-156692347 GGAGGCTCAGGAAGGGGAAGTGG + Intergenic
915718697 1:157967632-157967654 TGAAGCTCAGAGAGGGGCTCAGG + Intergenic
915718704 1:157967666-157967688 TGAAGCTCAGAGAGGGGCTCAGG + Intergenic
915938019 1:160100083-160100105 TGAGGCCCAGAGAGGGTAAGTGG + Intergenic
916057825 1:161080156-161080178 TGAGACCCAGAGAGAGGAAGTGG + Intronic
916059440 1:161088733-161088755 TGATGCCCAGAGAGTGGATGGGG - Intronic
916512520 1:165485073-165485095 TGAAGTCCAGACAGGGGAAGTGG + Intergenic
918357103 1:183715168-183715190 TGAGGCTCAGAGAGGGAAACTGG - Intronic
919283063 1:195517574-195517596 TGAGACACAGAGAGGGAAAGTGG + Intergenic
919489576 1:198188879-198188901 TGATGCTCACAGAGGGTAAGTGG + Intronic
919788211 1:201273745-201273767 TGAGGCTCAGAGAGGGTGTGTGG - Intergenic
919886546 1:201939095-201939117 TGATGAAGAGAGAGGGGAAGGGG - Intronic
920657041 1:207885030-207885052 TAAGGCTCAGAGAAGGGAGGTGG - Intronic
920801644 1:209194049-209194071 TGAGGCCCAGAGAGGGCATGGGG - Intergenic
920966037 1:210701420-210701442 TGAGGCCCAGAGAGGGAGAGTGG + Intronic
921277552 1:213534892-213534914 TGACGCTGAGAGCATGGAAGAGG - Intergenic
921286466 1:213614148-213614170 TGCCTCCCAGAGAGGTGAAGTGG + Intergenic
921767727 1:218992056-218992078 TGAAGCTCAGAGAGGTTAAGTGG - Intergenic
922728692 1:227939053-227939075 TGACAGTCAGAGGTGGGAAGTGG - Intronic
922732608 1:227958940-227958962 AGAGGCTCAGAGGGGTGAAGGGG - Intergenic
922975771 1:229782253-229782275 CGCTGCTCAGAGACGGGAAGGGG + Intergenic
923456997 1:234173374-234173396 AGAGGCCCAGAGAGGGTAAGTGG + Intronic
1063264636 10:4434382-4434404 TGCCTCTGAGAGAGGTGAAGGGG - Intergenic
1063513403 10:6669757-6669779 AGAGGCTCAGAGAGGCTAAGTGG - Intergenic
1065010061 10:21412702-21412724 TGAAGCTCAGAAAAGGGAGGAGG + Intergenic
1065250817 10:23811592-23811614 TGAGGATGAGAAAGGGGAAGGGG + Intronic
1065934746 10:30511362-30511384 TGAGGCTTAGAGAGGTTAAGAGG + Intergenic
1066040468 10:31544164-31544186 TGACCCTCAGTGAAGGAAAGAGG - Intergenic
1066657127 10:37706221-37706243 TGAGGGTCAGAGAAGGGGAGAGG + Intergenic
1067696869 10:48542076-48542098 TGACATCCAGAGAGGGAAAGTGG - Intronic
1067934884 10:50601552-50601574 TGAAGCTCAGAAAGGTTAAGTGG + Intronic
1069309666 10:67018678-67018700 TGAGGCACAGAGAGGTTAAGTGG - Intronic
1069604305 10:69730177-69730199 TGAGGCTGAGAGAGGGAGAGTGG + Intergenic
1069613966 10:69794502-69794524 TGGGACTCAGAGAAGGGAAGTGG - Intergenic
1069677652 10:70260146-70260168 TGAGGCTGAGAGACGAGAAGCGG + Intronic
1069687927 10:70331016-70331038 TGAGGCTCAGAAGGGAGAAGTGG - Intronic
1069826773 10:71259520-71259542 CGAGGCTCAGAGAGGCAAAGTGG + Intronic
1069831159 10:71283230-71283252 TGAGGCTCAGAGAGGGTAGGTGG - Intronic
1069943181 10:71969280-71969302 TGAGGCTCAGAGAGGTGCAGTGG + Intronic
1070751191 10:78965029-78965051 CGAGTCTCAGAGAGGGGAAGGGG - Intergenic
1070823208 10:79375336-79375358 TGAGACTCAGAGAGGGAAGGTGG + Intergenic
1070967270 10:80537141-80537163 TGAAGCTCAGAGAAAGTAAGTGG - Intergenic
1071518990 10:86317308-86317330 TCTTGCTCAGAGTGGGGAAGGGG - Intronic
1071600517 10:86956619-86956641 TGAGGCTCAGAGAGGCTGAGGGG - Intronic
1071776676 10:88796872-88796894 TGAGGCTCGGAGAGGTTAAGTGG + Intergenic
1072449985 10:95532185-95532207 TGAGGCTCAGTGAGGGTTAGTGG - Intronic
1072566251 10:96619077-96619099 TGAGGCTCAGAGAGGCGAAGAGG - Intronic
1072679639 10:97497998-97498020 TGAGGCTCAGCGAGGGCAAGAGG - Intronic
1072853376 10:98921102-98921124 GGAGGATCAGAGAGGGGCAGAGG - Intronic
1073050279 10:100662650-100662672 TGAAGCCCAGAGAGGGAAGGTGG - Intergenic
1073079968 10:100853505-100853527 TGAGGCCCAGAGAGGGGAAGGGG + Intergenic
1073458010 10:103649306-103649328 CGGTGCTCAGAGAGGTGAAGTGG + Intronic
1074198313 10:111208459-111208481 TGAGGCCCAGAGAGGTGAAGTGG + Intergenic
1074455189 10:113590102-113590124 TGAAGCCCAGAGAAGGGAAGTGG - Intronic
1074975693 10:118579852-118579874 TGAGGCCCAGAGAGGGTATGGGG - Intergenic
1075023612 10:118968234-118968256 TGCGGCTCAGAGAGGGGAGGTGG - Intergenic
1075056405 10:119222139-119222161 ACAAGCTCAGAGAGGTGAAGTGG + Intronic
1075223118 10:120601458-120601480 TGACGTCCAGAAAAGGGAAGTGG - Intergenic
1075440202 10:122474249-122474271 TGAGGCCCAGGAAGGGGAAGTGG + Intronic
1075590364 10:123686838-123686860 TGAGGCCCAGAGAGGGAAAGGGG - Intronic
1075852693 10:125602095-125602117 TGAGGCACAGAGAGGGGCGGTGG - Intronic
1075915103 10:126160111-126160133 TGAAGACAAGAGAGGGGAAGGGG + Intronic
1076125792 10:127972678-127972700 TGAAGCACAGAGAGGTGGAGGGG + Intronic
1076531396 10:131147613-131147635 CGAGGCCCAGAGAGGGGAGGGGG - Intronic
1077107559 11:848652-848674 GGAAGCTAAGGGAGGGGAAGGGG - Intronic
1077157983 11:1099867-1099889 TGACTCCGTGAGAGGGGAAGAGG - Intergenic
1077336734 11:2008622-2008644 TGAGGCTCAGAGAAGTGGAGGGG - Intergenic
1077601716 11:3579418-3579440 TAAGGCTCAGAGAGGGTAAGTGG + Intergenic
1078542842 11:12225244-12225266 TAAAGCTCAGAGAAGGTAAGTGG - Intronic
1078546457 11:12250512-12250534 TGAGGCTCACAGAAGGGAAATGG + Intronic
1078781624 11:14444239-14444261 TAAACCTCAGAGAGGGTAAGAGG + Intronic
1079031195 11:16987559-16987581 TGAGGTCCAGAGATGGGAAGTGG - Intronic
1079116764 11:17645193-17645215 TGAAGCTCAGAGAGGGGTAAGGG + Intronic
1079159385 11:17978101-17978123 TGAGGCTCAGAGAGGCTAAGTGG - Intronic
1079279860 11:19077365-19077387 TTACCCTGAGACAGGGGAAGGGG + Intergenic
1079668582 11:23136711-23136733 TGACTCTCACAGAGAGGAAATGG - Intergenic
1079943309 11:26709819-26709841 TGATGGTCAGAGAAGAGAAGTGG - Intronic
1079943551 11:26712915-26712937 TGATGATCAGAGAAGAGAAGTGG + Intronic
1079953616 11:26835186-26835208 TGAGGCTCAGAGAGGATAAGTGG - Intergenic
1080587459 11:33694790-33694812 AGAGGCTCAGAGAGGGAAAGTGG - Intergenic
1081618456 11:44604388-44604410 TGAGGCTCAGAAAGGCGAACAGG - Intronic
1081703433 11:45165995-45166017 GGAGGCTCAGAGAGGTTAAGTGG - Intronic
1081993884 11:47351678-47351700 TGAGGCTCAGAGAAGCTAAGCGG + Intronic
1083307216 11:61767424-61767446 TGAGGCTCAGAGAGGGAAAGGGG + Intronic
1083328883 11:61887882-61887904 AGAGGCTCAGAGAGGCAAAGTGG - Intronic
1083877124 11:65530190-65530212 TGAAGATCAAAGAGGTGAAGGGG - Intronic
1084118345 11:67054823-67054845 TGAGCCTCAGAGAGAGGCAGAGG - Intergenic
1084120650 11:67066992-67067014 TGAGGCTCAGAGTGGGGCAGTGG + Intronic
1084153637 11:67302594-67302616 TGAGGCTCAGATAGGCTAAGGGG - Intergenic
1084168949 11:67391303-67391325 TGAGTCTCAGAGAGGCGTAGGGG - Intronic
1084193104 11:67507891-67507913 TGAGGCTCAGCGAGGGTAGGCGG + Intronic
1084257620 11:67953965-67953987 TAAGGCTCAGAGAGGGTAAGTGG + Intergenic
1084264812 11:67999408-67999430 TGAGGCCCAGAGGGCGGAAGGGG + Intronic
1084275017 11:68046947-68046969 GGAGGCTCAGAGAGGTGAAGTGG + Intronic
1084529285 11:69717530-69717552 TGAGAGTCAGAGAGGGGAGGAGG - Intergenic
1084716810 11:70879490-70879512 TGAGGCTCAGAGAGGTGCCGTGG + Intronic
1084815144 11:71641272-71641294 TAAGGCTCAGAGAGGGTAAGTGG - Intergenic
1084916643 11:72433847-72433869 TGATGCCCAGAGAGGGGAAGCGG + Intronic
1085034464 11:73291817-73291839 GGAGGCTCAGAGAAGGGAAGGGG + Intronic
1085050106 11:73376027-73376049 TGAAGCCCAGAAAGGGGCAGAGG + Intergenic
1085051553 11:73382672-73382694 TGAGGCTCAGAGAGGTCAAGTGG - Intronic
1085408610 11:76278573-76278595 TGAGGCCTGGAGAGGGGAAGAGG - Intergenic
1085463816 11:76710841-76710863 TGAGGCTCAGAGAGGGTAAGCGG + Intergenic
1085473100 11:76770719-76770741 TGAAGCTCAGAGAGGGAAATTGG - Intergenic
1085642109 11:78199201-78199223 TGAGGCCCAGAGCGGGGAAGTGG + Intronic
1085819578 11:79777876-79777898 TGAAGCTCAGAGAGGTAAAGTGG - Intergenic
1086089909 11:82994892-82994914 TGAGGCCCAGAGAGGGTGAGTGG - Intronic
1086122826 11:83318040-83318062 TGAAGCTCAGAGAGGGGATAAGG - Intergenic
1086167862 11:83800235-83800257 TGAGGCCCAGAGAGATGAAGGGG - Intronic
1086283768 11:85221726-85221748 TGAAGCTCAAAGAGGAGTAGTGG + Intronic
1086575885 11:88338505-88338527 AGAGGCCCAGAGAGAGGAAGCGG + Intergenic
1086643479 11:89189210-89189232 TGAGACTCAGAGAGGGTAAGTGG - Intronic
1086759901 11:90615225-90615247 TTAAGTTCAGAGAGGGCAAGAGG + Intergenic
1088233967 11:107702669-107702691 TGAGGCTCAGAAAGGACAAGTGG - Intergenic
1088757791 11:112900832-112900854 GGAGGTTCAGAGAGGTGAAGTGG - Intergenic
1089074906 11:115730007-115730029 TGAGGCTGAGAAAGGTGAAGTGG - Intergenic
1089387604 11:118078490-118078512 TGATGATCAGAAAGGGGAAGGGG + Intronic
1089390812 11:118100452-118100474 TGAGGCTCGGAGAGGAGGAGTGG + Intronic
1089688108 11:120169635-120169657 CCACGCTCAAAGAGGGGAAGTGG - Intronic
1089841473 11:121422114-121422136 TGACTCAGAGAGAGGGAAAGGGG + Intergenic
1089897394 11:121945067-121945089 TGATGCTTAGAGTAGGGAAGTGG - Intergenic
1090263040 11:125335377-125335399 TGGGGCCCAGAGAGGGGCAGTGG - Intronic
1090363755 11:126190029-126190051 TGATGCAGAAAGAGGGGAAGGGG - Intergenic
1091289624 11:134430579-134430601 TGAGGCCCGGAGAGGGGAGGGGG + Intergenic
1202819718 11_KI270721v1_random:63804-63826 TGAGGCTCAGAGAAGTGGAGGGG - Intergenic
1091379648 12:48214-48236 TGAAGCTCAGAGAAGTGAAGTGG - Intergenic
1091566655 12:1653790-1653812 TAACACTCAGAGTGGTGAAGCGG + Intergenic
1091690495 12:2593257-2593279 TGAAGCTCAGAGAGTGGTCGTGG - Exonic
1091825385 12:3508680-3508702 TGACGCTGAGAGAGTGGATGGGG - Intronic
1091874366 12:3921311-3921333 TGAGACACAGAGAGGGCAAGTGG + Intergenic
1092215196 12:6677138-6677160 TGAGGCCCAGAGAGGGGAAAAGG + Intronic
1092427857 12:8388787-8388809 TAAGGCTCAGAGAGGGTAAGTGG + Intergenic
1092429129 12:8395774-8395796 TAAGGCTCAGAGAGGGTAAGTGG + Intergenic
1092725734 12:11483919-11483941 TGAGGCTCAGAGAGGTTAAGGGG + Intronic
1093800457 12:23366139-23366161 TAAAGCACAGAGTGGGGAAGAGG - Intergenic
1093803101 12:23398073-23398095 ATACGCAAAGAGAGGGGAAGAGG + Intergenic
1094064831 12:26351203-26351225 AAACACTCAGAGAGGGGAGGTGG + Intronic
1095498289 12:42808651-42808673 TGATGCTAAGAGATGGGGAGTGG - Intergenic
1096263827 12:50108823-50108845 TGAGGCTCAGAGAGGTTAAGTGG + Intronic
1096574985 12:52547179-52547201 TGAGGCTCAGAGAGGATAAGGGG - Intronic
1096596649 12:52700116-52700138 GGACGCTCAGAGAGTGGAAATGG - Intronic
1096623554 12:52879421-52879443 GGAGGCTCAGAGAGGGGAGTTGG - Intergenic
1097696907 12:62783572-62783594 TGAGGCCCAGTGAGGGGAACTGG - Intronic
1097862137 12:64528404-64528426 TGACGCTTAGAGTGGTTAAGTGG + Intergenic
1098527382 12:71501392-71501414 TGAGGCTCAGTGAGGTGAGGTGG - Intronic
1098910478 12:76203753-76203775 TGAGGCTCTGAGCGGGGATGGGG + Intergenic
1099405666 12:82258948-82258970 TGAGGCTCAGAGAGGTGAAGTGG - Intronic
1100382100 12:94071609-94071631 TGAGGCCCAGAGAGGCTAAGGGG - Intergenic
1101470150 12:104988261-104988283 AGAGGGTGAGAGAGGGGAAGAGG - Intronic
1101763116 12:107675499-107675521 TGAGGCTCAGAGACAGAAAGTGG + Intergenic
1101818824 12:108167137-108167159 TGAAACCCAGAGAGGAGAAGTGG - Intronic
1101822748 12:108196383-108196405 TGAAGCTCAGAGAGATGAAGCGG + Intronic
1101834834 12:108287946-108287968 TGAGGCTCAGAGAGGTGAGGCGG - Intergenic
1101918393 12:108913459-108913481 TGAGGCTCAAAGAGGATAAGTGG + Intronic
1102009384 12:109608672-109608694 TGAGACTCAGAAAGGTGAAGTGG + Intergenic
1102018864 12:109667583-109667605 TGAGACTCAGAGAGGTCAAGTGG - Intergenic
1102021605 12:109687230-109687252 TGAGGCCCAGAGAGGGGAGTGGG + Intergenic
1102136761 12:110582466-110582488 TGTCGCCCAGGGAGGGGACGAGG + Intronic
1102202413 12:111066827-111066849 TGATGCTCAGAGAGGGGCAGAGG - Intronic
1102389609 12:112538899-112538921 TGAGGCTCAGAGAGGGCAAGTGG + Intergenic
1102391769 12:112554856-112554878 AGAAGCTCAGAGAGATGAAGAGG + Intergenic
1102438245 12:112941961-112941983 TGAGGCTGAGAGAGGGGTAGAGG - Intronic
1102439219 12:112948735-112948757 TGAGGCTCAGAGAGGGGAAGTGG - Intronic
1102464146 12:113118729-113118751 TGAGGCTCAGAGAGGCTAAGTGG - Intronic
1102497401 12:113329229-113329251 TGAGGCACAGAGAGGCAAAGTGG + Intronic
1102513966 12:113434309-113434331 TGAGGCCCAGAGGGGAGAAGAGG + Intronic
1102564002 12:113782877-113782899 TGAGGCCCAGAGGGGGGAAGTGG + Intergenic
1102632385 12:114292571-114292593 TGAAGTTCAGAGAGGAGGAGTGG + Intergenic
1102632681 12:114295359-114295381 CGAGACTCAGAGAGGTGAAGTGG + Intergenic
1102636599 12:114329973-114329995 CAAGGCTCAGAGAGGGGAAGGGG - Intergenic
1102655500 12:114479656-114479678 GGACGCCCAGGGAGGGGAGGTGG - Intergenic
1102687097 12:114733814-114733836 TGAGTCTCAGAGAGGTTAAGAGG + Intergenic
1102812523 12:115836808-115836830 TGAGGCTCAGAGGGAGGATGAGG + Intergenic
1102825392 12:115944125-115944147 TGAGGCCCAGAGAGGGAAGGAGG - Intergenic
1102898572 12:116618250-116618272 TGAGGCTCAGAGAGATGTAGGGG - Intergenic
1103049755 12:117768836-117768858 TGAGGCACAGAGAGGTCAAGTGG + Intronic
1103145478 12:118591433-118591455 TGAAGATCAGAGAGGTGAAGGGG + Intergenic
1103184322 12:118943303-118943325 TGAGGCTCAGAGAGATTAAGTGG - Intergenic
1103218186 12:119219881-119219903 TGAGGCTCAGAGATGTGAAGGGG + Intronic
1103403754 12:120660462-120660484 TGAGGCTCAGAGAGGGTAAGTGG - Intronic
1103938522 12:124489399-124489421 AGAGGCACAGAGAGGGTAAGTGG + Intronic
1103970879 12:124670801-124670823 TGACGCCCGGAGAGGTGCAGAGG - Intergenic
1104820218 12:131672773-131672795 TCTCGCTCAGAGCGGGGATGTGG - Intergenic
1106665206 13:31844795-31844817 TGAAGCTCAGAGAGGTGAAGGGG - Intergenic
1106769749 13:32950543-32950565 TGAGGCTGGGAGAGGTGAAGGGG + Intergenic
1106939513 13:34762548-34762570 TTAGGCTCAGAAAGGGAAAGTGG + Intergenic
1107428275 13:40316011-40316033 TGAGGCTCAGAGAGATTAAGTGG + Intergenic
1107542864 13:41409492-41409514 TCACGCTTAGAGTGGGGGAGAGG - Intergenic
1108429860 13:50342676-50342698 GGAAGCTCAGAGAGGTAAAGAGG + Intronic
1110191059 13:72728668-72728690 TTAAGCTCAGAGAAGTGAAGTGG - Intronic
1110450956 13:75636705-75636727 TGAGGCTCAGAGATGGGTGGAGG + Intronic
1113022943 13:105909034-105909056 TGAAGCCAAGAGAGGGGAATCGG - Intergenic
1114510132 14:23252063-23252085 TGACAATCAGAGAGGGAAAAGGG - Intronic
1114549488 14:23524811-23524833 AGAGGCAGAGAGAGGGGAAGAGG - Exonic
1114666198 14:24378436-24378458 TAAAGTTCAGAGAGGGAAAGGGG + Exonic
1114853261 14:26406324-26406346 TAAAGCACAGAGAAGGGAAGTGG + Intergenic
1115451810 14:33556731-33556753 TGAGGCACAGAGAGGCTAAGTGG - Intronic
1115506134 14:34095949-34095971 AGAGGATGAGAGAGGGGAAGGGG - Intronic
1116160657 14:41263650-41263672 TGACAGTGAGAGAGGAGAAGTGG + Intergenic
1116173709 14:41437196-41437218 TGAAGCTTAGAGAGTCGAAGTGG + Intergenic
1117173703 14:53127362-53127384 TGAGGCTCAGAGAGGTTAAGGGG - Intronic
1117675679 14:58152421-58152443 TCCCGCTTAAAGAGGGGAAGCGG - Intronic
1118743729 14:68759247-68759269 TGATGCCCAGAGAGGTAAAGGGG + Intergenic
1119384466 14:74248816-74248838 TGAGGCTCACAGATGGGAAGTGG - Intronic
1119439931 14:74621432-74621454 TGAGGCCCAGGGAGGGGAAGGGG - Intergenic
1119598587 14:75958913-75958935 TGACGCAGACAGAGGGGATGGGG - Exonic
1119859685 14:77927094-77927116 TGAGGCTCAAAGAGGTGATGAGG - Intronic
1119999646 14:79288556-79288578 TGAGACTCAGAGAGGTTAAGTGG + Intronic
1120856557 14:89217581-89217603 TGAAGCTCAGAGAAGTGAAGTGG - Intronic
1120878682 14:89397761-89397783 TGAAGCTCAGAGAGGTTCAGTGG - Intronic
1121246901 14:92467562-92467584 TGAGGGACAGAGAGGGGAGGTGG + Intronic
1121254989 14:92524750-92524772 GGTGGCTCAGAGAGGGGAAGTGG + Intronic
1121298250 14:92847853-92847875 TGAGGGTCAGAGACGGTAAGTGG - Intergenic
1121351458 14:93176640-93176662 TGAGGTTCAGAGAGGGTGAGAGG - Intergenic
1121417023 14:93786888-93786910 TAACTCTCAGAGAGGGTAAGTGG + Intronic
1121441338 14:93951578-93951600 TGAGGCACAGAGAGGGTAAGTGG + Intronic
1121442648 14:93958506-93958528 TGAGGCACAGAGCGGGGATGGGG - Intronic
1121472540 14:94166381-94166403 TGAGGCTCAGAGAAGTTAAGCGG + Intronic
1121507184 14:94486139-94486161 TGAGGCTCAGAGAGGTGACGTGG - Intergenic
1121537242 14:94699317-94699339 CTAGTCTCAGAGAGGGGAAGGGG + Intergenic
1121561614 14:94880361-94880383 TGATGCTCAGAGAGGCTATGTGG - Intergenic
1121801843 14:96780975-96780997 TGCCGCTCAGAGGGGAGAAGTGG + Intergenic
1121991478 14:98561909-98561931 TGCCACTCAGAGAGGGGTGGAGG - Intergenic
1122062922 14:99148713-99148735 TGAGGCACAGAGAGGTGAAGTGG + Intergenic
1122067084 14:99181407-99181429 TGACGCTCAGAGAAGCAAAGCGG + Intronic
1122125722 14:99577473-99577495 TGAGGCTCAGAGAGGTGAGGCGG - Intronic
1122242053 14:100375662-100375684 TGACGCTGAGGGTGGGGAACGGG - Intronic
1122362219 14:101174249-101174271 CGAGGCCCAGAGAGGGCAAGGGG + Intergenic
1122794104 14:104197128-104197150 TGAGGCCCAGAGAGGGGAAGGGG - Intergenic
1123680408 15:22758656-22758678 TGAAGTGCAGAGAGGGAAAGAGG - Intergenic
1124231078 15:27946961-27946983 TGCCGCTCAGAGAGGCCAGGAGG + Intronic
1124617498 15:31252221-31252243 TGAGGCTCAGAGACTTGAAGTGG + Intergenic
1125170223 15:36758418-36758440 TGAGGCACAGAGAGGCAAAGTGG - Intronic
1125492630 15:40159619-40159641 TGGGACTGAGAGAGGGGAAGGGG - Intergenic
1126373823 15:47974791-47974813 TGAAGCTCAGAAAAGGGAACAGG + Intergenic
1126896546 15:53263773-53263795 TGATGCTCAGACAGGATAAGTGG - Intergenic
1127849232 15:62898304-62898326 TGAGGTACAGGGAGGGGAAGCGG + Intergenic
1128072389 15:64806066-64806088 TGAGGCCCAAAGAGGGAAAGGGG + Intergenic
1128079363 15:64847051-64847073 TGAGGCTCAGAGAGGTTAAGTGG + Intronic
1128215864 15:65933637-65933659 GGAGACTCAGAGAGGGGCAGTGG + Intronic
1128258762 15:66217263-66217285 TGAGGCCCAGAGAGGGAAAATGG + Intronic
1128346985 15:66860503-66860525 TGAGGCACAGAGAGGTTAAGTGG - Intergenic
1128477371 15:68008703-68008725 TGATGCTCATACAGGGGTAGGGG + Intergenic
1129111810 15:73341541-73341563 TGAGGCACAGAGAGGCAAAGTGG + Intronic
1129239773 15:74244469-74244491 TGATGGTCAGATTGGGGAAGGGG + Intronic
1129254845 15:74328411-74328433 TGAGGCTCAGAAAGGTGAAGGGG + Intronic
1129274137 15:74434186-74434208 TGAGGCCCAGAGAGGGGATAGGG - Exonic
1129292526 15:74579280-74579302 TGCTGCTCAGGGAGGGGAGGGGG - Intronic
1129323481 15:74787467-74787489 TGAGGCCCAGAAAGGAGAAGTGG + Intronic
1129386934 15:75201579-75201601 TGAAGCTCAGCGAGGTCAAGCGG + Intronic
1129520210 15:76181156-76181178 TGAGGCTCAGAGAAAGGGAGAGG + Intronic
1129606257 15:77026505-77026527 TGAGGCACAGAGATGGGAAGTGG - Intronic
1129785595 15:78308194-78308216 TGACCCTGAGAAAGGCGAAGTGG + Intergenic
1129851307 15:78795482-78795504 TGAGGCTCAAAGAGAGGAAGGGG - Intronic
1130139131 15:81208867-81208889 TGAGGCACAGAGAGGTAAAGTGG - Intronic
1130141354 15:81228871-81228893 TGAGGCACAGAGAGGTAAAGTGG - Intronic
1130306263 15:82713993-82714015 TGAGGCCCAGAGAGAGGAAGGGG - Intergenic
1130735050 15:86539111-86539133 TGAGGCACAGAGAGGGGAATTGG + Intronic
1130992861 15:88887015-88887037 TGCTTCTCAGACAGGGGAAGGGG - Intronic
1131073629 15:89481116-89481138 TGAGGCTCAGAGGGGTTAAGGGG - Intronic
1131074738 15:89487903-89487925 TGAGGCTCTGAGAAGGGAAGTGG - Intronic
1131316937 15:91347660-91347682 TGAGGCTCAGAGAGGTCAAATGG + Intergenic
1131442909 15:92472199-92472221 TGACCCCCAGAGTGGGGAAGGGG + Exonic
1131990502 15:98088649-98088671 TGACCCTGGGGGAGGGGAAGGGG - Intergenic
1132099642 15:99014648-99014670 TGACCCTGGGGGAGGGGAAGGGG + Intergenic
1132181172 15:99753986-99754008 TGACCCTCACAGAGAGGAGGTGG + Intergenic
1132256669 15:100382413-100382435 AGAGGCTCAGAGAGATGAAGTGG + Intergenic
1132420487 15:101662064-101662086 TGAAGCTGAGAGAGGGTATGTGG - Intronic
1132584265 16:699494-699516 TGAGGCTCAGAGAAGGGAAGTGG - Intronic
1132662826 16:1069212-1069234 TGAGGCTCAGAGAGGGTAAAGGG - Intergenic
1132793969 16:1709370-1709392 TGCAGCCCAGCGAGGGGAAGAGG - Intronic
1132889827 16:2197962-2197984 TGAGGCTCAGAGAAGCCAAGGGG + Intergenic
1133236721 16:4390805-4390827 TGAGGCTCAGAGTGGTGATGAGG + Intronic
1133236982 16:4392059-4392081 TGAACCTCAGAGGAGGGAAGGGG - Intronic
1133752330 16:8734506-8734528 TGAGGCACAGAGAGGTTAAGTGG - Intronic
1134063857 16:11214339-11214361 GGAAGCTCAGAGAGGTTAAGTGG + Intergenic
1134416073 16:14044471-14044493 TGAGGCTCAGAGAAGGTAGGTGG + Intergenic
1134656575 16:15952076-15952098 TGAGGCACACAGAGGGAAAGTGG - Intronic
1135030349 16:19033133-19033155 TGAGGCTCAAAGAGGTGAACTGG - Intronic
1135052833 16:19206375-19206397 TGAGGCTCAGAGAGGTTCAGCGG + Intronic
1135185129 16:20309194-20309216 TGAGCCTCAGAGAGGGGAGAAGG + Intergenic
1135238032 16:20776701-20776723 TGAAGCTCACAGAGGTGAAGTGG + Intronic
1135932435 16:26749808-26749830 TGAAGCTCAGAGAAGAAAAGTGG + Intergenic
1135983457 16:27166709-27166731 TGAGGCACAGACAGGTGAAGGGG + Intergenic
1135998320 16:27269904-27269926 TGAAGCCCAGAGAGGTTAAGAGG - Intronic
1136299580 16:29324947-29324969 GGAGGGGCAGAGAGGGGAAGGGG - Intergenic
1136406934 16:30053511-30053533 GGGGGCCCAGAGAGGGGAAGGGG - Intronic
1136536225 16:30901377-30901399 TGAGGCTCAGAGAAGGGAAGTGG + Intronic
1136683982 16:31983530-31983552 TGAGGCTCAGAGAGGCTAAGAGG + Intergenic
1136778644 16:32884389-32884411 GGAGGCCCAGAGAGGAGAAGGGG - Intergenic
1136784607 16:32927082-32927104 TGAGGCTCAGAGAGCCTAAGAGG + Intergenic
1136885176 16:33926724-33926746 TGAGGCTCAGAGAGCCTAAGAGG - Intergenic
1136891976 16:33977125-33977147 GGAGGCCCAGAGAGGAGAAGGGG + Intergenic
1137253750 16:46758686-46758708 TGACGCCCAGAGATGGGAAGGGG + Intronic
1137408561 16:48208799-48208821 TGAGGCCCAGAGAGGCTAAGTGG - Intronic
1137445838 16:48531665-48531687 TGACACCCAGAGAAGGGAAGGGG + Intergenic
1137572159 16:49573850-49573872 AGAAGCCCAGAGAGGGGAAGGGG - Intronic
1137666272 16:50251469-50251491 TGAAGCCCAGAGAGGTGAAGTGG + Intronic
1137725241 16:50652458-50652480 TGAGACTCACAGAGGGGAAACGG - Intergenic
1138100593 16:54249195-54249217 TGAGTCTCAGAGAGGTTAAGTGG + Intronic
1138291651 16:55853203-55853225 TGAGGCTTAGAGAGGTGAAGTGG + Intronic
1138351201 16:56347203-56347225 AGAGGCTCAGAGAAGAGAAGAGG - Exonic
1138501122 16:57445641-57445663 TGAGGCCCAGAGAGGGGCAATGG - Intronic
1138510115 16:57503848-57503870 TGAGGCCCAGAGGGGAGAAGTGG + Intergenic
1139028903 16:62855092-62855114 TGAGGCAAAGAGAGGGGATGAGG - Intergenic
1139321509 16:66118042-66118064 TGAAGCCCAGAGAGGGGAGAGGG - Intergenic
1139354828 16:66361238-66361260 TGAGGTGCTGAGAGGGGAAGAGG - Intergenic
1139365985 16:66433935-66433957 TGACACTCAGAGTTGGGCAGGGG - Intronic
1139430003 16:66906035-66906057 TGAGGATCAGAGAGGGGGTGTGG - Intergenic
1139701724 16:68711782-68711804 TGACTCACAGAGAGGAGCAGAGG + Intronic
1139739174 16:69020512-69020534 TGAAGCTCACTGAGGGGAAGAGG + Intronic
1140747797 16:77996489-77996511 TGAGGCTCAAAGAGGAAAAGTGG - Intergenic
1141019905 16:80485368-80485390 TGGCGCTCAGAGTGGGGATGTGG + Intergenic
1141259975 16:82443863-82443885 TGAGCCTCAGAGAGGGGACGGGG - Intergenic
1141348776 16:83273840-83273862 TGAGGCTCAGAGGGGTGAAAAGG + Intronic
1141422593 16:83926377-83926399 TGAGGCCCAGAGAGCTGAAGGGG + Exonic
1141468824 16:84224778-84224800 TGAAGCACAGAGAGGGTCAGTGG + Intronic
1141468897 16:84225324-84225346 TGAAGCACAGAGAGGGCCAGTGG - Intronic
1141604439 16:85144899-85144921 TCACACTCAGAGAGAGGAACTGG - Intergenic
1141700090 16:85638506-85638528 GGAAGCTCAGAGAGGCAAAGCGG - Intronic
1141744461 16:85916239-85916261 TGAGGCACAGAGTGGGGAAGCGG + Intronic
1141853320 16:86663179-86663201 TGAGGCTTACAGAGGTGAAGGGG + Intergenic
1142232100 16:88904817-88904839 TGAGGCTCAGAGAGGGGAAGAGG - Intronic
1142242178 16:88952590-88952612 TGGAGCTCAGAGAGGCGATGGGG - Intronic
1203081060 16_KI270728v1_random:1146483-1146505 GGAGGCCCAGAGAGGAGAAGGGG - Intergenic
1203087266 16_KI270728v1_random:1191088-1191110 TGAGGCTCAGAGAGCCTAAGAGG + Intergenic
1142533982 17:600761-600783 TGCAGCTCAGAGAGGTTAAGTGG - Intronic
1142720332 17:1771612-1771634 AGAGGCTCAGAAAGAGGAAGTGG + Intronic
1142882948 17:2895426-2895448 TGAGGCTCAGAGAGGTTAAGCGG - Intronic
1143020450 17:3914801-3914823 TGAGGCCCAGAGAGGGGCAGTGG - Intronic
1143268480 17:5658366-5658388 TAAAGCTCAGAGAGGGCAGGTGG - Intergenic
1143337807 17:6186632-6186654 TGAGACCCAGAGAGGGGAAGAGG + Intergenic
1143898663 17:10156799-10156821 GCACGCCCAGAGAGGGGAAAAGG - Intronic
1144669339 17:17124103-17124125 TGAGGCCCAGAGAGGTGGAGAGG + Intronic
1144773453 17:17772013-17772035 TGAGGCCCAGAGAGGACAAGGGG - Intronic
1145785977 17:27594147-27594169 TGAGGCTCAGAGAGGTCAAGTGG - Intronic
1145786573 17:27597625-27597647 TGAGGTTCAGAGAGAGGGAGGGG + Intronic
1145807020 17:27741760-27741782 TGCCGTTCAGAGGAGGGAAGTGG + Intergenic
1145866561 17:28245704-28245726 TGAGGCTCACAGAGGTAAAGAGG - Intergenic
1145907232 17:28523200-28523222 TGAAGATCAGAAAGGGGCAGTGG + Intronic
1146124225 17:30219235-30219257 TGGGGCTCAGAGAGGGGAAGTGG - Intronic
1146226792 17:31074089-31074111 TGAGGCTCAGAGAAGTGAAGTGG + Intergenic
1146267588 17:31463268-31463290 TGAGGCTCAGAGAGGCTAAAGGG - Intronic
1146275605 17:31513890-31513912 TGAGGCTCAGAGTGGGAGAGTGG - Intronic
1146515944 17:33489342-33489364 TGAGGCTCAAAGAAGTGAAGGGG + Intronic
1146569349 17:33939430-33939452 TGAAGTTCAGAGAAGGGAAGAGG + Intronic
1146645544 17:34574806-34574828 TGAGACTCAGAGAGGTGCAGTGG + Exonic
1146650314 17:34602364-34602386 TGAGGCCCAGAGAAGTGAAGGGG - Intronic
1146953492 17:36922383-36922405 TGAAGCTCAGAGAGGAGAGGTGG - Intergenic
1147050987 17:37794753-37794775 TGAGGCACAGAGAAGGTAAGGGG - Intergenic
1147055076 17:37827896-37827918 TGAGGCTCAGAGAGAGGAAGTGG + Intergenic
1147143666 17:38473386-38473408 TGAGGCTCAGGGAAGGTAAGTGG - Intronic
1147144908 17:38479233-38479255 TGAGGCTCAGAGAGGCTAAGAGG + Intronic
1147166186 17:38594702-38594724 TGAGGCTCAGAGAGGGAAAGTGG + Intronic
1147263177 17:39220425-39220447 TGAGGCTCAGAGAGAAGAAGTGG - Intronic
1147563270 17:41521734-41521756 TAAGGCTCAGAGAGAGGAGGCGG - Exonic
1148126356 17:45239209-45239231 TGACACTGAGAGAGAGGAAGAGG - Intronic
1148336105 17:46842182-46842204 TGAGGCACAGAGAGGCGAAGTGG - Intronic
1148382003 17:47206755-47206777 TGAGGCCCAGAGAGAGGAAGTGG + Intronic
1148395022 17:47300900-47300922 TGAGGCACAGAGCTGGGAAGTGG + Intronic
1148638910 17:49170264-49170286 AGAGGATCAGAGAAGGGAAGGGG + Intergenic
1148652324 17:49259201-49259223 TGAGGCCCAGAATGGGGAAGGGG + Intergenic
1148861424 17:50606251-50606273 AGAGGCTCAGAGAGGGTAAGGGG + Intronic
1148875614 17:50685105-50685127 TGAGGCTCAGAGATGGTAAAGGG + Intronic
1149559160 17:57595865-57595887 TGAGGCTCAGAGAGGGCAAGGGG + Intronic
1150247917 17:63689913-63689935 TAAAGATCAGAGAGGAGAAGAGG - Intronic
1150268315 17:63845339-63845361 AGAGGCTCTGAGATGGGAAGGGG - Intergenic
1150434004 17:65140113-65140135 TGAGGCTCAGAGAGGCTAAGCGG + Intronic
1151121272 17:71796015-71796037 TGAAGAACAGAGAAGGGAAGGGG + Intergenic
1151820740 17:76495456-76495478 TGAGGCTCAGAGATGTTAAGTGG - Intronic
1152276892 17:79363225-79363247 TGATGCACAGAGAGGGGACATGG + Intronic
1152278838 17:79373326-79373348 TGAAGCTCAGAGAGGGAAGGGGG + Intronic
1152460381 17:80439221-80439243 AGAGGCTCAGAGAGGCGAGGTGG - Intergenic
1153014949 18:575177-575199 TGATTCTCTGAGAGGGGGAGAGG - Intergenic
1153366684 18:4265016-4265038 TGATGCACAGAGAAAGGAAGGGG - Intronic
1154155490 18:11941083-11941105 TCACGCTGAGAGAGGAGAGGAGG - Intergenic
1155447678 18:25929047-25929069 TGACCCTCAGAAAGGGTAGGAGG + Intergenic
1156352012 18:36309901-36309923 TGACCCTGAAAGAGGGCAAGTGG + Intronic
1156488367 18:37481114-37481136 TGACGCGAGGGGAGGGGAAGGGG + Intronic
1156921305 18:42525577-42525599 TGAAGCTCAGAGAGGGTAAGTGG + Intergenic
1157057460 18:44247657-44247679 TGAAGCTCAGAGGGGATAAGGGG - Intergenic
1158375218 18:56855934-56855956 TGTCCCAAAGAGAGGGGAAGGGG + Intronic
1158937355 18:62376735-62376757 AGAAGTTCAGAGAGAGGAAGGGG - Intronic
1159009422 18:63044222-63044244 TGAGGCCCAGAGAAGGGCAGTGG + Intergenic
1159814753 18:73059128-73059150 TGATGCCCTGAGAGGGGTAGTGG + Intergenic
1159834560 18:73322973-73322995 AGAAGTCCAGAGAGGGGAAGAGG + Intergenic
1160495969 18:79375630-79375652 TGGCCCTGAGTGAGGGGAAGGGG + Intronic
1160677500 19:399286-399308 TGAGGCTCAGAGAGGGGGAGGGG + Intergenic
1160691271 19:461510-461532 TGAGGCGCGGGGAGGGGAAGGGG + Intergenic
1160749265 19:726333-726355 TGACCCGCAGAGAATGGAAGTGG + Intronic
1160770449 19:828591-828613 GGAGGCCCAGAGAAGGGAAGGGG + Intronic
1160770477 19:828690-828712 GGAGGCCCAGAGAAGGGAAGGGG + Intronic
1160770510 19:828792-828814 GGAGGCCCAGAGAAGGGAAGGGG + Intronic
1160770602 19:829089-829111 GGAGGCGCAGAGAAGGGAAGGGG + Intronic
1160770682 19:829359-829381 GGAGGCGCAGAGAAGGGAAGGGG + Intronic
1161154246 19:2723926-2723948 TGCTGCTCAGAGAAGGGAAGCGG + Intronic
1161244674 19:3243033-3243055 GGGGGCACAGAGAGGGGAAGTGG - Intronic
1161269556 19:3382352-3382374 TGGTGGTCTGAGAGGGGAAGTGG + Intronic
1161275683 19:3415523-3415545 TGAAGCCCAGAGATGGGCAGGGG + Intronic
1161277227 19:3425286-3425308 TGAGGCTCGGAGAGGTTAAGGGG + Intronic
1161399342 19:4060478-4060500 AGAGGCTCAGAGAGGTGAGGCGG + Intronic
1161513427 19:4683858-4683880 TGACGCCCTCAGAGGGGACGTGG - Intronic
1161607042 19:5220911-5220933 TGAGGCACAGAGAGGGCACGTGG + Intronic
1161631716 19:5360167-5360189 TGAGGCTCAGAGATGGGCAGGGG - Intergenic
1161810856 19:6470448-6470470 GGAGACTCAGAGAGGGAAAGGGG - Intronic
1161851561 19:6740255-6740277 GGACGCTCATGGAGGGGAAGGGG + Intronic
1162324304 19:9989691-9989713 TGAGGATCAGAGAGGGAAATGGG - Intronic
1162335519 19:10057884-10057906 TCAAGTCCAGAGAGGGGAAGAGG + Intergenic
1162582209 19:11538407-11538429 AGAGGCCCAGAGAGGAGAAGGGG + Intergenic
1162858513 19:13488172-13488194 TGTGGTTCAGAGAGGGTAAGTGG + Intronic
1162997903 19:14348172-14348194 TGAGGCTCAGGGAGGCGATGCGG - Intergenic
1163256343 19:16158117-16158139 TGAGGTTCAGAGAGGATAAGAGG + Exonic
1163281152 19:16318654-16318676 TGAGGCTCCGAGAGGTTAAGTGG + Intergenic
1163450885 19:17376853-17376875 TCAGGCTCAGAGAGGTGAGGGGG + Intronic
1163451067 19:17377687-17377709 TGAGGCACAGGGAGGAGAAGGGG + Intergenic
1163462585 19:17448059-17448081 TGAGGCCAAAAGAGGGGAAGAGG + Intronic
1163565273 19:18047397-18047419 TGAGGCTCATATAGGCGAAGTGG + Intergenic
1163776979 19:19224625-19224647 AGAGGATCAGAGAGAGGAAGGGG - Intronic
1163850750 19:19662018-19662040 TGAAACTCAGAGAGCAGAAGCGG + Intronic
1164159423 19:22616942-22616964 TGAAGCACAGAGAAAGGAAGCGG + Intergenic
1164472343 19:28546768-28546790 TGAGGGTCAGGGAGGGGAAGAGG - Intergenic
1164839956 19:31385699-31385721 TGAGGGCCAGAGAGGGGAAGGGG + Intergenic
1164948303 19:32314663-32314685 TAAAACCCAGAGAGGGGAAGGGG - Intergenic
1165315793 19:35054698-35054720 TGAGGCTCAGAGAGGTGGGGTGG - Intronic
1165413382 19:35676140-35676162 AGAAAATCAGAGAGGGGAAGAGG - Intronic
1165809714 19:38605167-38605189 TGAAGCACAGAGAGGGTAAGTGG - Intronic
1166047620 19:40238712-40238734 TGAGGCTCAGAGAGGTTAAGTGG - Intronic
1166068309 19:40373237-40373259 TGAGGCTCTAAAAGGGGAAGTGG - Intronic
1166225308 19:41391485-41391507 TGAGGCCCAGAGAGGGGAAGGGG - Intronic
1166343460 19:42151632-42151654 TGAGGCCCAGAGAGGGGAGACGG + Intronic
1166359400 19:42246602-42246624 TGAGGCCCAGAAAGGGGAAGGGG - Intronic
1166500836 19:43340012-43340034 TGAGGCTCAGAGACGGGGACTGG + Intergenic
1166505296 19:43367690-43367712 TGAGGCTCAGAGACGGGGACTGG + Intergenic
1166657778 19:44624716-44624738 TGAGACTCAGAGAGGCAAAGAGG - Intronic
1166658268 19:44627834-44627856 TGAGGCACAGAGAAGGGGAGTGG - Intronic
1166697297 19:44859388-44859410 TGAGGCACAGAGAGGTTAAGTGG + Intronic
1166859398 19:45801131-45801153 TGAGGCTCAGACAGGTGAACTGG - Intronic
1166968357 19:46544879-46544901 TGACAGTCAGAGAAGGGAACAGG - Intronic
1167193296 19:48007234-48007256 AAAGGCTCATAGAGGGGAAGGGG + Intronic
1167477222 19:49708040-49708062 TGAGGCTCAGGGAGAGGCAGAGG + Intronic
1167511777 19:49898973-49898995 TGGGGCACAGAGAGGGGAAAAGG + Intronic
1167571506 19:50291911-50291933 TGAGGCTCAGAGAGGGGCAGTGG + Intronic
1167654558 19:50755103-50755125 TGAGGCTCAGGGTGGGGATGGGG + Intergenic
1167733241 19:51274511-51274533 TGGGACTCAGAGAGGAGAAGAGG + Intergenic
1167792889 19:51691915-51691937 TGAGCCTCAGAGAGGGGAAGAGG - Intergenic
1167809391 19:51815225-51815247 TGACTTTCAGGAAGGGGAAGTGG + Intronic
1168074406 19:53971743-53971765 TGATGGCCAGAAAGGGGAAGTGG + Intronic
925920307 2:8633521-8633543 TGAGGCTCAGAGAGGTTAAGTGG - Intergenic
925920714 2:8636080-8636102 TGAGGCTCAGAGAGCAGAAACGG - Intergenic
926682556 2:15675108-15675130 TGAAGCCCAGAGAGGGCAGGAGG + Intergenic
926800432 2:16655363-16655385 TGAGGCTCAGGGAGGGGAGGAGG + Intronic
927454337 2:23236629-23236651 TGATGCACAGAGAAGGGGAGGGG - Intergenic
928375052 2:30767154-30767176 TGAGGCTCAGCGAGGTGAAATGG - Intronic
928693548 2:33825210-33825232 TGAGGGTGAGTGAGGGGAAGAGG - Intergenic
929051513 2:37840969-37840991 TGAGGTTCAGAGAAGTGAAGGGG - Intergenic
929119318 2:38471114-38471136 TGAGGCTCAGAAGGGGAAAGTGG + Intergenic
929316693 2:40487709-40487731 TGACTCCAAGAGAGGGGAACAGG + Intronic
929549361 2:42879742-42879764 TGCCTCTCAAAGAGGGGAAGTGG + Intergenic
929578146 2:43065732-43065754 TGAGGCCCAGAGAGGGCAAATGG + Intergenic
929792411 2:45033293-45033315 TGAGGCTTAGAAAGGGTAAGTGG - Intergenic
930186252 2:48415144-48415166 AGGCGCTCAGAAAGGGAAAGAGG + Intergenic
932048791 2:68378788-68378810 TGAGCCTTAGAGAGGGCAAGTGG + Intronic
932438993 2:71719912-71719934 TGAGGCTCAGAGAGGAACAGAGG + Intergenic
932574875 2:72957114-72957136 TGAAGCTGAGAAAGGGGATGTGG - Intronic
932615697 2:73230050-73230072 TGCAGCTCAGTGAGGGGAAGGGG + Intronic
932745242 2:74328612-74328634 TGAGGCCCAGAGAGGGGCAGTGG + Intronic
933465064 2:82641366-82641388 AAATGCTCAGAGAGGGAAAGGGG + Intergenic
933900429 2:86845979-86846001 AGATGCGCAGAGAGGGGAAGGGG + Intronic
934556523 2:95289619-95289641 AGGGGCTCAGAGAGGGGCAGGGG - Exonic
935405298 2:102703064-102703086 TGAGGCACAGGGAGGTGAAGTGG + Intronic
935780119 2:106503246-106503268 AGATGCGCAGAGAGGGGAAGGGG - Intergenic
935939152 2:108220512-108220534 TGTGGCTCAGAGAGATGAAGTGG - Intergenic
936469797 2:112788922-112788944 TGGAGCTCAGAGAGAGGAGGGGG + Intergenic
936564212 2:113570611-113570633 TGAAGCTCAGAGAAGTGAAGTGG + Intergenic
936685160 2:114819342-114819364 TGAGGATCACAGAGGGTAAGTGG - Intronic
936998206 2:118436792-118436814 TGAAGCTCAGAGAGTTTAAGTGG - Intergenic
937263119 2:120598933-120598955 TGACTCTGAGTGAGGGGAAATGG - Intergenic
937558584 2:123192349-123192371 TAAAGCTCAGAAAGAGGAAGTGG - Intergenic
937580004 2:123473829-123473851 GGACACTCAAAGAGGGGAGGGGG - Intergenic
937693274 2:124780093-124780115 TGAGGCTCAGAGAGAGTAAGTGG - Intronic
937849346 2:126619126-126619148 TGAGGCTCAGAGAGGTGCTGGGG - Intergenic
937989563 2:127654697-127654719 TGCCGCTCAGAGAGGCAAGGTGG + Intronic
938122073 2:128641085-128641107 TGCTGGACAGAGAGGGGAAGAGG + Intergenic
938625345 2:133102925-133102947 TGAGGCTCAAAGAGGGAAGGTGG - Intronic
940079327 2:149782236-149782258 TGACACTCAAAGAGGTTAAGTGG + Intergenic
940941920 2:159571573-159571595 TGACATCCAGAGAGGGGAAAGGG + Intronic
941028017 2:160479654-160479676 GGAGGCAGAGAGAGGGGAAGTGG - Intronic
941469859 2:165871194-165871216 GGAAGCTCAGAGACAGGAAGCGG + Intronic
942220935 2:173768337-173768359 TGACTCTCTGAGAGGGAAAATGG + Intergenic
945257116 2:207812043-207812065 TGACCCAGAGAGAGGGAAAGGGG + Intergenic
945509736 2:210686498-210686520 TGAGGTTTAGAGAGGTGAAGCGG + Intergenic
945864150 2:215158202-215158224 TGAAACTCAGAGAGGGCAGGAGG - Intergenic
946056903 2:216910479-216910501 TGAGGCCCAGAGAGGGGCAATGG + Intergenic
946886788 2:224229453-224229475 TGATGCGTAGAGAAGGGAAGGGG - Intergenic
948062150 2:235049995-235050017 AGAAGCTGAGAGAGGGGAAGTGG - Intronic
948136895 2:235643092-235643114 TGAGGCTCAGAGAGGGGGACTGG + Intronic
948459721 2:238123392-238123414 TGAGGCTCAGAGAGGGCAAGGGG - Intronic
948465920 2:238151575-238151597 TGAAGCCCAGAGAGGGGAGGTGG - Exonic
948679766 2:239625875-239625897 TGAGGCTGGGAGAGGAGAAGAGG - Intergenic
948917270 2:241040668-241040690 CAAGGCCCAGAGAGGGGAAGGGG - Intronic
948941662 2:241199911-241199933 TGAGGCCCTGAGAGGGGAAGGGG + Intronic
1168762953 20:362212-362234 TAAAGCTCAGAGAAGTGAAGTGG + Intergenic
1168788242 20:558028-558050 TGAGCCTCAGTGAAGGGAAGTGG + Intergenic
1168789588 20:567339-567361 TGAGACTCAGAGAGAGGATGTGG - Intergenic
1168789862 20:568666-568688 TGAGGCTCAGAGAGGAGAAAAGG - Intergenic
1168796072 20:610641-610663 TGAGGCCCAGAGAGGAGAAAGGG - Intergenic
1168805137 20:668273-668295 TGAGGCTCAGAGAGGTGAGGTGG - Intronic
1168834571 20:869542-869564 TGAGGTTCAGAGAGGGCCAGGGG + Intergenic
1168837126 20:884834-884856 TGAGGCCAAGAGAGGGGCAGGGG + Intronic
1168838890 20:896144-896166 TGAAACTCAGAGAGGGTGAGGGG - Intronic
1168857873 20:1021734-1021756 TGATGTTCAGAGAGGTGAAGTGG - Intergenic
1168862830 20:1058365-1058387 TGTAGCTCAGGGATGGGAAGGGG + Intergenic
1168953872 20:1820728-1820750 TGAGGCTCAGAGAGGGGGAGTGG + Intergenic
1168969079 20:1918550-1918572 TGAGGCTCAGCAAGGGGAACTGG - Intronic
1168973009 20:1943701-1943723 TGAGGCTCAGAGAGGTGGAGAGG + Intergenic
1168978163 20:1983400-1983422 TGAGGCTCAGAGCTGGGAAGTGG + Intronic
1169245689 20:4022724-4022746 TGCTGCTCGGAGAGTGGAAGAGG - Intergenic
1169433094 20:5557098-5557120 GGAAGGTCAGAGAGGGAAAGAGG + Intronic
1169682154 20:8227540-8227562 GGACTCACTGAGAGGGGAAGTGG - Intronic
1170896197 20:20416876-20416898 TGACGCTCAGACTGGCAAAGTGG + Intronic
1171185842 20:23123515-23123537 TGACACCCAGAGAGGGAAAGTGG + Intergenic
1171477036 20:25418853-25418875 TGACCTCCAGGGAGGGGAAGAGG - Intronic
1171989878 20:31687810-31687832 TCAGGCTCAGAGAGGGTAACTGG - Intronic
1172035466 20:32007790-32007812 TGAGGCCCAGAGAGAGGAAAAGG + Intergenic
1172056610 20:32158617-32158639 TGGGGCTCCGAGAGGTGAAGTGG - Intronic
1172082959 20:32357465-32357487 TGAGGCTCAGAGAGGTTGAGTGG + Intergenic
1172182845 20:33014105-33014127 TGAGGCTCAGAGAGGGGGAGAGG + Intronic
1172193916 20:33079190-33079212 TGAGGCTCAGAGGAGGGAAGTGG + Intergenic
1172504070 20:35448297-35448319 TGAGGCTCAGAAAGGGAAAGAGG + Intronic
1172606621 20:36218495-36218517 TGAGGCCCATAGAGAGGAAGTGG + Intronic
1172672197 20:36642258-36642280 GGAGGCACAGAGAGGGGAAGTGG - Intronic
1172696645 20:36827678-36827700 TGAGACTTAGAGAGGGGAAGTGG + Intronic
1172774979 20:37402083-37402105 TGAGGCTCAGAGAGGGGACTTGG + Intronic
1172874222 20:38154599-38154621 TGAGGCTCAGAGTGGTGAAGTGG - Intronic
1172883918 20:38218844-38218866 TGAGGCCCAGAAAGGGGGAGTGG - Intronic
1172889772 20:38255842-38255864 TAAGGCTCAGTGAGGGGCAGGGG - Intronic
1172974389 20:38895371-38895393 TGAGGCCCAGAGAGGTTAAGTGG + Intronic
1173063895 20:39690853-39690875 TGAAGTTCAGAGAGGGGAAGTGG - Intergenic
1173147054 20:40534049-40534071 TGAGGCTTAGAGAGGTTAAGGGG - Intergenic
1173162225 20:40661528-40661550 AGAGGCTCAGAGAGGTTAAGTGG + Intergenic
1173424152 20:42928314-42928336 AGATGCCCAGAGAGGGGCAGAGG + Intronic
1173438113 20:43050655-43050677 TGAGGCTCAGAGAAGTGAAGTGG - Intronic
1173469905 20:43314974-43314996 TGAGCCCCAGAGAGGAGAAGTGG - Intergenic
1173550536 20:43930258-43930280 TGAGGCCCAGAGAGGGTGAGTGG - Intronic
1173616078 20:44403772-44403794 TGAGGCTTAGAGAGGAAAAGTGG - Intronic
1173623707 20:44455983-44456005 TGAGGCTCAGAGATGGCAAGGGG + Intronic
1173648120 20:44646235-44646257 GGAGGATCAGAGAGAGGAAGTGG - Intronic
1173656523 20:44703610-44703632 TGAGGCTTAGAGAGAGGAAGTGG + Intergenic
1173674294 20:44820547-44820569 TAAAGCTCAGAGAGGTGAAGTGG - Intergenic
1173727023 20:45305357-45305379 TGAGGCCCAGAAAGGTGAAGTGG + Intronic
1173751422 20:45479842-45479864 TGAAGCCCAGTGAGGGGCAGTGG + Intronic
1173811463 20:45958396-45958418 TAAGGCTCAGAGAGGTGAAGTGG + Intronic
1173837732 20:46136699-46136721 TGAGGCTCAGAGAGGGGAAGCGG + Intergenic
1173849232 20:46207421-46207443 TGAGGCCCAGGGAGGGGAGGAGG - Intronic
1173852489 20:46227768-46227790 TGGGGCTCAGAGTGGGGATGGGG - Intronic
1173859183 20:46270902-46270924 TGAGGCTCAGAGAGATGAGGTGG - Intronic
1173870191 20:46336914-46336936 TGAGGTTCAGAGAGGTGATGTGG + Intergenic
1173902108 20:46598447-46598469 TGAGGCCCAGAGAAGGGAAGGGG + Intronic
1174107146 20:48170855-48170877 TGATACTCAGAGAGGGTAAGGGG - Intergenic
1174178859 20:48662464-48662486 TGAGGCTCAGAGAGGCTAAAGGG - Intronic
1174181328 20:48676751-48676773 TGACTCTCACAGAGTGGCAGGGG + Intronic
1174184855 20:48699176-48699198 TGAGGCTCAGAGACGGTCAGTGG + Intronic
1174188637 20:48724245-48724267 TGAGGCACAGAGAAAGGAAGTGG - Intronic
1174209064 20:48862571-48862593 TGAAGCCTGGAGAGGGGAAGTGG - Intergenic
1174267842 20:49344864-49344886 TGAGGCTCAGAGAAGGGAAGTGG - Intergenic
1174272689 20:49381107-49381129 AGAGGCTCAGAGAGGGGGAGTGG - Intronic
1174286342 20:49476474-49476496 TGACACTCAGAGAAGGAAAGGGG + Intronic
1174290301 20:49503654-49503676 TGAGGGTCAGAGAGGTGAAGTGG - Intergenic
1174296272 20:49547480-49547502 AGAGGCTCAGAGAGGGAAAGAGG + Intronic
1174357454 20:50008180-50008202 TGACGCTCCAAGAGGTTAAGAGG - Intergenic
1174407778 20:50313181-50313203 TAAGACCCAGAGAGGGGAAGGGG + Intergenic
1174574103 20:51524791-51524813 TGAGGCCCAGAGCGGGGAAAAGG + Intronic
1174742612 20:53030120-53030142 TGAGGCACAGAGAGAGGAAGTGG + Intronic
1175085769 20:56457347-56457369 TGAAGCTCAGAGAAGAGAAAAGG - Intronic
1175316625 20:58053300-58053322 TGAGGCTCAGAGAGGTTAAGAGG + Intergenic
1175573534 20:60042205-60042227 TGAGGCTCAGAGAGGGCAAGTGG + Intergenic
1176891278 21:14322341-14322363 TAAAACTCAGAGAGGGTAAGTGG - Intergenic
1176913139 21:14592500-14592522 TGAAGTGCAGAGAGGAGAAGTGG - Exonic
1178904416 21:36624700-36624722 TGAGGCACAGAAAGGGGAAGTGG + Intergenic
1178922826 21:36750167-36750189 TGAGGCTCCGGCAGGGGAAGAGG + Intergenic
1179149643 21:38799007-38799029 TCACGCTCCGAGTGGAGAAGGGG + Intergenic
1179789812 21:43749805-43749827 TGCCGCCCTGTGAGGGGAAGAGG + Intronic
1180012160 21:45058482-45058504 TGGGGCTCAGGGAGGGGGAGGGG + Intergenic
1180636718 22:17267698-17267720 TGAGGCTCGGAGAGGGTAGGAGG + Intergenic
1180956700 22:19744457-19744479 TGACCCTTAGAGAGGGAATGGGG - Intergenic
1181343003 22:22198039-22198061 TGGCGCTCAGGGAGGAGATGGGG - Intergenic
1181772464 22:25135973-25135995 TGAGGCTCAGGAAGGTGAAGTGG + Intronic
1181785166 22:25221589-25221611 TGAGTCCCAGAGAGGGGCAGGGG - Intronic
1181853337 22:25765587-25765609 TGAGGCCAAGAAAGGGGAAGGGG - Intronic
1181892092 22:26072260-26072282 TAAGGCTCAGAGAGGTGAAGTGG + Intergenic
1181892969 22:26080661-26080683 TGAGGCTGAGAGATGGGAAGAGG - Intergenic
1181908921 22:26222318-26222340 TGAGGCACAGAGAGGTTAAGTGG + Intronic
1181910865 22:26237123-26237145 TGAGGCTCAGGGAGGGGAAGTGG - Intronic
1181916570 22:26285890-26285912 TGAGGTTCAAAGAGGGGAAGCGG - Intronic
1182022860 22:27095765-27095787 GGAGGCTCAGAGAGGTTAAGTGG + Intergenic
1182070601 22:27461064-27461086 AGAAGTCCAGAGAGGGGAAGTGG - Intergenic
1182071448 22:27466592-27466614 TGAGGCACAGAGAGGTGAAGAGG - Intergenic
1182075663 22:27493775-27493797 TGAGGCTCAGAGAGGGGAAGTGG + Intergenic
1182100478 22:27654347-27654369 TGAGGCCCAGAGAGGGAAAGGGG + Intergenic
1182362086 22:29752586-29752608 TGAGGCCCAGAGAGGGCAAGTGG - Intronic
1182428593 22:30287603-30287625 TGAGGCTCAGAGAGGGGCAGGGG - Intronic
1182430646 22:30297068-30297090 TGAGGGCCAGAGAGGGAAAGGGG - Intronic
1182768444 22:32775724-32775746 TGAGGCTCTGAGAGGTGGAGAGG - Intronic
1182778405 22:32848392-32848414 TGAGGCTCAGAAAGAGGAAGTGG + Intronic
1182785588 22:32905018-32905040 TGAAGCTCAGAGAGGGGAAGGGG - Intronic
1182885334 22:33768995-33769017 TGAGGAGCAGAGAGGAGAAGGGG - Intronic
1183035772 22:35140004-35140026 TGAGGCTCAGAGAGAGGACGTGG + Intergenic
1183208641 22:36436192-36436214 TGAGACTCAGAGAGGTCAAGTGG + Intergenic
1183259443 22:36784992-36785014 GGACTCTCAGAGAGGAGAGGTGG + Intergenic
1183280859 22:36931612-36931634 TGAAGCTCAGAGAGGTTGAGTGG + Intronic
1183314541 22:37129611-37129633 TGAGGCCCAGAGAGGTGCAGGGG - Intronic
1183430605 22:37763280-37763302 TGAAGCTCAGAGGGGGCGAGGGG + Intronic
1183440937 22:37822809-37822831 TGAGGCCCAGAGAGGGGACATGG - Intergenic
1183475684 22:38034609-38034631 TGAGGCTCAGAGAGGGGTCCAGG - Intronic
1183515993 22:38266414-38266436 TGAAGCTCAAAGAGGGCAAGTGG + Intronic
1183544800 22:38449741-38449763 TGAGGCTCAGCAAGGGGAAGTGG - Intronic
1183546900 22:38459168-38459190 TGACACACAGAGAGGGGAAGTGG + Intergenic
1183547952 22:38465428-38465450 TGAGGCCCAGAGAGGGGACGTGG + Intergenic
1183654462 22:39176730-39176752 TGAGTCCCAGAGAGGGGAAGTGG - Intergenic
1183775894 22:39965010-39965032 TGAGGCTCACAGAGGTGCAGGGG - Intronic
1183971716 22:41482379-41482401 AGAGGCTCAGAGACAGGAAGGGG - Intronic
1184035388 22:41915470-41915492 CGAGGCGCCGAGAGGGGAAGGGG - Intergenic
1184091380 22:42294745-42294767 TGAGGCTCAGAGGTGGGCAGTGG + Intronic
1184115567 22:42419897-42419919 TGAGGCTCAGAGAAGGCAAGAGG + Intronic
1184278768 22:43425657-43425679 CGAGCCCCAGAGAGGGGAAGGGG + Intronic
1184331458 22:43830510-43830532 TGTGGCTCAGAGAGGTGAAGTGG - Intronic
1184337284 22:43861511-43861533 AGAGGCTCAGAGAGGGGAAGAGG - Intronic
1184380207 22:44140644-44140666 TGAGGAGCAGAGAGAGGAAGGGG - Intronic
1184416955 22:44357805-44357827 GGAGGCTCAGAGAAGGCAAGGGG - Intergenic
1184455655 22:44608272-44608294 AGAGGCTCAGACAGGGGAAGAGG - Intergenic
1184458778 22:44625706-44625728 TGAGGCTCAGGGAGGGGAAGGGG - Intergenic
1184514405 22:44953091-44953113 TGGGCCTCAGAGAGAGGAAGGGG - Intronic
1184562960 22:45274021-45274043 TGGAGCCCAGAGAGGGGAAGTGG - Intergenic
1184642117 22:45878327-45878349 TGGCGCTCAGAAGGGGGAAGGGG - Intergenic
1184684916 22:46091905-46091927 TGAGGCTCAGAGCCGGGGAGGGG - Intronic
1184760529 22:46541347-46541369 TGACTCTCAGGGCGGGGAGGGGG + Intergenic
1184799186 22:46749826-46749848 TGATGCTCAGAGAGGGGGCTGGG + Intergenic
1185317032 22:50183741-50183763 TTATGCTCAGGGAGGGGGAGGGG - Intergenic
949343442 3:3053406-3053428 TGAGGCTCTGAAAGGTGAAGTGG + Intronic
949454028 3:4219342-4219364 TGAGGCTCAGGGAAGTGAAGTGG + Intronic
950045057 3:9944149-9944171 TGAGGCTCAGAGAGGTAAAGGGG - Intronic
950053880 3:10010771-10010793 TGACCCTCAGGGTGGGGAGGGGG - Intronic
950110223 3:10413973-10413995 TGTAGCTCAGAGAAGGGAATTGG - Intronic
950110478 3:10415442-10415464 TGAGGCCCAGAGAAGAGAAGTGG - Intronic
950156326 3:10724110-10724132 TGAGGCTCAGAGAGGGCTGGGGG + Intergenic
950190163 3:10970977-10970999 TGAGGCTCAGGGAGGAGCAGGGG + Intergenic
950198127 3:11023725-11023747 TGAGGCTCAGAGAGATGAAATGG - Intronic
950211995 3:11130465-11130487 GGACGCTTTGAGAGTGGAAGTGG - Intergenic
950315259 3:11996362-11996384 AGAAGCTCAAAGAGGGGAAGAGG - Intergenic
950362507 3:12459626-12459648 TGAGGGCCAGAGAGGAGAAGGGG - Intergenic
950437054 3:12986433-12986455 TGAGGCTCACAGAGGGGCTGAGG - Intronic
950448891 3:13054673-13054695 TGAGGCGCAGAGAAGTGAAGAGG + Intronic
950450006 3:13060160-13060182 TGGGGCTCAGAGAGGTAAAGGGG + Intronic
950454975 3:13087428-13087450 TGAGGCTGAGAGAAGCGAAGGGG - Intergenic
950459608 3:13113379-13113401 TGAGGCCCAGAGAGGTCAAGGGG - Intergenic
950626935 3:14254142-14254164 TGAGGCACAGAGATGGCAAGTGG - Intergenic
950657830 3:14448026-14448048 TGAGGCTCAGAAAGGAGGAGTGG - Intronic
950674896 3:14548773-14548795 TGAGGTCGAGAGAGGGGAAGGGG + Intergenic
951855099 3:27187217-27187239 TGTCGATGAGAGAGGGGCAGGGG - Intronic
952291191 3:32017714-32017736 TGAGGCTCAGAGAAGTGAAATGG - Intronic
952306977 3:32155256-32155278 TGAGGCTCAGAGAGGTTTAGTGG - Intronic
953914132 3:46907006-46907028 TGAGGCTCAGAGAGGGAAGGTGG - Intergenic
953930548 3:47003690-47003712 TGACTCCCAGAGATGGGGAGGGG - Intronic
954331728 3:49894716-49894738 GGAGGCTCAGAGAGGTTAAGTGG + Intronic
954422012 3:50423825-50423847 TGGCCCTCAGAGATGGGAGGTGG + Intronic
954456968 3:50604885-50604907 CGAGGCTCAGAGCAGGGAAGGGG - Intergenic
955411766 3:58660179-58660201 AGACACTCAGAGACTGGAAGTGG + Intronic
955815252 3:62835635-62835657 TGAACCTCAAAGAGGGGACGTGG + Intronic
956209610 3:66789529-66789551 TGACTTACAGAGTGGGGAAGAGG + Intergenic
956444567 3:69313354-69313376 TGAGGCTCAGAGAGGGAACCAGG + Intronic
956641549 3:71420414-71420436 TGATGCTCAGAGAGGTGAAGTGG - Intronic
956700013 3:71950672-71950694 TGAGGCTCAGAGAGGTGAAGTGG - Intergenic
956720121 3:72110149-72110171 GGAGGCTCAGAGAGGAGAAGTGG - Intergenic
956770708 3:72523576-72523598 TAACTCTCAGGGAGGGAAAGAGG - Intergenic
956966611 3:74469176-74469198 TGAGGCCCAGAGAGGACAAGAGG + Intronic
957072554 3:75578453-75578475 TAAGGCTCAGAGAGGGTAAGTGG + Intergenic
960403475 3:117231794-117231816 TGAAGCACAGGGAGGGGAAGAGG - Intergenic
960536235 3:118817397-118817419 TGAGGCTCAGAAAGGTCAAGTGG + Intergenic
960836931 3:121916380-121916402 TGAGGCTCAGAGTGGAGAACAGG - Intronic
961109450 3:124271552-124271574 GGAAACTCAGAGAGGTGAAGTGG + Intronic
961165708 3:124762407-124762429 TGATTCTCAGAGAGGGGAAGTGG - Exonic
961281523 3:125768299-125768321 TAAGGCTCAGAGAGGGTAAGTGG - Intergenic
961424202 3:126832133-126832155 TGAGGCTCAGAGAGGCAAGGCGG + Intronic
961770999 3:129249832-129249854 TGAGGCCCAGTGAGGGGCAGGGG + Intronic
961820292 3:129572455-129572477 TGAGGCTCAGAGAGGAGAAGGGG + Intronic
961872846 3:130001281-130001303 TAAGGCTGAGAGAGGGTAAGTGG + Intergenic
962637445 3:137345594-137345616 GGAGGCTGAGAGAGGAGAAGGGG + Intergenic
962956160 3:140268822-140268844 TGAGACTCTGAGAGGGCAAGTGG - Intronic
963103286 3:141625050-141625072 TGCTGCCCAGAGAGGGTAAGTGG + Intergenic
964404970 3:156339466-156339488 TGAGGTTCAGAGAAGTGAAGTGG + Intronic
965557894 3:170036686-170036708 TGACACTCAGAGAGGTTGAGAGG + Intergenic
965815433 3:172631576-172631598 CGAGGCCCAGAGATGGGAAGTGG + Exonic
966710381 3:182966504-182966526 TTCTTCTCAGAGAGGGGAAGAGG + Intronic
967090354 3:186129763-186129785 TGAAGCTCACAGAGGCTAAGGGG + Intronic
967135554 3:186509967-186509989 TGAGGTACAGAGAAGGGAAGGGG + Intergenic
967479111 3:189954136-189954158 TGAAGCTCACAAAAGGGAAGAGG - Intergenic
967666357 3:192177180-192177202 TGAGGCTCAGAGAGGTTAACTGG - Intronic
967840991 3:194004252-194004274 TGAGGCTCAGAGAAGGGCAGTGG - Intergenic
967936312 3:194730658-194730680 TGACTGGCAGAGAAGGGAAGAGG + Intergenic
967967813 3:194975759-194975781 TGAGGCTTAGAAAAGGGAAGTGG - Intergenic
968149159 3:196323464-196323486 TGAGGCTCACAGAGGGTAACAGG - Intronic
968232914 3:197014999-197015021 TGAGATTCAGAAAGGGGAAGGGG + Intronic
968392853 4:207074-207096 TTAGGCTCAGAGAGGGGCAAAGG + Intergenic
968438703 4:610470-610492 TGACCCACAGAGAGTGGCAGAGG + Intergenic
968684887 4:1951301-1951323 TGACGGTGAGATTGGGGAAGGGG - Intronic
968830069 4:2928716-2928738 TGAGGCTCTGAGAGGACAAGGGG - Exonic
969016158 4:4105788-4105810 TAAGGCTCAGAGAGGGTAATTGG + Intergenic
969056883 4:4407790-4407812 TGTGGCTCAGAGAGGTTAAGGGG + Intronic
969155231 4:5204316-5204338 TGAGGCTCAGATAAGGGAAGTGG + Intronic
969351554 4:6600882-6600904 TGAGGCTCAGAGAAGCAAAGTGG + Intronic
969581285 4:8067070-8067092 CGAGGCTCAGAGAGGCGAGGGGG + Intronic
969703434 4:8780033-8780055 TGAGGCCCAGAGAGGGGAAGGGG + Intergenic
969718577 4:8880510-8880532 TGAGGCTCGGAGAGGCCAAGTGG - Intergenic
969737795 4:9002560-9002582 TAAGGTTCAGAGAGGGTAAGTGG - Intergenic
969796999 4:9534121-9534143 TAAGGCTCAGAGAGGGTAAGTGG - Intergenic
969962499 4:10959419-10959441 AGACTCACAGAGAGGGGAAAGGG + Intergenic
971241164 4:24890163-24890185 TGAAGCACAGAGTGGGGGAGTGG - Intronic
971343231 4:25789657-25789679 TGAAGCCCAGAGATGGGAAAGGG - Intronic
971365013 4:25970594-25970616 CCAGGCTGAGAGAGGGGAAGTGG + Intergenic
972385441 4:38561366-38561388 TGAGGATCAGAAAGGCGAAGTGG + Intergenic
972704366 4:41527506-41527528 TGACGCTGACAGTGGTGAAGAGG - Intronic
977585733 4:98773661-98773683 TGAAGCTCAGAGAAGTGAAATGG + Intergenic
978769493 4:112439573-112439595 TGAAGCTCAGAGAAGCAAAGTGG + Intronic
981359002 4:143826052-143826074 TGAGGCAGAGAGAGGAGAAGAGG + Intergenic
981369783 4:143946939-143946961 TGAGGCAGAGAGAGGAGAAGAGG + Intergenic
982374327 4:154672975-154672997 TGAGGCTTAGAGAGGTGAAGTGG + Intronic
983071470 4:163272559-163272581 TGAGGCTCAGAAAAGGTAAGTGG + Intergenic
983723643 4:170891568-170891590 TGAGGCTCAGAGAGGTTAAGTGG - Intergenic
984677224 4:182563447-182563469 TTAGGCTTAGAGAGGGGAAGGGG + Intronic
984713183 4:182903082-182903104 TGACCCTGTGAGATGGGAAGGGG - Intronic
984998766 4:185464266-185464288 TGAGGGTCAGAGAGCAGAAGGGG - Intronic
985233606 4:187848955-187848977 GGAGGCTCAGAGAGGGGCAGGGG - Intergenic
987416209 5:17664097-17664119 TGGCACTCACAGAGAGGAAGAGG - Intergenic
988975928 5:36515707-36515729 TGACGCTGAGAGAGGTGGAGAGG - Intergenic
992508357 5:77409551-77409573 TCTGGCTCAGGGAGGGGAAGGGG + Intronic
992734563 5:79705813-79705835 TGAGGCTCAAAGAGGTCAAGTGG - Intronic
993635481 5:90337852-90337874 TAACACTTAGAGAGGGCAAGAGG - Intergenic
994084825 5:95746747-95746769 TGAGGCTCAGAGAGGTTATGTGG - Intronic
996032739 5:118724088-118724110 TGAGGTTCAGAGAGCTGAAGTGG - Intergenic
996419609 5:123247887-123247909 TGAGGTTCAGAGAGGTAAAGTGG + Intergenic
996946690 5:129078940-129078962 TGAGGCTCAGAGAGGTGTAATGG - Intergenic
997363872 5:133312952-133312974 TGGGGTTCAGAGAGGGGAAGTGG + Intronic
997465400 5:134084618-134084640 TGAGGCACAGAGAGTTGAAGTGG - Intergenic
998374222 5:141680712-141680734 TGAGGCCCAGAGAGGGGAAGGGG + Intronic
999134857 5:149311828-149311850 TGAGGCCCAGAGCAGGGAAGTGG + Intronic
999151847 5:149431517-149431539 TGAGGCTCAGAGAGGTAAAGTGG + Intergenic
999240692 5:150125674-150125696 TGAGGCCCAGAGAGGGGCAGGGG + Intronic
999261322 5:150240687-150240709 TGAGGCCCAGAGAGGTGCAGTGG + Intronic
999284351 5:150385397-150385419 TGAGGCTCAGAGAAGGCAAGTGG - Intronic
999314891 5:150576906-150576928 AGAGGCTCAGAGAGGGCAGGTGG - Intergenic
999327636 5:150652922-150652944 TGAGGCCCAGAGATTGGAAGAGG - Exonic
999368283 5:151037167-151037189 TGAGGCTCAGAGACCTGAAGGGG + Intronic
999437808 5:151577765-151577787 TGAGGCCCAAAGAGAGGAAGAGG + Intergenic
999539747 5:152558497-152558519 TGAAGTTTAGAGAGGGGAAAGGG - Intergenic
999637697 5:153639961-153639983 TGCAGCCCAGAGAGGAGAAGGGG + Intronic
999739681 5:154540766-154540788 TGAAGCCCAGAGAGGTTAAGTGG - Intergenic
1000026164 5:157361020-157361042 TGAGGCTCAGAGAGGGTAAGGGG - Intronic
1000289444 5:159856490-159856512 TGAGACTCAGAGAGGTTAAGTGG - Intergenic
1000351496 5:160356291-160356313 TGAGGCCCAGAGAGGGAAAAGGG - Intronic
1001207925 5:169781408-169781430 TGAAGCCCAGAGAGGTTAAGTGG - Intronic
1001327161 5:170737477-170737499 TGAAGCTCAGAGAGGTAAGGGGG + Intergenic
1001481312 5:172091020-172091042 TGAGGCTCAGACAGGACAAGAGG - Intronic
1001490160 5:172149367-172149389 TAAGGCTCAGGGAGGGAAAGTGG - Intronic
1001543641 5:172556594-172556616 TTAGGCTCAGAGAGGCGAAGTGG - Intergenic
1001557126 5:172644276-172644298 CGAGGCTCAGAGAGGTAAAGTGG + Intronic
1001559003 5:172657187-172657209 TTAGGCCCAGAGAGGGTAAGGGG - Intronic
1001603399 5:172943650-172943672 TGAGGCTCAGAGAGGTAAACTGG + Intronic
1001717198 5:173825835-173825857 TGAGGCTCAGTGAAGTGAAGAGG + Intergenic
1001724953 5:173888774-173888796 GGAGCCGCAGAGAGGGGAAGAGG + Exonic
1001734486 5:173987958-173987980 GGAGGCTCAGAGAAGGAAAGGGG + Intronic
1001801887 5:174551674-174551696 TGAGGTTCCGAGAGAGGAAGTGG - Intergenic
1001865943 5:175105489-175105511 TGAGGCACAGAGAGGGGAAGTGG - Intergenic
1001923462 5:175618555-175618577 CAAGGCTCAGAGAGGGGAAACGG + Intergenic
1001929640 5:175663869-175663891 TGAGGCTCAGAGAGGGGAGGTGG - Intronic
1001953051 5:175829549-175829571 AGAGGCTCAGAGAGGGCAAGTGG - Intronic
1001965629 5:175908094-175908116 TGAGGCTCAGGGAGGTGGAGCGG - Intergenic
1002027816 5:176407238-176407260 CGAAGCTCAGAGAGGTGAAGTGG - Intronic
1002251319 5:177931101-177931123 TGAGGCTCAGGGAGGTGGAGCGG + Intergenic
1003111909 6:3258279-3258301 TGAGTCTCAGAGAGGTTAAGGGG + Intronic
1003308181 6:4947162-4947184 TGACGCCAGGAGAGGGGATGGGG + Intronic
1003773380 6:9332981-9333003 TGATGTTCAGAGAGGTGAAATGG + Intergenic
1003889963 6:10555482-10555504 TGATGCTCAGACAGGGGATTTGG - Intronic
1003925661 6:10875289-10875311 TGAGGCTCAGAGAGGTTAAGTGG - Intronic
1004230325 6:13827255-13827277 TGGTGCTCTGAGAAGGGAAGTGG - Intergenic
1005631709 6:27714265-27714287 TGTAGCTTAGAGAGAGGAAGTGG + Intergenic
1005821906 6:29605755-29605777 TGAAGGGCAGAGAGGGGATGGGG - Intronic
1006109983 6:31738682-31738704 AGAAGCCCAGAGAGGGAAAGAGG - Intronic
1006322889 6:33330860-33330882 TGAGGCTGAGGGAGGGGAGGGGG + Intergenic
1006378281 6:33683769-33683791 TGAGGCTCAGAGAGGCTAAGGGG + Intronic
1006442854 6:34062930-34062952 TGAAGCTCAGAGAAGAGAAGTGG + Intronic
1006450811 6:34104748-34104770 TGAGGCTCAGAGATGTGAAGTGG - Intronic
1006778027 6:36611391-36611413 AGAAGCTCAGAGAGGACAAGTGG + Intergenic
1006782859 6:36643823-36643845 TGAGTCCCAGAGAGGTGAAGTGG - Intergenic
1006870699 6:37248593-37248615 TGAAGCTCAAAGAGAGGAAGAGG - Intronic
1006908906 6:37551165-37551187 TGAGACCCATAGAGGGGAAGTGG - Intergenic
1006921353 6:37629632-37629654 TGAGGCTCAGAAAGGTGATGTGG - Intergenic
1006922106 6:37633887-37633909 TGAAGCCCAGAGTGGGGAAGGGG - Exonic
1007246816 6:40469125-40469147 AGACACACAGAGAGGGGAAAAGG + Intronic
1007270727 6:40635076-40635098 TGAGGCCCAGAGAGGGTAGGTGG - Intergenic
1007272043 6:40645245-40645267 GGAAGCTCAGAGAAGGCAAGTGG - Intergenic
1007286349 6:40750469-40750491 TAAAGCTTAGAGAGGTGAAGTGG - Intergenic
1007382725 6:41501302-41501324 TGAGGCTCAGAGAGACTAAGAGG + Intergenic
1007493221 6:42240574-42240596 TGAGACCCAGAGAGAGGAAGGGG - Intronic
1007572650 6:42904284-42904306 TGAGGTTCAGGGAGGGGAAATGG + Intergenic
1007595672 6:43049850-43049872 TGGAGGTCAGAGAGTGGAAGGGG - Intronic
1007727867 6:43927551-43927573 TGAGGCCCAGAGAGGAGAAATGG - Intergenic
1007776334 6:44226420-44226442 TCACTCTTAGAAAGGGGAAGCGG + Intronic
1007814162 6:44508517-44508539 TGAGGCCCAGAGAGGGACAGTGG + Intergenic
1008279304 6:49576832-49576854 TGCTGCTCAGAGAGGCCAAGAGG + Intergenic
1008613036 6:53201715-53201737 TGCTGCTCAGAGAGGCCAAGAGG + Intergenic
1010083497 6:71888629-71888651 TGACACTCAGATAGGGGAGGGGG + Intronic
1012983212 6:105851466-105851488 TGCAACTCTGAGAGGGGAAGAGG + Intergenic
1013427984 6:110032509-110032531 AGACCCTGAGAGAGGGGAGGAGG + Intergenic
1014054571 6:116999053-116999075 TGTCTCTAAGAGAGGGTAAGGGG - Intergenic
1014094665 6:117446857-117446879 TAACGCTCAGGGAGGGAAGGGGG - Intronic
1018116411 6:160590208-160590230 TGTCTCTCAGAGAGGGGTACTGG + Intronic
1018394493 6:163367182-163367204 TGAGGCACAGAGAGGCTAAGTGG - Intergenic
1018911658 6:168104352-168104374 TGACGTTCAGAGAAGGGCAATGG - Intergenic
1019212753 6:170419686-170419708 TGATGCTCACAAAGGGGCAGAGG - Intergenic
1019267123 7:124185-124207 TGAGGCTCAGAGATGGGAAAAGG - Intergenic
1019492812 7:1323058-1323080 TGAGGCCCAGAGAGGCGCAGGGG + Intergenic
1019493093 7:1324115-1324137 TGAGGCTCAGAGGGGGGACGCGG + Intergenic
1019494854 7:1332948-1332970 TGAGGCTCAGCGAGGGTAAGCGG - Intergenic
1019498022 7:1349541-1349563 TGAGGCTCAAAGAGGGGAGGGGG - Intergenic
1019770875 7:2883045-2883067 TGAGGCTCAGAGGCGGGAAGTGG - Intergenic
1019778901 7:2928421-2928443 TGAGGCTCAGAGGAGGGAAGCGG - Intronic
1020262442 7:6537953-6537975 TGAGGCTCGGAGAGGTTAAGAGG - Intronic
1020590150 7:10125000-10125022 TGAAGCCCACAGAGGGCAAGTGG - Intergenic
1020617368 7:10476532-10476554 TGAGGCTCAGGGAGGGTAGGCGG - Intergenic
1022259749 7:28692560-28692582 TGTGGCACAGAGAGGTGAAGTGG - Intronic
1022891833 7:34708963-34708985 TGAGGCTCAGAGAGGGTAAGTGG + Intronic
1023608826 7:41954396-41954418 TGACTCCTGGAGAGGGGAAGGGG + Intergenic
1024548846 7:50543709-50543731 TGAGGCTCAGAGAGGTTAGGTGG - Intronic
1024863855 7:53880481-53880503 TGACTCTCAGGGAGTAGAAGTGG + Intergenic
1025022208 7:55488763-55488785 TGCTGGTCTGAGAGGGGAAGTGG - Intronic
1025631316 7:63275350-63275372 TGTGGCTCAGAGTGGGGTAGAGG + Intergenic
1025827711 7:65024170-65024192 TGTGGCTCAGAGTGGGGTAGAGG - Intergenic
1025915246 7:65860624-65860646 TGTGGCTCAGAGTGGGGTAGAGG - Intergenic
1026777594 7:73240404-73240426 TGAAGCTCAGAGTGGCTAAGTGG - Intergenic
1026863845 7:73810770-73810792 GGCGGCTAAGAGAGGGGAAGGGG + Intronic
1026964661 7:74431434-74431456 TGAGGCTCTGAGAGGGGAGGTGG + Intergenic
1027018449 7:74793776-74793798 TGAAGCTCAGAGTGGCTAAGTGG - Intergenic
1027069580 7:75152142-75152164 TGAAGCTCAGAGTGGCTAAGTGG + Intergenic
1027236074 7:76298698-76298720 TGAGGCTCAGAGAAGGCATGAGG + Intergenic
1028456690 7:91045460-91045482 TGATGCTCAGACAGAGGATGTGG + Intronic
1029074824 7:97927433-97927455 TAAGGCTCAGAGAGGGTAAGTGG + Intergenic
1029481870 7:100818362-100818384 TGAGGCTCAGACAGGCCAAGGGG + Intronic
1029666550 7:101998790-101998812 TGACGTTTAGAGGGAGGAAGTGG - Intronic
1029705337 7:102273006-102273028 TGAGGCCCAGAGAGGGAAAGGGG + Intronic
1030468241 7:109930065-109930087 TAACTCTCACAGAGGGGAAATGG - Intergenic
1030615726 7:111736265-111736287 TGACCCTGAGAGAGGTGAATGGG + Intronic
1032113659 7:129098712-129098734 CGAGGCTCAGAGATGTGAAGTGG - Intergenic
1033419087 7:141189910-141189932 TGAGGTTCAGAGAGGGGAATTGG + Intronic
1033485970 7:141789581-141789603 TGAGGCCCAGAGACGGGCAGTGG + Intergenic
1033486353 7:141792740-141792762 TGATGCCCAGAGAGGGGCAGTGG + Intergenic
1033995039 7:147335010-147335032 TGAAGCTCAGAGAGTTTAAGTGG + Intronic
1034345193 7:150381636-150381658 TGAGGCCCAGAGAAGGAAAGTGG + Intronic
1036242893 8:7093821-7093843 TAAGGCTCATAGAGGGTAAGTGG - Intergenic
1036257907 8:7220207-7220229 TAAGGCTCAGACAGGGTAAGTGG + Intergenic
1036259155 8:7227205-7227227 TAAGGCTCAGACAGGGTAAGTGG + Intergenic
1036307472 8:7612316-7612338 TAAGGCTCAGACAGGGTAAGTGG - Intergenic
1036309954 8:7678803-7678825 TAAGGCTCAGACAGGGTAAGTGG + Intergenic
1036311208 8:7685800-7685822 TAAGGCTCAGACAGGGTAAGTGG + Intergenic
1036358316 8:8060300-8060322 TAAGGCTCAGAGAGGGTAAGTGG - Intergenic
1036359579 8:8067299-8067321 TAAGGCTCAGAGAGGGTAAGTGG - Intergenic
1036692257 8:10951386-10951408 TGCAGCTCAGAGAGGGGAATGGG + Intronic
1036829838 8:12013323-12013345 TAAGGCTCAGAGAGGGTAAGTGG + Intronic
1036891378 8:12599653-12599675 TAAGGCTCAGAGAGGGTAAGTGG + Intergenic
1036898931 8:12657615-12657637 TAAGGCTCATAGAGGGTAAGTGG + Intergenic
1036900186 8:12664629-12664651 TAAGGCTCAGAGAGGATAAGAGG + Intergenic
1037835163 8:22211314-22211336 TGAGGCCCAGAGATGGGAGGTGG + Intronic
1037858862 8:22390632-22390654 TGACGAACACAAAGGGGAAGAGG - Intronic
1037884045 8:22586983-22587005 TGAGGCCCAGGGAGAGGAAGGGG - Intronic
1038380040 8:27084388-27084410 TGGGGCTCAGAGAGGGAGAGGGG - Intergenic
1038451510 8:27642444-27642466 TGAAACTCAGAGGAGGGAAGTGG + Intronic
1038617932 8:29112643-29112665 TCACCCTCAAAGAGGGGATGTGG - Intronic
1038747620 8:30268299-30268321 GGAGGCTCTGAGATGGGAAGGGG - Intergenic
1039246671 8:35616152-35616174 TGAGCCTCAGAGAGGTCAAGCGG + Intronic
1039502870 8:38030876-38030898 AGACGCACTCAGAGGGGAAGCGG - Intronic
1039833426 8:41236183-41236205 GGAGGCCCAGAGAGGGGAAGCGG - Intergenic
1043142671 8:76609307-76609329 TGAGACTCAGAGAAGGGAAAGGG + Intergenic
1043571641 8:81610267-81610289 TGAGGCTCAGAGAGGTGATGTGG - Intergenic
1044477053 8:92639349-92639371 TGAGGCACAGAGAAGGGAAAGGG - Intergenic
1045370201 8:101515320-101515342 TCAGGCTGGGAGAGGGGAAGAGG - Intronic
1045548348 8:103148307-103148329 GGAAGCTCAGAGAGAGGCAGGGG + Intronic
1046907458 8:119588976-119588998 TGAGGCTCAGAGAGGGGTGAGGG - Intronic
1047403000 8:124561769-124561791 TGAAGCACACAGCGGGGAAGAGG + Intronic
1047501155 8:125442643-125442665 TGAGGCTCAGAGAGGGTAGGTGG + Intergenic
1047594771 8:126367305-126367327 CAAGGCTCAGAGAGGTGAAGTGG - Intergenic
1048188374 8:132265012-132265034 TGTGGCTCAGAGAGGTTAAGTGG - Intronic
1048198083 8:132349172-132349194 TGATGCTCAGGGAGGTGAAGTGG + Intronic
1048252085 8:132875031-132875053 TGAGGCTCTGAGAGAGTAAGTGG - Intronic
1048268173 8:133005615-133005637 TGAGGCTCAGAGAAGGGGAGTGG + Intronic
1048348211 8:133594326-133594348 GGAGGATCAGAGAGGTGAAGTGG - Intergenic
1048609839 8:136010223-136010245 TTAGGCTCAGAGAGGGTAGGTGG - Intergenic
1048837053 8:138529817-138529839 TGAAGCTCAGAGATGGGTGGTGG - Intergenic
1048842750 8:138579673-138579695 TGAAGCCCAGAGAAGAGAAGGGG - Intergenic
1049195642 8:141314243-141314265 TGAGGCTCAGGGAGGGGATGGGG - Intergenic
1049204012 8:141355010-141355032 TGCTGCTCAGAGAGGGGCCGTGG - Intergenic
1049204086 8:141355317-141355339 TGAGGCTCAGAGGGAGAAAGGGG - Intergenic
1049225150 8:141447026-141447048 TGAGGCTCAGAGAGGGTCAGAGG - Intergenic
1049258791 8:141627826-141627848 TGAGGCCCAGAGAGGGGATACGG - Intergenic
1049320330 8:141992768-141992790 TGAGGCTCAAGGAAGGGAAGGGG - Intergenic
1049444335 8:142623147-142623169 TGAGGCACAGAGAAGGCAAGGGG + Intergenic
1049888310 9:43493-43515 TGAAGCTCAGAGAAGTGAAGTGG - Intergenic
1050055428 9:1648126-1648148 GGACTCTGAGAGAGGGAAAGAGG + Intergenic
1050413328 9:5388756-5388778 TGAAGCACAGAGAGGTTAAGTGG - Intronic
1050482044 9:6097481-6097503 TGAGGCTCAGAATGGGGAAGGGG - Intergenic
1051833104 9:21302956-21302978 TGAGGCTCAGAGAGATTAAGTGG + Intergenic
1052977369 9:34421181-34421203 AGCAGGTCAGAGAGGGGAAGGGG + Intronic
1053202909 9:36164911-36164933 TGAAGCCCAGGGAGAGGAAGAGG - Intergenic
1053364248 9:37511548-37511570 TGAGGCCCAGAGGGGGAAAGAGG + Exonic
1053413416 9:37930275-37930297 TGAGGCTCAGAGAAGGGCAGAGG + Intronic
1053427799 9:38022488-38022510 TGACCCTCAGAGCTGGGGAGAGG - Intronic
1053443845 9:38136497-38136519 AGAGGTTCAGAGAGAGGAAGGGG + Intergenic
1055500461 9:76897724-76897746 TGAGGCTCAGTGAGGTTAAGAGG - Intronic
1055721030 9:79175075-79175097 AGACACACAGAGAGGAGAAGAGG - Intergenic
1056493186 9:87128403-87128425 TGACACAGAGAGTGGGGAAGGGG + Intergenic
1056507310 9:87269416-87269438 TGAGGCTCAGAGAGGTTAAGTGG + Intergenic
1056942029 9:90964274-90964296 TGAGGCTCAGGAAGGGGAAGTGG + Intergenic
1057082396 9:92182438-92182460 TGAGGCCCAGAGAGGAAAAGTGG - Intergenic
1057133492 9:92670443-92670465 TGAGGCTCAGAGACGCCAAGAGG - Intergenic
1057430871 9:94992674-94992696 TGAGCCTCAGAGAGGGCAAGTGG - Intronic
1057479259 9:95431714-95431736 TGAGGCTCAGAGAGGGTATCAGG - Intergenic
1057804423 9:98210353-98210375 TGCCTGTCAGAGAGGGGACGAGG - Intronic
1057857125 9:98610218-98610240 TGAGGCTCAGAGAGGTTAAATGG - Intronic
1058639566 9:107069668-107069690 TGAAGCACAGAGAAGTGAAGGGG + Intergenic
1059346691 9:113633776-113633798 AGAAGCTCAGAGAGGGGAAGTGG + Intergenic
1059415896 9:114162330-114162352 TGAGGCCCAGAGAAGGGGAGGGG + Intronic
1059433257 9:114262267-114262289 TGAGGCCCAGAGAGGAGATGGGG + Intronic
1059451143 9:114372161-114372183 TGAGGCTGAGAGAGGGGTTGGGG + Intronic
1059770383 9:117418096-117418118 TGAAGCTCAGTGAGGGGGAGAGG + Intergenic
1060210707 9:121708545-121708567 TGACGCTCAGAGAGGTGAAGGGG + Intronic
1060300538 9:122372174-122372196 TGAGGCCCAGAGAGGGCAGGAGG + Intronic
1060484570 9:124039043-124039065 GTAAGCTCAAAGAGGGGAAGGGG + Intergenic
1060529234 9:124338737-124338759 TGAGGCTCAGATGGGTGAAGAGG - Intronic
1060566795 9:124599763-124599785 TGAAGCTCAAAGAAAGGAAGAGG + Intronic
1060931455 9:127491892-127491914 TGAGGTTCAGAGAGGGGAAAGGG - Intronic
1060940453 9:127540322-127540344 TGAGGCTCAGAGAGGAGAGGAGG + Intronic
1061046496 9:128167924-128167946 TGAGGCTCAGAGAGGCCAAGTGG + Intronic
1061056162 9:128224120-128224142 TGAGGCCCAGAGAGGGGTAGTGG + Intronic
1061150882 9:128827327-128827349 TGAGGCCCAGAGAGGGGAGCTGG - Intronic
1061397706 9:130352622-130352644 TGAGGCCCAGAGAGGGGAAGTGG + Intronic
1061407605 9:130401089-130401111 TGGAGCTCAGAGAGGGCGAGAGG - Intronic
1061419090 9:130463647-130463669 TGAGGCTCAGAGAGGTGACAGGG + Intronic
1061448869 9:130658148-130658170 TGAGGCTCACAGAGGACAAGTGG + Intergenic
1061488347 9:130931711-130931733 TGAGGCCCAGAGAGGGCAAGGGG + Intronic
1061515620 9:131088285-131088307 TGAGGCTCAGAGAGGTGGAGTGG - Intronic
1061680502 9:132240619-132240641 AGTTGCCCAGAGAGGGGAAGGGG + Intronic
1061878115 9:133554927-133554949 TGAGGCTTAGAAAGAGGAAGTGG + Intronic
1062040063 9:134400469-134400491 TGAGGCCCAGAGAGGGAGAGTGG + Intronic
1062235950 9:135507691-135507713 CGAGGCTCAGAGGGGTGAAGGGG - Intergenic
1062268710 9:135699269-135699291 GGACCCTGGGAGAGGGGAAGGGG - Intronic
1062334821 9:136060504-136060526 TGACCCTCAGGGAGGGGAGAGGG - Intronic
1062600191 9:137315980-137316002 GGAGGCTCAGAGACGGGAGGGGG - Intronic
1186467349 X:9794043-9794065 TGCTCCTCAGAGCGGGGAAGAGG - Intronic
1186534068 X:10329208-10329230 TGGACCTCAGAGATGGGAAGTGG + Intergenic
1188630918 X:32358999-32359021 TGAGGCTCTGAGAGGTAAAGAGG + Intronic
1189302188 X:39960110-39960132 TGAGGGTCCGAGAGGGGAACTGG + Intergenic
1189328584 X:40129044-40129066 TGAGACTCAGAGAGGTTAAGCGG + Intronic
1190888377 X:54548659-54548681 TGAGGCTCAGAGAAGGGCAAAGG + Intronic
1191884476 X:65874506-65874528 GGAGGCTGAGAGAGGGGAAGAGG + Intergenic
1191948588 X:66563142-66563164 CGACTCTCAAAGAAGGGAAGGGG + Intergenic
1192142675 X:68659089-68659111 TGAGGCTTAGAGAAGAGAAGAGG - Intronic
1192161238 X:68789532-68789554 TGAGGCTCAAAGAAGAGAAGTGG - Intergenic
1192189850 X:68984092-68984114 TGAGGCCCAGAGAAGGCAAGAGG - Intergenic
1192191650 X:68994773-68994795 TGAGGCTCAGAGAGGGGAAGTGG + Intergenic
1192226878 X:69234993-69235015 TGAGGCTCAGAGAGGCAGAGGGG - Intergenic
1192246991 X:69380976-69380998 TGAGGATCAGAGAGGGAAAGTGG + Intergenic
1192321429 X:70093574-70093596 AAAGGCTCAGAGATGGGAAGAGG + Intergenic
1192554537 X:72079453-72079475 TGAGGCTCAGAAAGGGAAAGGGG - Intergenic
1192798331 X:74442964-74442986 TGACACTCCAAGAGGTGAAGTGG + Intronic
1194619512 X:96152235-96152257 TGGAGCCCAGTGAGGGGAAGTGG + Intergenic
1196700559 X:118663535-118663557 TGAGGCACAGTGAGTGGAAGTGG + Intronic
1197101106 X:122656028-122656050 TGTTGCTCGGAGAGGGGATGTGG - Intergenic
1197772234 X:130096648-130096670 TGAGGCCCAGAGAAGGGCAGCGG + Intronic
1198153734 X:133936363-133936385 TGAGGCTCAGACAGGTTAAGTGG + Intronic
1198513044 X:137373517-137373539 TGAGGCTCAGAGTGGGCAATTGG + Intergenic
1199467815 X:148159324-148159346 TGAGGTTCAGAGAGGTCAAGTGG - Intergenic
1199492586 X:148417320-148417342 TTAGGCTTAGAGAAGGGAAGCGG - Intergenic
1199689776 X:150299865-150299887 TGCAGCCCAGAGAGAGGAAGAGG - Intergenic
1199967375 X:152831315-152831337 TGAGACCCGGAGAGGGGAAGGGG + Intronic
1200101180 X:153689660-153689682 GGAGGCCCAGAGAGGAGAAGGGG + Intronic
1200157889 X:153987284-153987306 GGTCGGTGAGAGAGGGGAAGGGG - Intergenic
1200227735 X:154428478-154428500 TCACGCTCCGAGTGGGAAAGGGG - Intergenic