ID: 903189008

View in Genome Browser
Species Human (GRCh38)
Location 1:21646033-21646055
Sequence GGGAACTGACGCTCAGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1607
Summary {0: 1, 1: 3, 2: 69, 3: 406, 4: 1128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189008_903189016 -2 Left 903189008 1:21646033-21646055 CCCCTCTCTGAGCGTCAGTTCCC 0: 1
1: 3
2: 69
3: 406
4: 1128
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189008_903189011 -8 Left 903189008 1:21646033-21646055 CCCCTCTCTGAGCGTCAGTTCCC 0: 1
1: 3
2: 69
3: 406
4: 1128
Right 903189011 1:21646048-21646070 CAGTTCCCTCATCTGTAAAATGG 0: 37
1: 931
2: 4071
3: 9755
4: 16832
903189008_903189018 11 Left 903189008 1:21646033-21646055 CCCCTCTCTGAGCGTCAGTTCCC 0: 1
1: 3
2: 69
3: 406
4: 1128
Right 903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 290
903189008_903189017 10 Left 903189008 1:21646033-21646055 CCCCTCTCTGAGCGTCAGTTCCC 0: 1
1: 3
2: 69
3: 406
4: 1128
Right 903189017 1:21646066-21646088 AATGGGGATGGACAGTAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 172
903189008_903189012 -7 Left 903189008 1:21646033-21646055 CCCCTCTCTGAGCGTCAGTTCCC 0: 1
1: 3
2: 69
3: 406
4: 1128
Right 903189012 1:21646049-21646071 AGTTCCCTCATCTGTAAAATGGG 0: 30
1: 766
2: 3523
3: 8849
4: 15187
903189008_903189013 -6 Left 903189008 1:21646033-21646055 CCCCTCTCTGAGCGTCAGTTCCC 0: 1
1: 3
2: 69
3: 406
4: 1128
Right 903189013 1:21646050-21646072 GTTCCCTCATCTGTAAAATGGGG 0: 23
1: 594
2: 2828
3: 6721
4: 11858

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189008 Original CRISPR GGGAACTGACGCTCAGAGAG GGG (reversed) Intronic
900642284 1:3693536-3693558 GGAGACTGAGGCTCAGAGAGCGG - Intronic
900996163 1:6124676-6124698 GGGGACTGGGGCTCAGGGAGTGG + Intronic
901319541 1:8330954-8330976 GGGAGCTGAGGCTCAGAGGGTGG + Intronic
901504384 1:9675457-9675479 GGAAACTGAGGCACAGAAAGGGG + Intronic
901657358 1:10777111-10777133 GGAAACTGAGGCCCAGAGGGAGG - Intronic
901680116 1:10908167-10908189 AGACACTGAGGCTCAGAGAGGGG + Intergenic
901700958 1:11044620-11044642 GGGCACTGAGGCCCGGAGAGGGG - Intronic
901792281 1:11660611-11660633 GGAAACTGAAGCACAGAGAAAGG + Intronic
902235385 1:15053997-15054019 GGAAACTGAGGCTCAGAGGAGGG + Intronic
902293029 1:15447389-15447411 GGAAACTGAGGCCCAGAGAGAGG + Intronic
902374536 1:16024091-16024113 GGAGACTGAGGCCCAGAGAGGGG - Intronic
902387233 1:16082904-16082926 GGAAGCTGAGGCCCAGAGAGGGG - Intergenic
902388451 1:16089086-16089108 GGGAACTGAGGCCCCGAGAGGGG - Intergenic
902406814 1:16188838-16188860 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
902450223 1:16491924-16491946 GGACACTGAGTCTCAGAGAGAGG - Intergenic
902515053 1:16985735-16985757 GGGAACACAGGCCCAGAGAGGGG + Intergenic
902526645 1:17063003-17063025 GGAAACTGAAGCTCAGAGACAGG - Intergenic
902538819 1:17137954-17137976 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
902560420 1:17273860-17273882 GGAAACTGAGGCTCAGAGAGCGG - Intronic
902619186 1:17640501-17640523 GGAAGCTGAGGCTCAGAGAGGGG - Intronic
902668686 1:17956888-17956910 GGAAACTGAGGCTTAGAGATTGG + Intergenic
902702796 1:18184114-18184136 GGAAATTGAGGCACAGAGAGGGG - Intronic
902703042 1:18185894-18185916 AGAAACTGAGGCTCAGAGAGGGG - Intronic
902737876 1:18413287-18413309 GTAAACTGAGGCTCAAAGAGGGG - Intergenic
902756830 1:18554421-18554443 GGAAACTGAGGCACGGAGAGGGG + Intergenic
902776308 1:18676925-18676947 GGAAAATGCAGCTCAGAGAGGGG + Intronic
902791062 1:18768447-18768469 TGAAACTGAGGCCCAGAGAGGGG + Intergenic
902796603 1:18804534-18804556 GGAAACTGAGGCCCAGAGAAGGG + Intergenic
902806041 1:18861942-18861964 GGGGACTGAGACCCAGAGAGAGG - Intronic
902809022 1:18877814-18877836 GGAAACTGAGGCCCAGGGAGGGG + Intronic
903002298 1:20274940-20274962 GGAAACTAAGGCTCAGAGAAGGG - Intergenic
903004120 1:20287273-20287295 GGAGACTGAAGCACAGAGAGAGG + Intergenic
903012310 1:20339839-20339861 GGCAGCTGGGGCTCAGAGAGTGG - Intronic
903014109 1:20350764-20350786 GGGAACAGAGGCCTAGAGAGGGG - Intronic
903019131 1:20381350-20381372 GAAAACTGAGGCTCAGAGAAGGG - Intergenic
903027834 1:20442274-20442296 GGAAACTGAGGCACAGAGACGGG + Intergenic
903132372 1:21288838-21288860 GGAAACTGAGGCTCTGAGAGGGG - Intronic
903174146 1:21570597-21570619 AGAAACTGAAGCTCAGAGAGGGG + Intronic
903189008 1:21646033-21646055 GGGAACTGACGCTCAGAGAGGGG - Intronic
903189366 1:21648189-21648211 GTCAACTGAAGCCCAGAGAGGGG + Intronic
903193602 1:21669528-21669550 GGAAACTGAGGACCAGAGAGGGG + Intergenic
903233244 1:21934390-21934412 GGAAACTAAGGCTCAGAGAGAGG + Intronic
903235332 1:21946816-21946838 GGAAACTGAGGCTTAGTGAGAGG - Intergenic
903267433 1:22166278-22166300 GGAAGCTGAGGCTCAGAGACAGG + Intergenic
903283190 1:22261828-22261850 GGAAATTGAAGCTCAGAGAGGGG - Intergenic
903300397 1:22374660-22374682 GGATACTGAGGCCCAGAGAGGGG - Intergenic
903306144 1:22414633-22414655 GGCAACTGAGGCCCAGGGAGAGG - Intergenic
903334107 1:22613699-22613721 GTAAACTGAGGCTCAGGGAGAGG - Intergenic
903334523 1:22616098-22616120 GGAAACTGAAGGCCAGAGAGAGG + Intergenic
903342035 1:22660708-22660730 GGAGACTGAGGCTCAGAGAGAGG + Intronic
903351215 1:22717546-22717568 GGAAGCTGAGGCTCAGAGAGTGG - Intronic
903359184 1:22766233-22766255 GGAAACTGAGGTTCAGAGAGGGG - Intronic
903364088 1:22795157-22795179 AGGAACCGAGGCCCAGAGAGGGG + Intronic
903366829 1:22810488-22810510 GGGAACCCAGGCCCAGAGAGAGG - Intronic
903374034 1:22854597-22854619 GGAAACTGAGGCTCACAGAAAGG - Intronic
903377144 1:22873999-22874021 AGGAACCCAGGCTCAGAGAGAGG + Intronic
903462409 1:23529139-23529161 GGAAACTGAGGCTCAGAGAGGGG - Intronic
903465685 1:23551216-23551238 GGAGACTGAGGCTCAGAGAGGGG + Intergenic
903547854 1:24137994-24138016 GAGAAATGAGGCTCAGAGAGGGG + Intronic
903653329 1:24933989-24934011 GGAAATTGAGGCTCAGTGAGGGG - Intronic
903658047 1:24960799-24960821 GGAAACTGAGGCCCAGAGAGAGG + Intronic
903660303 1:24973041-24973063 GAGGACTCAGGCTCAGAGAGGGG + Intergenic
903678710 1:25082976-25082998 GGAAACTGAGGCTCAGAGAGAGG - Intergenic
903760151 1:25692061-25692083 GGAAACCAAGGCTCAGAGAGGGG + Intronic
903779637 1:25813050-25813072 GAAAACTGAGGCTCACAGAGGGG - Intronic
903889560 1:26560548-26560570 GAAAACTGAGGCCCAGAGAGGGG + Intronic
903943349 1:26946520-26946542 AGAAACTGAGGCCCAGAGAGGGG - Exonic
903945835 1:26961679-26961701 GGAAACTGAAGCTTAGAGAGGGG + Intergenic
903957906 1:27037785-27037807 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
904033176 1:27545837-27545859 GGAAACTGAGGCCCAGAGAGGGG + Intronic
904047396 1:27616778-27616800 GGGAACTGAGGCCCAGAGAAGGG - Intronic
904137689 1:28326662-28326684 GGAAGCTGAGGCTCAGGGAGGGG + Intergenic
904208352 1:28869587-28869609 GGAAACTGAGGCTCAGAGAAGGG + Intergenic
904280169 1:29413418-29413440 GGAAACTGAGGCCCAAAGAGGGG + Intergenic
904280968 1:29418006-29418028 GGAAACTGAGGCTCAGATAAAGG - Intergenic
904282035 1:29427410-29427432 GGAAACTGAGGCACAGAGGGTGG + Intergenic
904306019 1:29590829-29590851 GGAAACTGAGACTCAGAGAGGGG - Intergenic
904318119 1:29679329-29679351 GGAAACTGAGGCTCTGAGGGTGG - Intergenic
904356459 1:29943230-29943252 GAAAACTGAGGCCCAGAGAGGGG + Intergenic
904361593 1:29976733-29976755 GAAAACTGAGGTTCAGAGAGGGG - Intergenic
904401171 1:30257678-30257700 GGAAACTGAGGCTCAGGAAGGGG - Intergenic
904440644 1:30527278-30527300 GGCAAGTGAGGCTCAGTGAGAGG + Intergenic
904474467 1:30756054-30756076 GGAAACTGAGGCCCAGAGAGAGG + Intronic
904474888 1:30758336-30758358 AGAAACTGAGGCACAGAGAGGGG + Intergenic
904495378 1:30883723-30883745 GGAAACTGAGGCACAGAGAGGGG + Intronic
904535913 1:31199275-31199297 GAAAACTGAGGCTCAGAGAGGGG - Intronic
904586469 1:31583712-31583734 GGGAACAGAGGCCCAGAGAAGGG - Intronic
904613156 1:31736182-31736204 GGAAACTGAAGCTCAGAAATGGG + Intronic
904616933 1:31755043-31755065 GGAAACTGAGGCCCAGAGAGAGG + Intronic
904625637 1:31800353-31800375 TGTCACTGAGGCTCAGAGAGAGG - Intronic
904629893 1:31833105-31833127 GGAAACTGAGGCTCAGAGAGGGG - Intergenic
904809250 1:33152748-33152770 GGAAACTGGGGCTCTGAGAGGGG + Intronic
904823300 1:33258526-33258548 AGGAACTGAGGTCCAGAGAGAGG + Intronic
904824389 1:33265233-33265255 GGGCACTGAGGCTCCCAGAGAGG + Intronic
904826108 1:33274821-33274843 AGAAACTGAGGCTCAGAGAGAGG - Intronic
904944574 1:34189841-34189863 TGAAACTGAGGCTCAGAGAAGGG + Intronic
905123676 1:35702320-35702342 GGGAAAGGAGGCTCAGAAAGGGG + Intergenic
905174813 1:36128550-36128572 GGGAACTAAATCCCAGAGAGGGG - Intergenic
905295585 1:36952341-36952363 GGGAACAGAGGCACAGAGATGGG - Intronic
905416407 1:37807702-37807724 GGAGACTGAGGCGCAGAGAGCGG - Intronic
905665958 1:39763240-39763262 GGGCCCTGAGGCTCAGGGAGGGG - Intronic
905793865 1:40804398-40804420 GGAAACTGAGTCCCAGAGAGGGG - Intronic
905851216 1:41276494-41276516 GGAAACAGAGGCACAGAGAGGGG - Intergenic
905873881 1:41419931-41419953 GCAAAATGAGGCTCAGAGAGAGG + Intergenic
906077998 1:43066356-43066378 GGAAACTGAGGCTTAGAAAGGGG - Intergenic
906646302 1:47477992-47478014 GGAAACTGAGGGTCAGAAAGGGG - Intergenic
906652452 1:47522340-47522362 GGAAACAGAGGCCCAGAGAGGGG + Intergenic
906666626 1:47626701-47626723 GGAAACTGAGTCCCAGAGAGAGG + Intergenic
906679826 1:47718678-47718700 GGGAACTGAGGCCCAGAAAAGGG - Intergenic
906680773 1:47724271-47724293 GCAAACTGAGACTCAGAGAGGGG - Intergenic
906696206 1:47825029-47825051 GGAATCTCAGGCTCAGAGAGAGG + Intronic
906712694 1:47943086-47943108 GGGAACCAAGGCTCAGAGAGAGG - Intronic
906789153 1:48643559-48643581 GGAAACTGACACTCAAAGAGAGG - Intronic
906797243 1:48708050-48708072 GGAAACTGAGGCTTAGAGAGAGG + Intronic
906801086 1:48737476-48737498 GGGAAATGAAGCTCAGAGGTGGG - Intronic
906802652 1:48751085-48751107 GACAACTGAGGCCCAGAGAGGGG - Intronic
906949436 1:50322577-50322599 GGAAATGGAGGCTCAGAGAGGGG - Intergenic
907191131 1:52649955-52649977 GGCAGCTGAGGCCCAGAGAGAGG + Intronic
907205890 1:52770835-52770857 GTAAACTGGGGCTCAGAGAGTGG - Intronic
907221563 1:52910987-52911009 GGAAACTGAAGCTCCGAGAGGGG + Intronic
907237651 1:53062783-53062805 AGAAACTGAGGCCCAGAGAGGGG + Intronic
907243015 1:53091020-53091042 GGAAGCTGACGCCCAGAGGGCGG + Intronic
907268297 1:53275922-53275944 GGAGACTGAAGCTCAGAGAGGGG + Intronic
907268754 1:53278100-53278122 GGAAACTGAGGCCCAGAGAGAGG + Intronic
907269121 1:53280337-53280359 GGAAACTGAGGCTCAGACAAGGG - Intronic
907273162 1:53302456-53302478 GGGCACTGAGGCCCAGAGAGGGG + Intronic
907307388 1:53520878-53520900 GGGAACTGAGGCACAGTGAAGGG - Intronic
907317658 1:53582777-53582799 GGAAACTGAGGCCCATAGAGAGG - Intronic
907320795 1:53601011-53601033 GAAAACTGAGGCCCAGAGAGGGG - Intronic
907438475 1:54464128-54464150 AGGAAGTGAGGTTCAGAGAGGGG + Intergenic
907442999 1:54489912-54489934 GGAAGCTGAGGCTCAGAGAGGGG + Intergenic
907490424 1:54805757-54805779 GGAAACTGAGGCCCACAGAGAGG - Intergenic
907513505 1:54979481-54979503 GGAAACTAAGGCTCAGAGAAGGG - Intergenic
907513529 1:54979587-54979609 GGGATCTGAAGCCCAGAGAGAGG - Intergenic
907513656 1:54980324-54980346 GGAAACTGAGGCCCAGACAGGGG - Intergenic
907520412 1:55020014-55020036 GTGAACTGAGGCTCAGAAAGGGG + Intergenic
907523780 1:55041680-55041702 AGAAACTGAGGCCCAGAGAGAGG + Intronic
907589254 1:55650318-55650340 AGGACCTGAGTCTCAGAGAGGGG - Intergenic
907612388 1:55885557-55885579 GGAAACTGAAGCCCAGAAAGGGG - Intergenic
907637104 1:56146300-56146322 GAAAACTGAAGCTCAAAGAGAGG + Intergenic
907773066 1:57485358-57485380 GGAAACCGAAGATCAGAGAGGGG - Intronic
907823699 1:57995080-57995102 GGAAACTGAGGCCCAGAGAGGGG - Intronic
907852094 1:58265201-58265223 GGAAACTGAGGCTCAGAGAGAGG + Intronic
908024677 1:59938271-59938293 GGGAACTGGCGCTCAGCATGCGG + Intergenic
908329053 1:63052349-63052371 GGGAACTGAGGCCAAGAGAGGGG + Intergenic
908563048 1:65326243-65326265 GGAAACTGAGGCCTAGAGAGAGG + Intronic
909477168 1:76094080-76094102 GGCAACTGACGTTCTGACAGAGG + Intronic
912508992 1:110175607-110175629 GGAAAGTGAGGCCCAGAGAGGGG + Intronic
912540882 1:110414363-110414385 GAAATCTGAGGCTCAGAGAGGGG + Intergenic
912701509 1:111881720-111881742 GGGAACTGAGGCCCAGAGAGGGG - Intronic
913089220 1:115465298-115465320 GGAAACTGAGGCCCAGAGTGGGG + Intergenic
914220479 1:145677024-145677046 GGAAACTGAAGCACAGAGAGAGG + Intronic
914473060 1:147999896-147999918 GGAAACTGAAGCACAGAGAGAGG + Intergenic
915271501 1:154756961-154756983 GAGCACTGCAGCTCAGAGAGAGG + Intronic
915294819 1:154912498-154912520 GGAAACTGAGGCTCAGAGAGGGG - Intergenic
915341551 1:155179336-155179358 GGAAACTGAGGCCCAGAAAGGGG + Intronic
915837280 1:159187952-159187974 GGGAACTGTCGATAAAAGAGAGG - Intronic
916057824 1:161080150-161080172 GGAAACTGAGACCCAGAGAGAGG + Intronic
917028722 1:170667155-170667177 GGAAACTGAGGCTCAGAAAGAGG + Intronic
917642485 1:176996575-176996597 TTGAACTGAAGCCCAGAGAGAGG - Intronic
918212002 1:182359445-182359467 GAAAACTGAAGGTCAGAGAGAGG + Intergenic
918232976 1:182552587-182552609 GGGATGTGAGGCTGAGAGAGGGG - Intronic
919471926 1:197989343-197989365 GGGAAGTGAAAGTCAGAGAGGGG + Intergenic
919855746 1:201704903-201704925 GGAAACTGAGGCCCAAAGAGGGG + Intronic
919921827 1:202170674-202170696 GGGAGCTGAGGTTCAGAGAGAGG + Intergenic
919932690 1:202231574-202231596 GAAAACGGAGGCTCAGAGAGAGG - Intronic
919979061 1:202631065-202631087 GGAAACTGACAGCCAGAGAGAGG + Intronic
920185054 1:204154304-204154326 GGAAACTGAGGCCCAGAGAATGG - Intergenic
920386918 1:205575996-205576018 GGAAACTGAGGCCCAGATAGGGG - Intronic
920390261 1:205595652-205595674 GAAAATTGAGGCTCAGAGAGGGG - Intronic
920454194 1:206085811-206085833 GGGAACTGAGGCTCAGGGAGAGG + Intronic
920514646 1:206575751-206575773 GGAAACTGAGGCCCTGAGAGGGG + Intronic
920966641 1:210706606-210706628 GGAAACTGAGGCCCAGAGAAGGG + Intronic
921166840 1:212513972-212513994 GGGAACTGAGGCTGAGAGTTTGG + Intergenic
922173538 1:223177437-223177459 GGAAACAGAAGCTCAGAGAGGGG + Intergenic
922720183 1:227896340-227896362 GGAAGCTGAGGCTGAGAGAGGGG - Intergenic
922922678 1:229319915-229319937 AAGAGCTGAAGCTCAGAGAGTGG - Intergenic
923187591 1:231588970-231588992 GGGAACTGGGGCACAAAGAGAGG - Intronic
1063596527 10:7440777-7440799 GGGCACTGTCGCTCAGAGTGAGG + Intergenic
1065598674 10:27345760-27345782 GGGCACTGAAGCTCACAGACAGG - Intergenic
1066721896 10:38348095-38348117 GTGCAGTGATGCTCAGAGAGAGG - Intergenic
1067319303 10:45202480-45202502 GGGCACTGAAGCTCACAGATAGG - Intergenic
1067329946 10:45305794-45305816 GGGAAGGGATGCTCAGAAAGAGG - Intronic
1067384253 10:45804244-45804266 GGAAACTGAGGCTGAGAAAGGGG - Intergenic
1067546147 10:47194000-47194022 GGAAACTGAGGCTCAGAGTACGG - Intergenic
1067832545 10:49618618-49618640 GGAAACTGAGTCCCAGAGAGTGG - Intronic
1067891945 10:50144814-50144836 GGAAACTGAGGCTGAGAAAGGGG - Intergenic
1068661669 10:59629058-59629080 GAAAACTGACACTCAGAGAGAGG + Intergenic
1068746198 10:60533319-60533341 GGAAGCTGTCGCTCAGAGAAGGG + Intronic
1069566426 10:69466323-69466345 GGAATCTGAGGCTGAGAGAGAGG - Intronic
1069628253 10:69881277-69881299 GGAAACTGAGGCTCAGAGAGGGG + Intronic
1069707027 10:70465346-70465368 GGAAACTGAGGCTCAGAGAAGGG + Intergenic
1069716176 10:70522886-70522908 GGACACTGAGGCCCAGAGAGGGG + Intronic
1069729958 10:70604094-70604116 GGAAACTAACGCTCAGAAAGGGG - Intergenic
1069739530 10:70678738-70678760 GGCAACTGAGGCCCAGAGAAGGG - Intronic
1069751500 10:70748167-70748189 GGAAACTGAGGCTCAGAGAGAGG + Intronic
1069800973 10:71081235-71081257 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1069821454 10:71231045-71231067 GGAAACTGAGGCTCAGAGAGAGG - Intronic
1069832385 10:71289232-71289254 GGAAACTGAGTCACAGAGAGAGG + Intronic
1069936661 10:71922130-71922152 GGAGACTGAGGCCCAGAGAGGGG + Intergenic
1070287584 10:75095007-75095029 GGCAACTGAAGCCCAAAGAGAGG + Intronic
1070343871 10:75523052-75523074 GGAAACTGAAGTTCAAAGAGGGG - Intronic
1070421004 10:76237399-76237421 AGGAACTGAGGCCCAGAGAAGGG + Intronic
1070646219 10:78204098-78204120 GGACACTGAGGCTCAGAGAGGGG - Intergenic
1070704466 10:78627748-78627770 GGAAGCTGAGGCTCAAAGAGAGG - Intergenic
1070746076 10:78934795-78934817 GAAAACTGAGGCCCAGAGAGGGG - Intergenic
1070778795 10:79125809-79125831 GGAAACTGAGGCCCAGAGATAGG + Intronic
1070785529 10:79160173-79160195 GGAAACTGAGGCCCAGAGACAGG - Intronic
1070819951 10:79348681-79348703 GGAAACTGAGGCCCAGGGAGAGG - Intronic
1071186804 10:83055953-83055975 GGGAACTGGCTCACAGAGATAGG + Intergenic
1071432549 10:85617835-85617857 GGGACCTCACGGTCAGTGAGTGG + Intronic
1071838249 10:89441379-89441401 GGAAACTGAGGCCCAGAGAAAGG + Intronic
1072188931 10:93065219-93065241 GGAAACTGAGGCCCAGAGAAAGG - Intronic
1072256070 10:93621438-93621460 GGAAACTGAGGTCCAGAGAGTGG - Intronic
1072302412 10:94073995-94074017 AGGAACTGACCCTCAGACAAGGG - Intronic
1072426604 10:95335648-95335670 GGAAACTGAGTCTCAGACAGGGG + Intronic
1072709707 10:97707954-97707976 AGTAACTGAGGCCCAGAGAGGGG - Intergenic
1072782708 10:98261265-98261287 GGAAACTGAGGCCCAGAGAAGGG + Intronic
1073054393 10:100689718-100689740 GGAAACTGAGGCTTAGAAAGGGG - Intergenic
1073074817 10:100817262-100817284 GGAAACTGAGGCTCAGAGAGAGG - Intronic
1073079964 10:100853499-100853521 GCCAACTGAGGCCCAGAGAGGGG + Intergenic
1073179081 10:101573347-101573369 GGAAACTGAGGCCCAGAGATGGG - Intronic
1073475818 10:103752431-103752453 GGGAACTCAGGCTCAGAGAAGGG + Intronic
1073486648 10:103823467-103823489 GGCAACTGAGGCACAGAGGGAGG + Intronic
1074060666 10:109962557-109962579 GGAAACAGAGGCTCAGAGAGCGG - Intergenic
1074120314 10:110489211-110489233 GGAAACTGATGCATAGAGAGGGG + Intergenic
1074343775 10:112660468-112660490 GGAAACTGAGGCCCAGAGAAAGG + Intronic
1074362758 10:112836361-112836383 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1074405270 10:113176064-113176086 GGAAACTGAAGCCCAGAGAGGGG + Intergenic
1074446940 10:113528471-113528493 GGAAACTGAGGCTCATAGAGGGG - Intergenic
1074859279 10:117498000-117498022 GGGAGCTGAGGCCCAGAGAGGGG + Intergenic
1074869990 10:117568799-117568821 GGGAACTGAGGCCAAGAAAGTGG + Intergenic
1075463142 10:122632038-122632060 GGCCACTGAAGCACAGAGAGGGG - Intronic
1075489477 10:122854318-122854340 GGAAACTAAAGCTCAGAGAGTGG + Intronic
1075563497 10:123486052-123486074 GGAAACTAAAGATCAGAGAGAGG - Intergenic
1075566532 10:123508974-123508996 GAAAACTGAAGCTCAGAGAAGGG + Intergenic
1075681986 10:124339770-124339792 GAAAACTGAGGCTCAGAGATGGG + Intergenic
1075744484 10:124717179-124717201 GGGAACTGAGGCTCCGAGGAGGG - Intronic
1075852695 10:125602101-125602123 GGAAGCTGAGGCACAGAGAGGGG - Intronic
1075972179 10:126664204-126664226 GTGACCTGACGCTCTGAGTGTGG + Intronic
1076478303 10:130767653-130767675 GGTCACTGGTGCTCAGAGAGGGG - Intergenic
1076639897 10:131907971-131907993 GCGAGCTGAAGCTCAGAAAGGGG - Intronic
1077317583 11:1926224-1926246 GGAAACTGAGGCTCAGAGGATGG - Intronic
1077554712 11:3220406-3220428 GGAAATTGAGGCTCAGAGAGGGG - Intergenic
1077664509 11:4095381-4095403 GGAAACTGACGCTCAGAGCGAGG + Intronic
1077777516 11:5287936-5287958 AGAAACTGAGGCTCAGAGAAGGG + Intronic
1078062493 11:8056980-8057002 GGAAACTGAGGCCCACAGAGTGG + Intronic
1078180615 11:9006869-9006891 GGAAACTGAGGCTCAGAGGTAGG - Intergenic
1078431640 11:11292713-11292735 GGAAACTGAGGCTCAGAGATGGG - Intronic
1078452678 11:11452284-11452306 GGAAACTGAGGCTCAGGGTGAGG - Intronic
1078468681 11:11569858-11569880 GGGAACTGAAACAGAGAGAGAGG + Intronic
1078512635 11:11997025-11997047 GGGAATTGAGACTCTGAGAGTGG - Intronic
1078849866 11:15153811-15153833 GGAAACTGAGGCCCGGAGAGGGG + Intronic
1078921840 11:15837911-15837933 GGACACTGAGACTCAGAGAGGGG - Intergenic
1079004113 11:16780479-16780501 GGAAACTGAGGCCCAGTGAGGGG - Intronic
1079088048 11:17461308-17461330 GGAAACTGAGGCTCTGAGAAGGG - Intronic
1079116762 11:17645187-17645209 GAAAACTGAAGCTCAGAGAGGGG + Intronic
1079133891 11:17765136-17765158 TGAAACTGAGGCCCAGAGAGGGG + Intronic
1079149666 11:17886110-17886132 GGGAACTGAGGGCCAGAGGGAGG - Intronic
1079281039 11:19087446-19087468 GGAAATTGAGGCACAGAGAGAGG + Intergenic
1079307635 11:19337678-19337700 GAGAACTGAGGATGAGAGAGTGG + Intergenic
1079311109 11:19366671-19366693 GGGAACTGAGGCTCACGGAGAGG - Intronic
1079367210 11:19819793-19819815 GGAAACTGAGGCTTAGAGAGTGG + Intronic
1079417210 11:20250134-20250156 GGAAACTGAGAATCAGAGAGTGG - Intergenic
1080615463 11:33941414-33941436 GGAAACTGAGGCTCAAAGAATGG + Intergenic
1080801833 11:35617517-35617539 GGAAACTGAGGCACAGAGAAGGG - Intergenic
1080839239 11:35969091-35969113 GGACACCGAAGCTCAGAGAGAGG + Intronic
1081527208 11:43935192-43935214 GGGAACCGTGGCTCAGAGATTGG + Intronic
1081532414 11:43971447-43971469 GGAAACTGAGGCTGAGAGGGAGG + Intergenic
1081574667 11:44311457-44311479 GCTAACGGAGGCTCAGAGAGGGG + Intergenic
1081637659 11:44731240-44731262 AGAAACCGAGGCTCAGAGAGAGG - Intronic
1081650582 11:44821248-44821270 GGAAACTGAAGCACAGAGAGGGG + Intronic
1081701348 11:45154793-45154815 GAAAACTGAGGCTCAGAGAGGGG + Intronic
1081734937 11:45396130-45396152 GGCAACTGAAGCCCAGAGGGAGG + Intergenic
1081757075 11:45552360-45552382 GGAAACTGAGACTCAGAGAAGGG - Intergenic
1082003926 11:47409417-47409439 GGGCACTGAGGCTCAGAGGGGGG + Intronic
1082775804 11:57243629-57243651 GGAAACTGCCCCACAGAGAGGGG - Intergenic
1082804313 11:57437883-57437905 GGAAACTGAGGCTCCGGGAGGGG - Intergenic
1082869967 11:57935236-57935258 GGGAAAAGAGGCCCAGAGAGGGG + Intergenic
1082992787 11:59222650-59222672 GGAAACAGAGACTCAGAGAGGGG - Intergenic
1083201450 11:61123418-61123440 AGAAACTGAGGGTCAGAGAGAGG - Intronic
1083268118 11:61556378-61556400 GGAAACTGAGGCACACAGAGAGG - Intronic
1083341252 11:61959783-61959805 GGAAACTGAGGTCCAGAGAGAGG + Intronic
1083478617 11:62929391-62929413 AGAAACTGAAGCTCAGAGAACGG - Intergenic
1083537027 11:63478838-63478860 AGGAACTGAGGCCAAGAGAGAGG + Intronic
1083631319 11:64096944-64096966 GGGCCCAGACGCTGAGAGAGTGG - Intronic
1083713165 11:64560946-64560968 GGAAACTGAGGCCCAGAGAAGGG - Intronic
1083759768 11:64809513-64809535 GGAAACTGAAGCCCAGAGAGGGG - Intronic
1083893885 11:65610778-65610800 GGAATCTGAGGCCCAGAGAGGGG + Intronic
1083899035 11:65634864-65634886 GGAAACTGAGGCTCAGCGTGAGG + Intronic
1084028833 11:66468854-66468876 GGAAACCGAGGCTCAGAGAGGGG + Exonic
1084105329 11:66976887-66976909 GGAAACTGAGGCCCAGAGTGGGG + Exonic
1084118346 11:67054829-67054851 GGGAACTGAGCCTCAGAGAGAGG - Intergenic
1084120649 11:67066986-67067008 GGAAACTGAGGCTCAGAGTGGGG + Intronic
1084198639 11:67540963-67540985 GGAAACTGAGGCCCAGAGAGAGG + Intergenic
1084216584 11:67650198-67650220 GGAAACTGAGACCCAGAGAGGGG + Intronic
1084264809 11:67999402-67999424 GGAAACTGAGGCCCAGAGGGCGG + Intronic
1084266355 11:68007339-68007361 GGAAACTGAGGCCCAGTGAGGGG + Intergenic
1084288263 11:68145802-68145824 GGAAACTGAGGCTCAGTGACGGG - Intergenic
1084389221 11:68864213-68864235 GGAAACTGAGGCTTAGAGAAGGG + Intergenic
1084417786 11:69043403-69043425 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1084425975 11:69084827-69084849 GGAAACTGAGGCCCAGAAAGGGG + Intronic
1084550268 11:69836849-69836871 GTAAACTGAGGCCCAGAGAGGGG - Intergenic
1084557315 11:69882830-69882852 TGGAGCTGGGGCTCAGAGAGTGG - Intergenic
1084675140 11:70629779-70629801 GGAAACTGAGGCCCAGAGATAGG - Intronic
1084852253 11:71951270-71951292 GGAAACTGAGGCATAGAGAGAGG + Intronic
1084940313 11:72608952-72608974 GGAAACTGAGGCGCAGAGAAGGG + Intronic
1084972337 11:72778747-72778769 GGATACTGGGGCTCAGAGAGGGG - Intronic
1085022758 11:73219414-73219436 GGCCACTGAGGCTCAGAGAAAGG - Intronic
1085073469 11:73570230-73570252 GAGAACTGAGTCTCAGAGAAAGG - Intronic
1085084786 11:73659780-73659802 GGGGACTGAGGCTCAGAGAATGG - Intronic
1085154982 11:74285279-74285301 GGAAACCGAGGCCCAGAGAGGGG - Intronic
1085204383 11:74721764-74721786 GGAAACTGAGGCTCAGAGAAAGG - Intronic
1085255043 11:75167763-75167785 GGAAACCAAGGCTCAGAGAGGGG + Intronic
1085298324 11:75443402-75443424 GGAGACTGAGGCCCAGAGAGGGG - Intronic
1085301810 11:75463028-75463050 AGAAACTGAGGTTCAGAGAGGGG + Intronic
1085307775 11:75497989-75498011 GGGCACTGAGGCTCAGAGACAGG + Intronic
1085321244 11:75575319-75575341 GAAAACTGGGGCTCAGAGAGGGG + Intergenic
1085342921 11:75745099-75745121 GGACACTGAGGCTCAGAGAGGGG + Intergenic
1085388597 11:76170972-76170994 GGAAAATGAGGCCCAGAGAGGGG + Intergenic
1085397890 11:76216414-76216436 AGAAACTGACGCCGAGAGAGGGG + Intergenic
1085400170 11:76231089-76231111 GGAAACAGAGGCTCAGAGAGGGG + Intergenic
1085475970 11:76789104-76789126 GGCAACTGGGGCCCAGAGAGGGG - Intronic
1085518328 11:77124014-77124036 GGACACTGAGGCTGAGAGAGGGG - Exonic
1085619931 11:78030422-78030444 GAGAACTGAGGCCCAGAGAGGGG - Intronic
1085640957 11:78192391-78192413 AGAAAGTGAGGCTCAGAGAGAGG - Intronic
1085697578 11:78718165-78718187 GGACACTGAAGCCCAGAGAGAGG + Intronic
1085757923 11:79216998-79217020 GGGAACTGAGGCTTAGAGGGGGG - Intronic
1085802433 11:79602853-79602875 GGAAACTGAGGCCCAGAGAGAGG + Intergenic
1085972001 11:81604516-81604538 GGAAACTAAAGCTCAGAGATAGG + Intergenic
1086031220 11:82358452-82358474 GAAAACTAAGGCTCAGAGAGAGG - Intergenic
1086122827 11:83318046-83318068 AGAAACTGAAGCTCAGAGAGGGG - Intergenic
1086178674 11:83923363-83923385 GGGAATTGAGGCTCTGAGGGTGG + Intronic
1086451011 11:86916816-86916838 AGAAACTGAGGCACAGAGAGGGG - Intronic
1086627791 11:88978823-88978845 GGTAACTGATGCTCAGAGTAGGG + Intronic
1089140112 11:116277851-116277873 GGAAACTGAAGCCCAGAGACAGG + Intergenic
1089146203 11:116331179-116331201 GGCAACTGAGGCCCAGAGAGGGG - Intergenic
1089347359 11:117799043-117799065 GGAAACTGAGGCCCAGAGTGGGG + Intronic
1089389039 11:118087460-118087482 GGGAACTGCCCTTCAGAGATGGG - Intronic
1089460366 11:118649660-118649682 GGAAACTGAGGCCCAGAGAAGGG + Intronic
1089603548 11:119628880-119628902 GAAAACTGAGGCTCAGAGAGGGG + Intronic
1089635530 11:119809231-119809253 AGGCACTGAGGCTCAGAGGGTGG - Intergenic
1089640942 11:119846823-119846845 GGAAAGCGAGGCTCAGAGAGGGG + Intergenic
1089897553 11:121946874-121946896 GGAAACTGACCCTCAGGCAGGGG - Intergenic
1090071681 11:123549636-123549658 GGAAACTGAGGCCCAGAGAAAGG + Intronic
1090076031 11:123580544-123580566 GGAAACTGAGGCCCAGAGAAGGG - Intronic
1090082811 11:123625659-123625681 GGATACTGAAGCTCAGAGAGGGG - Intronic
1090239685 11:125173324-125173346 AGAAACTGGGGCTCAGAGAGTGG + Intronic
1090441035 11:126725852-126725874 GGAAACTGAGACTCAGCGAGGGG - Intronic
1090593914 11:128299849-128299871 GGAAACTGAAGCACAGAGAGAGG + Intergenic
1091743466 12:2976386-2976408 AGGCACTGAGGCCCAGAGAGGGG + Intronic
1092050194 12:5463841-5463863 GAAAACTGAGGCCCAGAGAGAGG - Intronic
1092215195 12:6677132-6677154 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1092225512 12:6745794-6745816 GGGAACTGATGTTGCGAGAGAGG + Intergenic
1093711063 12:22330414-22330436 AGGAACTGAAGCTCTGAGATTGG + Intronic
1094137217 12:27140864-27140886 GGGAGATGGCCCTCAGAGAGAGG - Intergenic
1095418931 12:42005204-42005226 GGAAACTGAGGCACAGAGAGGGG + Intergenic
1095840456 12:46686016-46686038 AGAAACTGAGGCTCAGAGGGAGG + Intergenic
1096046408 12:48566504-48566526 GGAAACTGAGGCACAGAGAATGG + Intergenic
1096477735 12:51918661-51918683 AGAAACTGATGCTCAGAGAAGGG - Intronic
1096808738 12:54156430-54156452 GGGAACTGATGCCCAGAGAAGGG + Intergenic
1096819788 12:54224904-54224926 GGAAACTGATACCCAGAGAGGGG + Intergenic
1099468708 12:83019808-83019830 GGGTACTGAGGATAAGAGAGTGG - Intronic
1101242610 12:102853135-102853157 GGAAACTGAGGCTCAGAAATGGG - Intronic
1101320986 12:103672949-103672971 GGAAGCTGAGGCCCAGAGAGAGG - Intronic
1101645213 12:106625128-106625150 GGAAACTGAGGCTTAGAGAAGGG + Intronic
1101749417 12:107571261-107571283 GGAAACTGAGGCACAGAGATGGG + Intronic
1101807247 12:108075145-108075167 GGAAACTGAGGCTCCAAGAGGGG - Intergenic
1101827184 12:108229561-108229583 GGAAACTGAGGCTTAGTGAGGGG + Intronic
1101849846 12:108393384-108393406 GGAAGCTGATGCCCAGAGAGGGG + Intergenic
1101865237 12:108515491-108515513 GAGAACTGAGGCCCGGAGAGGGG - Intronic
1101897950 12:108769938-108769960 GGAAACTGAGGCCCAGAGAGAGG - Intergenic
1101909448 12:108850605-108850627 GGGAAGGGGAGCTCAGAGAGGGG + Intronic
1101925805 12:108970325-108970347 GGAAACTGAGGCACGGAGAGTGG - Intronic
1101926191 12:108973239-108973261 GGCAACTGAGGGCCAGAGAGGGG + Intronic
1101926407 12:108975495-108975517 GGAAACTGAGGCTTAGAGAGGGG - Intronic
1101954442 12:109200902-109200924 GGAAACTGAGGCTCAAGGAGGGG + Intronic
1101969797 12:109304991-109305013 AGAACCTGAGGCTCAGAGAGAGG + Intronic
1102008754 12:109605481-109605503 GGAAACTGAGGCACAGAGATGGG + Intergenic
1102016643 12:109652414-109652436 GGAAACTGAGGCTCAGAGAGGGG - Intergenic
1102021603 12:109687224-109687246 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1102024279 12:109704680-109704702 GGAAACTGAGGCTCAGAGAGGGG - Intergenic
1102036791 12:109775202-109775224 GGAAACTGAGGTTCAGAGAGGGG + Intergenic
1102048447 12:109845062-109845084 AAAAACTGAGGCTCAGAGAGGGG + Intergenic
1102056057 12:109897447-109897469 GGAAACTGAGGCCCAGAGAGTGG + Intergenic
1102081304 12:110100284-110100306 GAAAACTGAGGCACAGAGAGGGG - Intergenic
1102202414 12:111066833-111066855 AGAAGCTGATGCTCAGAGAGGGG - Intronic
1102247343 12:111363568-111363590 GGAAACTGACGCTCATAGGGTGG + Intronic
1102439220 12:112948741-112948763 GGTGACTGAGGCTCAGAGAGGGG - Intronic
1102456360 12:113073255-113073277 GGAAACTGAGGCCCTGAGAGGGG + Intronic
1102498829 12:113337413-113337435 GGAAACTGAGGCTCAAAGAGAGG - Intronic
1102511786 12:113421001-113421023 GGAAACTGAGGCCCAGAGATGGG + Intronic
1102559382 12:113751377-113751399 GGAAGCTGAGACTCAGAGAGAGG + Intergenic
1102561702 12:113766807-113766829 GGAAACTGAGGCACAGAGGGAGG - Intergenic
1102563955 12:113782609-113782631 GGAAACTGAGGCACAGACAGGGG + Intergenic
1102564001 12:113782871-113782893 GGAAACTGAGGCCCAGAGGGGGG + Intergenic
1102636603 12:114329979-114330001 GGAAACCAAGGCTCAGAGAGGGG - Intergenic
1102653128 12:114457439-114457461 GGAAACTGAGGCCAAGAGAGAGG - Intergenic
1102774954 12:115510601-115510623 GAAAACTGAGGCTCAGAAAGAGG + Intergenic
1102782899 12:115580867-115580889 GGTGACTGAGGCACAGAGAGGGG + Intergenic
1102791863 12:115653258-115653280 GGAAACTGAGACCCAGAGAGGGG + Intergenic
1102812522 12:115836802-115836824 GGAAACTGAGGCTCAGAGGGAGG + Intergenic
1102856469 12:116298759-116298781 GAAAACTGAGGCTCAGAAAGGGG - Intergenic
1102864189 12:116361145-116361167 GAGAACTGAGGCTCAGAAAGGGG - Intergenic
1102914744 12:116744481-116744503 AGAAGCTGAGGCTCAGAGAGGGG + Intronic
1102965164 12:117120070-117120092 AGAAACTGAGGCTCAGTGAGGGG - Intergenic
1103008581 12:117440299-117440321 GGAAATTGAGGCTTAGAGAGGGG + Intronic
1103145031 12:118588332-118588354 GGAAACTGAGGCTCAGAGAGGGG - Intergenic
1103182225 12:118923445-118923467 GAGAACTGAGGCTCAGAGAGGGG + Intergenic
1103186469 12:118962001-118962023 GTAGACTGAGGCTCAGAGAGGGG + Intergenic
1103193345 12:119021033-119021055 GGAAACTAAGGCTCAGAAAGAGG - Intronic
1103249469 12:119487222-119487244 GGGATGGGAGGCTCAGAGAGGGG - Intronic
1103264134 12:119614725-119614747 GAAAACTGAGACTCAGAGAGTGG - Intronic
1103324809 12:120113383-120113405 GTAAATTGAGGCTCAGAGAGGGG - Intronic
1103361522 12:120357276-120357298 GGAAACTGAGGCTCAGAGAAGGG + Intronic
1103394755 12:120599065-120599087 GGAAACTGAGGCCCAGAGAGAGG + Intergenic
1103394890 12:120599870-120599892 GGAAACTGAGGCTCAGAATGGGG + Intergenic
1103577571 12:121889715-121889737 GGAAACTGAGGCCCAGAGTGGGG + Intronic
1103709034 12:122897181-122897203 GGGAACTGAAGCCCTGAGAAGGG + Intergenic
1103721551 12:122978173-122978195 GGGTCCTGAGGCCCAGAGAGGGG - Intronic
1103739316 12:123080768-123080790 AGAAGCTGAAGCTCAGAGAGGGG - Intronic
1103952757 12:124560108-124560130 GGAAACTGTGGCCCAGAGAGGGG - Intronic
1103983141 12:124749888-124749910 GGAAACTGAGACTCAGAGAGGGG + Intergenic
1104067416 12:125317164-125317186 GGAAACTGAGGCACAGAGAGGGG - Intronic
1104608460 12:130206955-130206977 GGGAACTGAGGCCCAGGGAGGGG + Intergenic
1104683169 12:130766419-130766441 GGAAACTGAGGCACAGAAAGTGG + Intergenic
1104782740 12:131432375-131432397 GGAAACTGAGGCCCAGAGAAGGG + Intergenic
1104902631 12:132197613-132197635 GGGCCCCGACGCTCACAGAGAGG - Intronic
1104962659 12:132495566-132495588 GGAAACTGAGGCACAGAGAGGGG + Intronic
1107552785 13:41492849-41492871 GGAATCTGAGGCCCAGAGAGGGG - Intergenic
1107784161 13:43937667-43937689 GGCCACTGAGGCTCAGAGAGGGG + Intergenic
1108280630 13:48857610-48857632 GGGAGTTGAGGCTCAGAGAGAGG - Intergenic
1113136113 13:107091205-107091227 GGGAACTGAGGCTGAGGGTGGGG + Intergenic
1113968905 13:114173365-114173387 GGGAACTGACGTACAGAAATTGG + Intergenic
1115757305 14:36542331-36542353 AGGAAATGAATCTCAGAGAGTGG - Intergenic
1117747149 14:58881458-58881480 GGAAACTGAAGCATAGAGAGGGG + Intergenic
1118735865 14:68701553-68701575 CGAAACTGAGGCTCAGAGAAGGG - Intronic
1119180246 14:72600457-72600479 GGAAACTGAGGCCTAGAGAGGGG - Intergenic
1119210987 14:72831577-72831599 GGAAACTGAGGCTCAGAGAGGGG + Intronic
1119369200 14:74123911-74123933 GGAAAATGAAACTCAGAGAGAGG - Intronic
1119383315 14:74241821-74241843 GGAAACTGAGGCTCACAGAAGGG - Intronic
1119384467 14:74248822-74248844 GGAAACTGAGGCTCACAGATGGG - Intronic
1119425579 14:74532683-74532705 GGAAACTGAGGCACAGGGAGAGG - Intronic
1119545069 14:75465687-75465709 GGAAACTGAGGCCCAGAGAGAGG + Intronic
1119765154 14:77183165-77183187 GGAAACTGAGGCACAGAGGGTGG + Intronic
1119851248 14:77868207-77868229 GGAAACTGAGGCTCAGAGAGGGG + Intronic
1120896738 14:89539613-89539635 GGAAACTGAGGCTGAGAAAGTGG - Intronic
1121252812 14:92512706-92512728 GGAAACTGAGGCCTAGAGAGTGG - Intergenic
1121276355 14:92670703-92670725 GGAAATTGAGGCTCAGAGATGGG - Intronic
1121285477 14:92732126-92732148 GGAAACTGAGGCCTAGAGAGTGG - Intronic
1121327568 14:93030130-93030152 GGGAACTGAGGGTGTGAGAGCGG + Intronic
1121423393 14:93831590-93831612 AGAAAGTGAGGCTCAGAGAGGGG - Intergenic
1121442651 14:93958512-93958534 GGAAACTGAGGCACAGAGCGGGG - Intronic
1121492999 14:94373070-94373092 GGAAACTGGGGCTCAGGGAGAGG + Intergenic
1121606052 14:95240788-95240810 GGAAACTGAGTCTCAGAGAGGGG + Intronic
1121685827 14:95834282-95834304 GGAAACTGAGGCTCAGAAAGGGG - Intergenic
1121817694 14:96941023-96941045 GGCAACTGAGGCTCACAGAGAGG + Intergenic
1121850194 14:97214610-97214632 GGAAACTGAACCACAGAGAGTGG - Intergenic
1121929142 14:97956498-97956520 AGAAACTGAGGCTCAGAAAGGGG + Intronic
1122150776 14:99725083-99725105 GGAAACTGAGACCCAGAGAGAGG - Intronic
1122156640 14:99754066-99754088 GGAAACTGAGTCCCAGAGAGGGG - Intronic
1122181227 14:99956184-99956206 GGAAACAGAGGCTCAGGGAGAGG + Intergenic
1122190781 14:100041522-100041544 GAAATCTGAAGCTCAGAGAGTGG - Intronic
1122262230 14:100530150-100530172 GGAAACTGAGGCTCAGAAGGTGG - Exonic
1122298061 14:100716627-100716649 GGAAACTGAGGCCCAGAGATGGG + Intergenic
1122651807 14:103230529-103230551 GGATACTGAGGCTCAGAGAGAGG + Intergenic
1122804562 14:104250006-104250028 GGAAACTGAGGCTCAGAGGTGGG + Intergenic
1122937223 14:104965855-104965877 GGGAATGAAAGCTCAGAGAGGGG - Intronic
1123414179 15:20083095-20083117 AGAAACTGAGGCTCAGAGAGGGG + Intergenic
1123523521 15:21090206-21090228 AGAAACTGAGGCTCAGAGAGGGG + Intergenic
1123696320 15:22881516-22881538 GGGACTTGAGGCTCAGAGACAGG - Intronic
1124023759 15:25946095-25946117 GGAAACTGAGGCTGAGAGTGGGG + Intergenic
1124494657 15:30178944-30178966 GGAAACTGACAGCCAGAGAGAGG + Intergenic
1124496104 15:30188261-30188283 GGAAACTGAGGCTTAGAGAGGGG - Intergenic
1124747470 15:32350386-32350408 GGAAACTGAGGCTTAGAGAGGGG + Intergenic
1124748913 15:32359701-32359723 GGAAACTGACAGCCAGAGAGAGG - Intergenic
1127022997 15:54771979-54772001 GGAAACTAAAGCTCAGAGAAGGG - Intergenic
1127663823 15:61124776-61124798 AGAAACTGAGGCTCAGAGAGGGG - Intronic
1127785682 15:62352848-62352870 GGAAACTGACGCACAGGCAGGGG - Intergenic
1127980975 15:64034761-64034783 GGAAAGTGAGGCCCAGAGAGGGG - Intronic
1127983083 15:64048273-64048295 GGAAACTGAGGCTCGGAGAAGGG + Intronic
1128114484 15:65096693-65096715 GGAAACTGAGGCTAAAAGAGGGG + Intronic
1128146784 15:65336420-65336442 GGAAGCTGAGGCTCAGAGAAGGG + Intronic
1128148565 15:65346809-65346831 GGGAAAAGAGGCTCAAAGAGGGG - Intronic
1128161678 15:65426801-65426823 TGAAACTGAGGCCCAGAGAGAGG - Intergenic
1128215730 15:65932935-65932957 GGGAACTGAGACTCAGAGACGGG - Intronic
1128314501 15:66652181-66652203 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1128348668 15:66874185-66874207 GGAGTCTGAAGCTCAGAGAGAGG - Intergenic
1128360845 15:66960688-66960710 GGAAACTGAGGCTCAGAGGAGGG + Intergenic
1128421247 15:67493250-67493272 GGAAACTGAGGCTTAGAGAGGGG + Intronic
1128451614 15:67809052-67809074 AGGAAGAGGCGCTCAGAGAGTGG + Intergenic
1128519796 15:68367795-68367817 GTAAACTGAGGCTCAGAGAGAGG + Intronic
1128532503 15:68464253-68464275 GGAAACTGAGGCTCAGAAAGGGG + Intergenic
1128535223 15:68485383-68485405 GGAAACTGAGGCCCAAAGAGGGG - Intergenic
1128711452 15:69875332-69875354 GGAAACCGACGCTTAGAGAGGGG + Intergenic
1128720913 15:69947702-69947724 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1128998938 15:72317488-72317510 GGAAACTGAAGCCCAGAGAGTGG + Intronic
1129160474 15:73744860-73744882 GGGCAATGAGGCTCAGAGACTGG + Intronic
1129178881 15:73859215-73859237 GGAAACTGAGGCTCGGAGGGGGG - Intergenic
1129228943 15:74185798-74185820 GGAAGCTGAGGCTCAGAGAGAGG + Intronic
1129266864 15:74397829-74397851 GGAAACTGTGGCTCAGAGAAGGG - Intergenic
1129274139 15:74434192-74434214 TGGAACTGAGGCCCAGAGAGGGG - Exonic
1129316930 15:74750726-74750748 GGAAACTGAGGCCCAGAGAAGGG - Intronic
1129425240 15:75457870-75457892 GGAAACTGAGGCTCAGAGGGAGG - Intergenic
1129520208 15:76181150-76181172 GGCATCTGAGGCTCAGAGAAAGG + Intronic
1129523548 15:76200397-76200419 AGAAACTGAGGCCCAGAGAGGGG + Intronic
1129538586 15:76333738-76333760 GGAAACTGAGGCTCAGAGAGGGG - Intergenic
1129543083 15:76367157-76367179 GGAAACTAAAGCTCAGAGAAGGG + Intronic
1129606258 15:77026511-77026533 GGAAACTGAGGCACAGAGATGGG - Intronic
1129612795 15:77073705-77073727 GGATACTGAGGCACAGAGAGAGG - Intronic
1129659069 15:77543069-77543091 GGAAACTGAGGCCCAGAGAGAGG - Intergenic
1129690673 15:77711577-77711599 GGAACCTGAGGCTTAGAGAGAGG - Intronic
1129708960 15:77810626-77810648 GGAAACTGAGGCACAGGGAGTGG - Intronic
1129726064 15:77902370-77902392 GGAAACTGAGGCTCAGAGAGGGG - Intergenic
1129738486 15:77978554-77978576 GGAAACTGAGGCCCAGAGGGTGG + Intergenic
1129847584 15:78775056-78775078 GGAAACTGAGGCCCAGAGGGTGG - Intronic
1129850040 15:78788526-78788548 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1129850890 15:78793174-78793196 GGTAAGTGAAGCTCAAAGAGAGG + Intronic
1129880737 15:79004579-79004601 GGAAGCTGAGGCTCAGAGACAGG + Intronic
1129905558 15:79184840-79184862 AGGAGCTGAGGCCCAGAGAGGGG - Intergenic
1130041956 15:80412850-80412872 TAGAACAGAGGCTCAGAGAGAGG + Intronic
1130080871 15:80732430-80732452 GGAAACTAAAGCTCTGAGAGAGG - Intronic
1130136822 15:81188483-81188505 GGAAGCTGATGCTCAGAAAGAGG + Intronic
1130140823 15:81225025-81225047 GGGAACTGAGGTGCAGAGAGGGG - Intronic
1130251493 15:82302894-82302916 AGTAACTGAAGCTCAAAGAGAGG - Intergenic
1130254319 15:82318853-82318875 GGAAACTGAGGCCCAGAGGGTGG + Intergenic
1130274125 15:82467735-82467757 GGAAACTGAGGCTCAGAGGGGGG - Intergenic
1130466471 15:84195109-84195131 GGAAACTGAGGCTCAGAGGGGGG - Intergenic
1130497793 15:84478427-84478449 GGAAACTGAGGCTCAGAGGGGGG + Intergenic
1130534064 15:84770610-84770632 GAGAACTGAGGCTCAGAGAGGGG - Intronic
1130588767 15:85199702-85199724 GGAAACTGAGGCTCAGAGGGGGG - Intergenic
1130600646 15:85271117-85271139 GGAAACTGAGGCCCAGAGGGTGG - Intergenic
1130683975 15:86021131-86021153 GGAAACTGAGGCCCAGAGAAAGG + Intergenic
1130705684 15:86230980-86231002 GGAAACTGAGGACCAGAGAGAGG + Intronic
1130735049 15:86539105-86539127 AGAAACTGAGGCACAGAGAGGGG + Intronic
1130757822 15:86784658-86784680 CTGAACTGTGGCTCAGAGAGTGG - Intronic
1130923366 15:88367213-88367235 GGAAACTGAGGCTCAGGGGGTGG + Intergenic
1130979358 15:88802548-88802570 GAAAACTGAGGCTCAGAAAGTGG - Intergenic
1130993983 15:88894197-88894219 GGAAACTGAGGCCAAGAGAGTGG + Intronic
1131153135 15:90059427-90059449 GGAAACTGAGGCCCAGGGAGGGG - Intronic
1131257716 15:90872663-90872685 GGAAACTGAGGCCCAGGGAGAGG + Intronic
1131290464 15:91102347-91102369 GGAAACTAATGCTCAAAGAGGGG - Intronic
1131569950 15:93524556-93524578 TGAAACTGAGCCTCAGAGAGGGG + Intergenic
1131975832 15:97945029-97945051 GGCAACTGAGGCCCAGAGAAGGG - Intergenic
1132299605 15:100767823-100767845 TGAAGCTGAAGCTCAGAGAGTGG + Intergenic
1132584266 16:699500-699522 GGAAATTGAGGCTCAGAGAAGGG - Intronic
1132616320 16:842719-842741 GGGAGCTGACACCCAGTGAGGGG + Intergenic
1132871378 16:2117158-2117180 GGAAACTGAGGCTCAGAGCCCGG + Intronic
1132873944 16:2127737-2127759 GGAAACTGAGGCTGAGAGACTGG + Intronic
1132915188 16:2340331-2340353 GGGAGCCGACGCTGAGGGAGCGG + Intronic
1133279257 16:4655832-4655854 GGAAACTGAGGCTCAGACAGAGG + Intronic
1133320430 16:4910176-4910198 GGAAACTGAGGCACAGATAGGGG + Intronic
1133347382 16:5079954-5079976 GGAAACTGAGGCTCAGAGGCAGG + Intronic
1133561972 16:6958600-6958622 GGGAACGCACGCTCAGAGTAGGG + Intronic
1133736775 16:8621892-8621914 GGAAACTGACGCTAAGAGTGGGG - Intronic
1134041004 16:11068158-11068180 GGGAACTAAAGCACAGAGAGGGG - Intronic
1134065612 16:11226095-11226117 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1134209709 16:12266003-12266025 GGAAACTGAGGTTCAGAGAAAGG + Intronic
1134521149 16:14919736-14919758 GGAAACTGAGGCTCAGAGCCCGG - Intronic
1134550422 16:15136236-15136258 GGAAACTGAGGCTCAGAGCCTGG + Intronic
1134553031 16:15146911-15146933 GGAAACTGAGGCTGAGAGACTGG + Intergenic
1134708825 16:16318387-16318409 GGAAACTGAGGCTCAGAGCCCGG - Intergenic
1134716036 16:16358421-16358443 GGAAACTGAGGCTCAGAGCCCGG - Intergenic
1134815943 16:17206098-17206120 AAGAACTGACAATCAGAGAGGGG - Intronic
1134839059 16:17386859-17386881 AGAAACTGAGGCTAAGAGAGGGG + Intronic
1134847154 16:17449563-17449585 AGGAAGTGAGGCACAGAGAGGGG - Intronic
1134950780 16:18350258-18350280 GGAAACTGAGGCTCAGAGCCCGG + Intergenic
1134958720 16:18393738-18393760 GGAAACTGAGGCTCAGAGCCCGG + Intergenic
1135085798 16:19473626-19473648 GCAAACTGAGGCTCAGGGAGGGG - Intronic
1135521380 16:23181310-23181332 AGAAACTGAAGCCCAGAGAGAGG - Intergenic
1135955129 16:26950284-26950306 AGGAACTGATGCTCAGAAAATGG - Intergenic
1135968235 16:27053033-27053055 GGAAACTGAGGCTCAGTGAGGGG - Intergenic
1135998066 16:27268507-27268529 GGAAACTGAGGCCCAGACAGGGG - Intronic
1136009978 16:27357177-27357199 GGAAACTGAGGCTCAGAGCAAGG - Intronic
1136103096 16:28009771-28009793 GGAAACTGAGACTCAGAGAGAGG - Intronic
1136145570 16:28314491-28314513 GGAAACTGAGGCACAGAGAGAGG + Intronic
1136499578 16:30663749-30663771 GAAAACTAAGGCTCAGAGAGGGG + Intronic
1137264646 16:46858918-46858940 GGAAACTGAGGCACAGAGATTGG + Intergenic
1137479375 16:48838917-48838939 GGAAACTGAGGCTCAGAAAGTGG - Intergenic
1137599412 16:49746083-49746105 GGAAACTGAGGCTCGGGGAGAGG - Intronic
1137613465 16:49834233-49834255 GGCAACTGAGGCACCGAGAGAGG - Intronic
1137625791 16:49907616-49907638 TGAAACTGATGCTCAGGGAGGGG - Intergenic
1137668564 16:50266179-50266201 GGGCTCTGACGCTCACAGACAGG - Intronic
1137752440 16:50876792-50876814 GGAAACTGAGGCCCAGAGGGGGG + Intergenic
1137876579 16:52002420-52002442 AGAAACTGAGGCCCAGAGAGGGG + Intergenic
1137912675 16:52394042-52394064 GGACACTGATGTTCAGAGAGAGG + Intergenic
1137968590 16:52961050-52961072 GGAAACTGAGGTTCAGAGGGTGG - Intergenic
1138161262 16:54756862-54756884 AAGAAATGAGGCTCAGAGAGAGG - Intergenic
1138230247 16:55331225-55331247 GGGAACTGACGGGCAGGGAAGGG + Intergenic
1138235004 16:55374683-55374705 GGAAACTGACACACAGAGGGAGG + Intergenic
1138235919 16:55382470-55382492 GGAAACTAAAGTTCAGAGAGAGG - Intergenic
1138237905 16:55401052-55401074 GGAAACTGAGGTCCAGAGAGAGG + Intronic
1138266080 16:55660664-55660686 GGAACTTGAGGCTCAGAGAGGGG - Intronic
1138303892 16:55956902-55956924 GGGAACTAAGGCCCAGAGAGGGG + Intergenic
1138415553 16:56869615-56869637 GAAAACTGAAGCTCAGAGAAGGG + Intronic
1138431961 16:56974832-56974854 GGAAACTGAGGCCCACAGAGGGG + Intronic
1138442982 16:57046321-57046343 GGAAACTGAGGCTCAGGGAAGGG - Intronic
1138482631 16:57313963-57313985 GGAAACTGAGGCACGGAGAGGGG - Intergenic
1138501123 16:57445647-57445669 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1138528841 16:57623934-57623956 GAAAACTGAGGCTCAGAGAGAGG - Intronic
1138536110 16:57661097-57661119 GGAAACCGAGGCTCAGAGAAGGG - Intronic
1138579627 16:57932295-57932317 GGAAACTGAAGCTCAGAGAGGGG - Intronic
1138584258 16:57960227-57960249 GGGAACTGAGACCCAGGGAGGGG + Intronic
1139205532 16:65025137-65025159 GGAAACAGAGACTCAGAGAGGGG - Intronic
1139216291 16:65126803-65126825 GGAAACTGAGGCTCAGAGAAAGG - Intergenic
1139321511 16:66118048-66118070 GATAACTGAAGCCCAGAGAGGGG - Intergenic
1139353501 16:66352925-66352947 GAAAACTGAGGCTCAGAGAGTGG + Intergenic
1139429441 16:66903363-66903385 GGAAATTGAGGCTCAGAGATGGG + Intergenic
1139437153 16:66942872-66942894 GGAAACTGAGGCTCAGAGAGAGG + Intronic
1139953595 16:70683243-70683265 AGAAACTGAGGCTCAGACAGGGG - Intronic
1139969596 16:70765541-70765563 GGGAACTGAAGCACACAGATAGG + Intronic
1140783769 16:78319939-78319961 GGGATTAGATGCTCAGAGAGGGG - Intronic
1140989964 16:80201255-80201277 GGGAACTCCAGCTAAGAGAGTGG + Intergenic
1141164591 16:81652041-81652063 GGAAACTGACACCCCGAGAGAGG - Intronic
1141186319 16:81790042-81790064 GGGAATTAAAGTTCAGAGAGTGG - Intronic
1141259978 16:82443869-82443891 GAAAACTGAGCCTCAGAGAGGGG - Intergenic
1141329812 16:83100413-83100435 GGAAACTGATGCTCAGAGAAGGG + Intronic
1141483126 16:84319850-84319872 GGAAACTGAGGCTCAGAGATAGG - Intronic
1141524474 16:84603094-84603116 GGGAACTGGGGGGCAGAGAGGGG - Intronic
1141561172 16:84868614-84868636 GGAAATTGAACCTCAGAGAGGGG + Intronic
1141650413 16:85389830-85389852 GCAAACTGAGGCCCAGAGAGGGG + Intergenic
1141751294 16:85960225-85960247 GGAAACTGAGGCTCAGAAAGGGG - Intergenic
1141860343 16:86712180-86712202 CAGAGCTGAGGCTCAGAGAGAGG + Intergenic
1142116326 16:88357995-88358017 AGAAACTGAGGCACAGAGAGAGG + Intergenic
1142126970 16:88415092-88415114 AGAAACCGAGGCTCAGAGAGGGG - Intergenic
1142179794 16:88662870-88662892 GGAAACTGAGGCTCAGGGAGGGG - Intronic
1142230598 16:88898449-88898471 GGAAACTGAGGCTCGGAGAGGGG - Intronic
1142232101 16:88904823-88904845 GGAAAGTGAGGCTCAGAGAGGGG - Intronic
1142325930 16:89414627-89414649 GGAGACTGAGGCTCGGAGAGTGG + Intronic
1142361665 16:89630556-89630578 GGGAACTGGGGCTGGGAGAGCGG + Intronic
1142473412 17:176073-176095 GAGAAATGAGGCTCAGAGAGGGG + Intronic
1142867379 17:2798986-2799008 GGAAACTGAGACCCAGAGAGAGG - Intronic
1142995988 17:3760828-3760850 GGAAACTGAGGCTCAGAGAGTGG - Intronic
1143001097 17:3795475-3795497 AGGTGCTGAGGCTCAGAGAGGGG + Intronic
1143013366 17:3878588-3878610 GGAAACTGAGGCACACAGAGGGG - Intronic
1143013967 17:3881901-3881923 GGAAACTGAGGCACAGAGAAGGG + Intronic
1143020451 17:3914807-3914829 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1143217642 17:5237002-5237024 GGAAACTGAGGCTCAGAGAAGGG - Intergenic
1143323815 17:6085488-6085510 GGAAGTTGAGGCTCAGAGAGAGG + Intronic
1143368161 17:6421955-6421977 GGAAACTGAGGCTTAGAGAGGGG - Intronic
1143372572 17:6449522-6449544 GGAGACTGAGGCCCAGAGAGGGG - Intronic
1143627217 17:8117546-8117568 GGAAACCCAGGCTCAGAGAGGGG + Intronic
1143729479 17:8872939-8872961 GGAAACTGAGGCCCAGAGACTGG - Intergenic
1144216849 17:13063479-13063501 GGAAACTGACCCTCAGAGATTGG - Intergenic
1144718341 17:17450217-17450239 GGAAACTGAGGTTCAGAGAGAGG + Intergenic
1144769134 17:17749537-17749559 GGAAACTGAAATTCAGAGAGGGG + Intronic
1144831329 17:18132830-18132852 GGAAACTGAGGCACAGAGAGGGG - Intronic
1144833084 17:18142599-18142621 GGAAACTGGAGCTCAGAGAGGGG - Intronic
1145018161 17:19412156-19412178 GGAAATTGAGGCCCAGAGAGGGG + Intronic
1145269321 17:21396273-21396295 GGAAACTGAGGCTCAGAGAAGGG + Intronic
1145752248 17:27363511-27363533 GGGACATGAGGCACAGAGAGAGG + Intergenic
1145903640 17:28504778-28504800 GGAAACTGAGGCTCAGAGTGGGG + Intronic
1145907231 17:28523194-28523216 GGAAACTGAAGATCAGAAAGGGG + Intronic
1146124226 17:30219241-30219263 GGAAATTGGGGCTCAGAGAGGGG - Intronic
1146208974 17:30927130-30927152 GGAAACTGAGGCCCAGAGAAAGG - Intronic
1146260151 17:31415653-31415675 GGAAACTGAGGCCGAGAGAGGGG + Intronic
1146486665 17:33248745-33248767 GGGAACTGACACATACAGAGAGG - Intronic
1146572335 17:33963489-33963511 GAAAACTGAAGCTCAGAGAGGGG + Intronic
1146617598 17:34369381-34369403 GGAAATTGAGGCTTAGAGAGAGG - Intergenic
1146634091 17:34491343-34491365 GGAATCTGAGGCCCAGAGAGGGG + Intergenic
1146680859 17:34807092-34807114 AGAAACTGAGGCTCAGAGAAAGG + Intergenic
1146680964 17:34807954-34807976 GCAAACTGAGGCTCAGAAAGTGG - Intergenic
1146925786 17:36743878-36743900 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1147042530 17:37729802-37729824 AGGAACTGAGGCCCAGAAAGAGG - Intronic
1147055075 17:37827890-37827912 GAAAACTGAGGCTCAGAGAGAGG + Intergenic
1147238145 17:39072596-39072618 GGAAACTGAGGCTCAGAGAGGGG + Intronic
1147561319 17:41511139-41511161 GGAAACTGAAACCCAGAGAGAGG + Intergenic
1147586448 17:41656125-41656147 GGAAACTGGGGCCCAGAGAGGGG - Intergenic
1147588147 17:41664899-41664921 GGAAACTGAGGCTCAGAGAAGGG - Intergenic
1147598477 17:41731886-41731908 GGAAATTGAGGCTCAGAGAAAGG + Intronic
1147644354 17:42024921-42024943 AGAAACTGATGCCCAGAGAGGGG - Exonic
1147653803 17:42077230-42077252 GGAAACTGAAGCTCAGAGAGGGG - Intergenic
1147689559 17:42307068-42307090 GGAAACTGAGGCACAGAGAATGG - Intronic
1147704307 17:42415337-42415359 GGAAGCTGAGGCCCAGAGAGGGG - Intronic
1147744678 17:42687904-42687926 TGGAGCTGACGCTCAGCGAAGGG + Exonic
1148093942 17:45039668-45039690 GGGGACTGAGGCTCAGAGGAGGG - Intronic
1148158563 17:45437134-45437156 GGGCTCTGACGCTGAGAAAGCGG + Exonic
1148238056 17:45982629-45982651 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1148890156 17:50801345-50801367 GGGTGCTGAGGTTCAGAGAGAGG + Intergenic
1148957110 17:51363009-51363031 GGGAACTGAGGCCCAAAGACAGG - Intergenic
1149576204 17:57715398-57715420 GGAAACTGAGGCTCAGAGAATGG + Intergenic
1149651284 17:58278141-58278163 GGGATCTGAGGCACAGAGAGAGG + Exonic
1150327689 17:64269851-64269873 GGGAACTGACGCAGGGAGGGAGG + Intergenic
1150389985 17:64784533-64784555 GGGCTCTGACGCTGAGAAAGGGG + Intergenic
1150638215 17:66931405-66931427 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1150641559 17:66953151-66953173 GGGACCTGCCTCCCAGAGAGGGG - Intergenic
1150696737 17:67411877-67411899 GGAAACTGAGGCACAGAGAGGGG + Intronic
1151535814 17:74738242-74738264 GGAAACCGAGGCCCAGAGAGAGG - Intronic
1151888812 17:76940173-76940195 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1152007420 17:77691341-77691363 GGGAACTGAGACTCAGAGAGAGG + Intergenic
1152042789 17:77915375-77915397 GGAAACTGAGGCACACAGAGAGG - Intergenic
1152258983 17:79256387-79256409 GGGAGCTGAAGCCCAGAGTGAGG + Intronic
1152303805 17:79509840-79509862 GGAAGCTGAGGCTCAGGGAGGGG - Intronic
1152424522 17:80211631-80211653 GTGCACGGATGCTCAGAGAGGGG + Intronic
1152436195 17:80277945-80277967 GGGAAAGGGCGCACAGAGAGGGG + Intronic
1152613615 17:81328155-81328177 GGAAACTGAGGCGCAGAGTGAGG - Intronic
1152895548 17:82909052-82909074 GGAAACTGAGGCACAGAGAGAGG - Intronic
1153235668 18:2984725-2984747 GGAAACTGAGGCCCAGAAAGAGG + Intronic
1153475427 18:5494072-5494094 TGGATCTGAAGCTCAGTGAGAGG - Intronic
1154503289 18:15007100-15007122 GTAAACTGAGGCTCAGAAAGGGG + Intergenic
1155061179 18:22230084-22230106 GGAAACTGAGGCACAGAGAGAGG - Intergenic
1156126373 18:33910471-33910493 GGGAACTGAGGCCCTGGGAGAGG - Intronic
1157394496 18:47330577-47330599 GGGAACTGAAGCACAGAGACGGG - Intergenic
1157508750 18:48252449-48252471 GGAAACTGAGGCCCAGAGAGAGG - Intronic
1157543961 18:48534887-48534909 GGAAACTGAGGCCCAGAGACAGG + Intergenic
1157683207 18:49622975-49622997 GGGAACTGAGGTTCTGAGAGAGG - Intergenic
1157873838 18:51253769-51253791 GGAAACTAAGGCTCAGGGAGGGG + Intergenic
1158185360 18:54765290-54765312 GGGAAATTAAGATCAGAGAGGGG - Intronic
1160677496 19:399280-399302 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1160750003 19:729396-729418 GGAAACTGAGGCCCAGGGAGTGG - Intronic
1160775875 19:855485-855507 GGAAACTGAGGCCCGGAGAGGGG + Intronic
1160798578 19:956793-956815 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1160815207 19:1032256-1032278 GGAAACTGAGGCCCAGAGAGAGG + Intronic
1160824354 19:1072732-1072754 GGAAACTGAGGCATAGAGAGGGG - Intronic
1160833525 19:1114015-1114037 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1160907955 19:1460605-1460627 GGAAACTGAGGCCCAGACAGGGG - Intronic
1160924091 19:1534865-1534887 GGAAACTGAGGCTCAGATGGGGG - Intronic
1160928850 19:1560286-1560308 GGAAACTGAGGCACAGGGAGTGG + Intronic
1160940909 19:1620058-1620080 GGAAACTGAGGCTCAGAGATAGG - Intronic
1160943865 19:1632242-1632264 GGAAACTGAGGCTGAGAGAAGGG - Intronic
1160952955 19:1676180-1676202 GGAAATTGAGGCGCAGAGAGGGG + Intergenic
1161084647 19:2329137-2329159 GGAAACTGAGGCTCGGAGAGGGG - Intronic
1161128602 19:2574503-2574525 AGGACCTCACGCTCAGTGAGAGG - Intronic
1161154245 19:2723920-2723942 GGAAACTGCTGCTCAGAGAAGGG + Intronic
1161204784 19:3035379-3035401 GGAAACTGAGGCGCAAAGAGGGG - Intronic
1161205104 19:3036688-3036710 GTAAACTGAGGCTCAAAGAGAGG - Intronic
1161266010 19:3365138-3365160 GGAAACTGAGGCCCAGAGAACGG - Intronic
1161268494 19:3376046-3376068 GGAAACTAAGGCTCAGAGAGGGG - Intronic
1161271641 19:3392851-3392873 GGAAACTGAGGCCCGGAGAGGGG + Intronic
1161272799 19:3399197-3399219 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1161282852 19:3454999-3455021 GAAAACTGAGGCTCAGAGAGGGG - Intronic
1161337015 19:3720115-3720137 GGAAACTGAGGAACAGAGAGGGG + Intronic
1161342728 19:3751870-3751892 GGAAACTGAGGCCCAGAGATAGG - Intronic
1161404400 19:4083565-4083587 GGAAACTGAGGCTCTCAGAGGGG + Intergenic
1161475198 19:4480826-4480848 GGAAACTGAGGCTCACAGAGGGG - Intronic
1161482493 19:4517959-4517981 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1161493837 19:4576961-4576983 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1161504698 19:4637595-4637617 GGAGACTGAGGCCCAGAGAGAGG - Intergenic
1161604020 19:5204570-5204592 GGAAACTGAGGCTCAGGGAGGGG - Intronic
1161622051 19:5303185-5303207 GGAAACTGAGTCCCAGAGAGTGG - Intronic
1161625586 19:5324689-5324711 GGAAACCGAGGCTCAGAGAGGGG - Intronic
1161627303 19:5334793-5334815 GGAAACTGAGGCACAGGGAGGGG - Intronic
1161631278 19:5357372-5357394 GGAAACTGAGGCCCAGCGAGAGG - Intergenic
1161632600 19:5366105-5366127 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1161632692 19:5366706-5366728 GGGTGCTGAGGCCCAGAGAGAGG + Intergenic
1161635522 19:5386452-5386474 GGAAACTGAGGCTCAGCCAGAGG + Intergenic
1161649147 19:5473640-5473662 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1161703642 19:5807701-5807723 GGAAACTAAGGCCCAGAGAGAGG + Intergenic
1161719459 19:5895021-5895043 GGAAACTGATGCACAGAGGGAGG + Intronic
1161761331 19:6174986-6175008 GAAAACTGAGGCTCAGACAGAGG + Intronic
1161797424 19:6395129-6395151 GGGAACCGAGGTTCAGTGAGAGG - Intergenic
1161861719 19:6802816-6802838 AACAACTGAGGCTCAGAGAGGGG - Intronic
1162142692 19:8594235-8594257 GTAAACTGAGGCCCAGAGAGGGG - Intronic
1162180142 19:8863101-8863123 GCAAACTGAGGCTCAGAAAGGGG - Intronic
1162181217 19:8870449-8870471 GGAAACTGAGGCACAGAGAAGGG - Intronic
1162419069 19:10555530-10555552 GGTAACTGAGGCTCAGAGAACGG + Intronic
1162531524 19:11238808-11238830 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1162756605 19:12864679-12864701 GGAAACTGAGGCTCTGAGAGGGG - Intronic
1162768441 19:12934332-12934354 GAAAACTGAGGCTCAGAGGGTGG + Intergenic
1162801021 19:13110464-13110486 AGAAACTGAGGCACAGAGAGGGG - Intronic
1163024496 19:14502534-14502556 GGAGACTGAGGCTCAGAGAGGGG + Intergenic
1163055301 19:14713486-14713508 GGGAATTGACACCCAGAGAATGG + Intronic
1163157302 19:15446421-15446443 AATAACTGAGGCTCAGAGAGAGG - Intronic
1163161170 19:15464741-15464763 GGCAACGGAGGCTCAGAGAGAGG - Intergenic
1163161475 19:15467180-15467202 GGAAAACGAGGCTCAGAGAGAGG - Intergenic
1163172070 19:15538327-15538349 GGAAACTGAGCCTCAGAAAGTGG - Intronic
1163196787 19:15727500-15727522 GAGCAATGAGGCTCAGAGAGGGG + Intergenic
1163220130 19:15913090-15913112 GGGAACCGAGGCACAGAGAGAGG + Exonic
1163228292 19:15980140-15980162 GGAAAATAAAGCTCAGAGAGGGG + Intergenic
1163270208 19:16248492-16248514 GGAAACTGAGGCTCAGAGACAGG + Intergenic
1163281730 19:16322569-16322591 GGAAACTGAGGCCCAGAGAAAGG + Intergenic
1163339898 19:16698920-16698942 GGAAATTGAGGCTCAGAGAAGGG - Intergenic
1163434951 19:17289878-17289900 GGAAAGTGAAGCTCAGAGAGCGG - Intergenic
1163467277 19:17475576-17475598 GAGAACAGAGGCACAGAGAGGGG + Intronic
1163481746 19:17560574-17560596 GTAAACTGAGGCTTAGAGAGGGG + Intronic
1163514313 19:17753988-17754010 GTAAACTGAGGCACAGAGAGGGG + Intronic
1163520628 19:17789499-17789521 GGAAACTGACGCACAGCCAGAGG - Intergenic
1163525133 19:17816359-17816381 GGAAACTGAGGCCCAGGGAGAGG - Intergenic
1163548190 19:17951435-17951457 GGAAACTGAGGCTCAGAAAGGGG + Intronic
1163548312 19:17951923-17951945 GGAAACTGAGGCCCGGAGAGCGG - Intronic
1163558801 19:18007225-18007247 GGAAACTGAAGCCCAGAGAGAGG + Intronic
1163583917 19:18153867-18153889 GGAAACTGAGGCCCCGAGAGGGG - Intronic
1163584112 19:18154736-18154758 GGAAACTGAGGCTCAGAGCAGGG - Intronic
1163730857 19:18948529-18948551 GGAAACTGAGGCTCAGAGAATGG - Intergenic
1164051031 19:21586203-21586225 GGAAACTGAGGCCCAAAGAGGGG - Intergenic
1164520052 19:28972242-28972264 AGGGACTGACACTCAGGGAGAGG - Intergenic
1164588141 19:29490422-29490444 GGAAACTGAAGCCCAGAGAGGGG + Intergenic
1164590609 19:29504917-29504939 GGGGACTCAAGCTCAGGGAGGGG + Intergenic
1164671367 19:30073939-30073961 GGAAACAGAGGCCCAGAGAGGGG + Intergenic
1164689479 19:30199650-30199672 GGAGACTGAGGCCCAGAGAGTGG - Intergenic
1164915856 19:32051945-32051967 GGCCACTAAGGCTCAGAGAGGGG - Intergenic
1165069924 19:33249216-33249238 GGGAACTGAGCCTCGGAGAGGGG + Intergenic
1165333959 19:35156169-35156191 GGAAACTGAGGCTCAGCGAAGGG + Intronic
1165334112 19:35157073-35157095 AGCAACTGAGGCTCAGAGAAAGG + Intronic
1165394547 19:35557284-35557306 GGAAACTGAGGCTCAGAGAGGGG + Intronic
1165411790 19:35666576-35666598 GGGGTCTGAGGCTCAGGGAGGGG + Intronic
1165481657 19:36068130-36068152 GGAACCTTAAGCTCAGAGAGTGG - Intronic
1165735961 19:38175739-38175761 GGAAACTGAGGCTCACTGAGGGG + Intronic
1165811688 19:38615644-38615666 GGAAACTGAGGCCCAAAGAGAGG - Intronic
1165890473 19:39109187-39109209 GGGAACTGAGGCTCAGAGAGGGG + Intronic
1166033626 19:40151507-40151529 GTAAACTGAGGCGCAGAGAGTGG + Intergenic
1166044907 19:40224317-40224339 GGAGACCGAGGCTCAGAGAGAGG - Intronic
1166051788 19:40264960-40264982 AGAAACTGAGGCCCAGAGAGGGG - Intronic
1166075374 19:40411083-40411105 GGAAACTGAGGCTCACAGAGGGG + Intronic
1166114223 19:40642953-40642975 GGAAGCTGAGGCTCAGAGAGAGG + Intergenic
1166200363 19:41233682-41233704 AGGAACTGAGGCCCAGAGAGGGG + Intronic
1166200369 19:41233706-41233728 AGGAACTGAGGCCCAGAGAGGGG - Intronic
1166218063 19:41349207-41349229 GGAAACTGACATTCAGAAAGAGG - Intronic
1166220508 19:41361326-41361348 GGAAACTGAGGCTCCAAGAGGGG + Intronic
1166228946 19:41414418-41414440 GAAAACTGAGGCTCAGAGAAGGG - Intronic
1166230618 19:41424168-41424190 GGAAACTGAGGCACAGAGAAGGG - Intronic
1166326310 19:42053235-42053257 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1166343459 19:42151626-42151648 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1166354631 19:42219635-42219657 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1166500834 19:43340006-43340028 GGAAACTGAGGCTCAGAGACGGG + Intergenic
1166505294 19:43367684-43367706 GGAAACTGAGGCTCAGAGACGGG + Intergenic
1166509266 19:43393411-43393433 GGAAACTGAGGTTCAGAGACAGG - Intergenic
1166521348 19:43482267-43482289 GGGAACTGAGGCTCCCAGAGGGG - Intronic
1166584417 19:43932990-43933012 GGGAGCTCACGCACACAGAGGGG + Intronic
1166657866 19:44625519-44625541 GGAAACTGGGGCTCAGAGAGGGG - Intronic
1166678118 19:44751519-44751541 GGAAACTGAGGCTCAGAGCAGGG - Intronic
1166706538 19:44911131-44911153 GAGAGCTGGCGCTCAGAGAGGGG + Intergenic
1166733788 19:45072707-45072729 GGAAGCTGACGCTCAGAGGAGGG + Intronic
1166735003 19:45079006-45079028 AGAAACTGAGGTTCAGAGAGGGG - Intergenic
1166794216 19:45416680-45416702 GGAAACTGAAGGCCAGAGAGAGG + Intronic
1166797507 19:45436164-45436186 GGAAACTGAGGCTCAGAGAGAGG - Intronic
1166826543 19:45613434-45613456 GGAAACCGAGGCTCAGAGAAGGG + Intronic
1166833921 19:45655266-45655288 GGAAACTGAGGCCCAGAGAAGGG - Intergenic
1166857370 19:45789526-45789548 GAGAAGTGAGGCTCAGAGAATGG + Intronic
1166873275 19:45883401-45883423 AAGTACTGAGGCTCAGAGAGGGG - Intergenic
1166875803 19:45896537-45896559 GTGATTTGAGGCTCAGAGAGAGG + Intronic
1166878925 19:45914984-45915006 GGAAACTGAGGCACAGAGAATGG - Intergenic
1166938874 19:46351042-46351064 GGGCACTGAGGCCCACAGAGAGG - Intronic
1166963478 19:46513870-46513892 GGAAACTGAGGCTCAGAGGTGGG - Intronic
1166968358 19:46544885-46544907 GGGAAGTGACAGTCAGAGAAGGG - Intronic
1166983783 19:46648215-46648237 GGAAAGTGACGCCCAGAGAAGGG + Exonic
1166988911 19:46678824-46678846 GGAAACTGAGGCACAGAGGGGGG - Intronic
1167017322 19:46849746-46849768 GGGAACTGAGACTGAGAAAGTGG - Intronic
1167096631 19:47378001-47378023 GGGGACTGAAGCTCAGGCAGGGG + Intronic
1167102104 19:47409980-47410002 GGAAACGGAGGCTCAGAGTGGGG - Intronic
1167104016 19:47419932-47419954 GGGAATCGAGCCTCAGAGAGGGG - Intergenic
1167259702 19:48451382-48451404 GGAAACTGAGGCTCAGCAAGAGG + Intronic
1167315814 19:48762175-48762197 GGGAACAGAGACCCAGAGAGAGG + Intergenic
1167315847 19:48762312-48762334 GGGGACAGAGGCCCAGAGAGAGG + Intergenic
1167315873 19:48762400-48762422 GGGGACAGAGGCCCAGAGAGAGG + Intergenic
1167315892 19:48762468-48762490 GGGAACAGAGGCCCAGAGAGAGG + Intergenic
1167368484 19:49066730-49066752 GGGAACAGAGACCCAGAGAGAGG - Intergenic
1167384625 19:49156540-49156562 GGGAACAGAGACCCAGAGAGAGG - Intergenic
1167384641 19:49156610-49156632 GGGAACAGAGACCCAGAGAGAGG - Intergenic
1167388166 19:49176922-49176944 AGAAACTGGGGCTCAGAGAGGGG - Intronic
1167388307 19:49177744-49177766 AGAGACTGAGGCTCAGAGAGAGG + Intronic
1167414070 19:49361340-49361362 GGGGACAGAGGCTCAGAGAGAGG + Intronic
1167420489 19:49399755-49399777 GGCAACTGAGGCACAGAGAAGGG - Intronic
1167447233 19:49544721-49544743 GGGAACAGAGACCCAGAGAGAGG + Intronic
1167463347 19:49637895-49637917 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1167477912 19:49711652-49711674 GGGAACTGAGGCTTAGAGAGGGG - Intronic
1167485102 19:49758158-49758180 GGGAACAGAGACCCAGAGAGAGG - Intronic
1167571505 19:50291905-50291927 GCAAACTGAGGCTCAGAGAGGGG + Intronic
1167657816 19:50777762-50777784 GGAAACTGAGGCACAGAGAGTGG - Intergenic
1167668806 19:50838295-50838317 GGGAACTGAGGCCCAGGGAGAGG + Intergenic
1167690475 19:50981626-50981648 GGGTACAGAGGCCCAGAGAGAGG + Intronic
1167792890 19:51691921-51691943 GGGGGCTGAGCCTCAGAGAGGGG - Intergenic
1168092928 19:54097264-54097286 GGAAACTGAGGCTAAGAAAGGGG - Intronic
1168121117 19:54253137-54253159 GCAAACTGAGGCTCAGAGAGGGG + Intronic
1168123858 19:54272062-54272084 GGAAACCGAGGCTCAGAGATGGG - Intronic
1168124706 19:54277080-54277102 AAAAACTGACGCTCAGAGAGGGG + Intronic
1168128333 19:54299653-54299675 GGAAACTGAGGCTCAGAGAAGGG - Intergenic
1168171557 19:54593282-54593304 GGAAACTGAGGCTCAGTGATGGG + Intronic
1168177280 19:54634468-54634490 AAAAACTGACGCTCAGAGAGGGG - Intronic
1168178501 19:54643473-54643495 GGAAACCGAGGCTCAGAGATGGG + Intronic
1168181584 19:54665629-54665651 ACAAACTGAGGCTCAGAGAGGGG - Intronic
1168280687 19:55303936-55303958 AGGAAATGAGGCCCAGAGAGGGG - Intronic
1168309080 19:55451776-55451798 GGGAACTGAGGCTCGGAGCTGGG - Intergenic
1168351951 19:55680991-55681013 GGAAACTGAGGCCCAGAGACGGG + Intronic
925189492 2:1871375-1871397 GGGAACTGAGGAGCAGAGATAGG - Intronic
925651235 2:6091675-6091697 GGCAACTGAGGCTCACAGAGCGG + Intergenic
925907041 2:8545790-8545812 GGAAACTGAGGCACAGAAAGAGG - Intergenic
925911331 2:8575360-8575382 GGGACCCGACGCTCAGGGTGAGG - Intergenic
926037021 2:9643786-9643808 AGGCTCTGAGGCTCAGAGAGGGG - Intergenic
926085451 2:10016982-10017004 GGGAAGTAGAGCTCAGAGAGTGG + Intergenic
926121191 2:10242016-10242038 GGAAACTGAGGCACAGAGAGGGG - Intergenic
926579401 2:14618107-14618129 AGGACCTCAGGCTCAGAGAGGGG - Intergenic
926689537 2:15723978-15724000 GGGAAATGAAGCCCAGAGCGGGG + Intronic
926734100 2:16059339-16059361 GGAAACTGAGGCCCAGAGTGGGG + Intergenic
926799178 2:16644098-16644120 GGAAACCGATGCTCAAAGAGGGG - Intronic
926799306 2:16645363-16645385 GGAAGCTGATGCTCAAAGAGGGG - Intronic
926800430 2:16655357-16655379 AGGAACTGAGGCTCAGGGAGGGG + Intronic
926946935 2:18198598-18198620 AGAAACTGAGGCCCAGAGAGGGG + Intronic
927048386 2:19303005-19303027 GAAAACTGAGGCTCATAGAGAGG - Intergenic
927216345 2:20669765-20669787 GGGAACTGAGGCCCAGGTAGGGG - Intronic
927243834 2:20941168-20941190 GGAAACTGAGGCTCAGGGAGGGG - Intergenic
927877992 2:26671393-26671415 GGAAACTGTTGCCCAGAGAGGGG - Intergenic
927880151 2:26684535-26684557 GGAAACTGAGGCTCAGAGAAGGG + Intergenic
928127921 2:28628967-28628989 AGAAACTGAGGCCCAGAGAGGGG - Intronic
928340299 2:30437218-30437240 GGAAATTGAATCTCAGAGAGGGG + Intergenic
928436509 2:31257954-31257976 GGAAACTGAGGCTCAGGAAGGGG - Intronic
929032536 2:37662606-37662628 GGGGAGTGAGGTTCAGAGAGAGG - Intronic
929596038 2:43176660-43176682 GGAAACAGAGGCTCAGAAAGAGG - Intergenic
929770634 2:44888707-44888729 GTGAACTGACTGTCAGACAGAGG + Intergenic
929790294 2:45017583-45017605 GGGAACCCAAGCTCAGAGAGAGG - Intergenic
932812337 2:74835240-74835262 CGGAACTGAGGCTCGGCGAGGGG + Intronic
933780272 2:85796197-85796219 AGAAACTGAGGCTCAGGGAGGGG - Intergenic
934859262 2:97750081-97750103 GGAAACTGAGGCTCTGAGAGGGG + Intergenic
934938200 2:98480386-98480408 GGGAAGGGATGCTCAGAGAGAGG + Intronic
934942343 2:98511725-98511747 GGAAACTGATGCACAGAGATGGG + Intronic
935180888 2:100690481-100690503 TGAAACTGAGGCACAGAGAGAGG + Intergenic
935250888 2:101259441-101259463 GAGAACTGGTGGTCAGAGAGAGG + Intronic
936058658 2:109280307-109280329 GGAAACTGAGGCCCAGAGAGGGG + Intronic
936463408 2:112727339-112727361 GGAAACTGAGGCTCAGAGAGAGG + Intronic
937062192 2:118988993-118989015 GGAAACTGAGGCTCAGAGCAGGG + Intronic
937094397 2:119226031-119226053 GGCAACTGAGGCCTAGAGAGTGG + Intronic
937267799 2:120627893-120627915 AGAAACTGAGGCACAGAGAGAGG - Intergenic
937270089 2:120644076-120644098 GGAAACTGAAGCCCAAAGAGGGG - Intergenic
937292692 2:120791032-120791054 GCAAACTGAGGCTCCGAGAGGGG + Intronic
937426651 2:121805548-121805570 GGAAACTGGGGCCCAGAGAGGGG + Intergenic
938465103 2:131520079-131520101 GCGAACTGAAGCACAGACAGAGG - Intergenic
938502466 2:131837261-131837283 GTAAACTGAGGCTCAGAAAGGGG + Intergenic
938951129 2:136255787-136255809 GGAAACTGAAGCCCAGAAAGGGG - Intergenic
938979201 2:136509560-136509582 GTGAAATGAGGCTCAGAGAAGGG - Intergenic
938985546 2:136571908-136571930 GGAAATTGAGGCTCAGGGAGAGG + Intergenic
941885832 2:170526182-170526204 GGATACTGAGGTTCAGAGAGAGG - Intronic
943613960 2:190069906-190069928 AGAAACTGAGGCCCAGAGAGAGG + Intronic
943805098 2:192113879-192113901 GGCAACTGAAGCTCAGAAAAGGG + Intronic
945975355 2:216266227-216266249 GAAAACTGAGTCTCAGAGAGAGG - Intronic
945976548 2:216275565-216275587 GAGAACTGAGGCTCAGAGAGAGG - Intronic
946190687 2:218006286-218006308 GGAAACTGAGGCCCAGGGAGGGG - Intergenic
946313106 2:218893636-218893658 GGAAGCTGACGGGCAGAGAGAGG + Exonic
946395365 2:219441657-219441679 GGAAACTGAGGCACAGAAAGGGG - Intronic
947917700 2:233844906-233844928 GGGCACTGACCTTAAGAGAGGGG + Intronic
948136893 2:235643086-235643108 GGAAACTGAGGCTCAGAGAGGGG + Intronic
948529613 2:238596004-238596026 GGAAACTGAGCTTCAGAGAGGGG + Intergenic
949035137 2:241812728-241812750 GGAAACTGAGGCCCACAGAGAGG - Intronic
1168789589 20:567345-567367 GAAAACTGAGACTCAGAGAGAGG - Intergenic
1168854649 20:1000192-1000214 GGAAACTGAGGCTCTGAGAAGGG + Intronic
1168953870 20:1820722-1820744 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1168954470 20:1825211-1825233 GGAAACTGAGGTCCAGAGAGAGG + Intergenic
1168955294 20:1830272-1830294 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1168969080 20:1918556-1918578 GGAAACTGAGGCTCAGCAAGGGG - Intronic
1170171682 20:13420754-13420776 GGAACCTGAGGCTCAGAGAAGGG + Intronic
1171960174 20:31487822-31487844 GGAAACTGAGACTCAGAGAGAGG + Intergenic
1171972721 20:31574121-31574143 GGAAAGTGAAGCTCAGAGATGGG - Intronic
1172029383 20:31970921-31970943 GGGAATGGAGGCTCAGAGAGGGG + Intronic
1172035465 20:32007784-32007806 GGAAATTGAGGCCCAGAGAGAGG + Intergenic
1172115883 20:32573337-32573359 GAAAACTGTGGCTCAGAGAGGGG + Intronic
1172115918 20:32573636-32573658 GGAAACTGAGGCTCAGAGAGGGG + Intronic
1172121416 20:32601125-32601147 GGAAACTGAGGCTCAGGGTGGGG + Intronic
1172182843 20:33014099-33014121 GGACACTGAGGCTCAGAGAGGGG + Intronic
1172185639 20:33029501-33029523 GAAAACTGAGGCCCAGAGAGGGG + Intergenic
1172190002 20:33056238-33056260 GAAAACTGAGGCTCAGAGAGGGG - Intronic
1172193300 20:33075242-33075264 AGAAACTGAGGCTCAGGGAGAGG - Intergenic
1172196542 20:33095665-33095687 GAAAACTGAGGCTCAGAGAGAGG - Intronic
1172201050 20:33126200-33126222 GGGAATTGAGGCCCAGAGAGGGG + Intergenic
1172206737 20:33167771-33167793 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1172215208 20:33230745-33230767 GGACACTGAGGCTCAAAGAGGGG + Intergenic
1172226724 20:33310264-33310286 GGAAACTGAGGCCCACAGAGGGG - Intergenic
1172227172 20:33312796-33312818 ATAAACTGAGGCTCAGAGAGAGG + Intergenic
1172442673 20:34977211-34977233 GGAAACTGAGGCCCAGAGAAAGG - Intronic
1172594294 20:36139661-36139683 GGAAACTGAGACCCAGAGAGGGG - Intronic
1172629133 20:36366595-36366617 GGAAACTGAGGCTCAGAAAGGGG + Intronic
1172697161 20:36830864-36830886 AGGAACTGAAGCCCAGAGAAGGG + Intronic
1172703447 20:36865917-36865939 AGAAACTGAAGCACAGAGAGAGG - Intergenic
1172765341 20:37347774-37347796 GGAAACTGAGGCTAAGAGAGGGG + Intronic
1172766262 20:37352683-37352705 GGCAGCTGAAGCTCAGAGAGAGG + Intronic
1172774512 20:37399195-37399217 GATAACTGAGGCTTAGAGAGGGG + Intronic
1172774978 20:37402077-37402099 GAAAACTGAGGCTCAGAGAGGGG + Intronic
1172810671 20:37645633-37645655 GAAAGCTGAGGCTCAGAGAGAGG - Intergenic
1172842737 20:37911762-37911784 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1172845076 20:37925378-37925400 AGGAGCAGAGGCTCAGAGAGGGG + Intronic
1172869898 20:38129521-38129543 GGAGACTGAGGCTTAGAGAGAGG - Exonic
1172872466 20:38144262-38144284 GGAAATGGAGGCTCAGAGAGGGG - Intronic
1172884457 20:38222032-38222054 GGTAACTGAGGCTCAGCGAAGGG - Intronic
1172971244 20:38874442-38874464 GGAAACTGAGGCTCAGATAGAGG + Intronic
1173142488 20:40496202-40496224 GGAAACTGAGGCTTAGAGAGAGG - Intergenic
1173168248 20:40701187-40701209 GGAAAGTGAGGCTAAGAGAGGGG - Intergenic
1173320265 20:41981407-41981429 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1173324408 20:42019446-42019468 GGAAACTGAGTCTCAGAGAGGGG - Intergenic
1173480566 20:43395644-43395666 GGAAACTGAGGCTCAGGGGGAGG - Intergenic
1173575511 20:44110835-44110857 GGAAACTGAGGCACAGAAAGAGG + Intergenic
1173596979 20:44264754-44264776 GGAAACTGAATTTCAGAGAGGGG - Intronic
1173617530 20:44412858-44412880 GGAAACTGAGCCCCAGAGAGAGG + Intronic
1173617966 20:44415133-44415155 GAACACTGAGGCTCAGAGAGAGG - Intronic
1173648240 20:44646930-44646952 GGAAACTGAGACTCAGAGAGGGG - Intronic
1173656522 20:44703604-44703626 GGAAACTGAGGCTTAGAGAGAGG + Intergenic
1173668257 20:44778337-44778359 GGCAACTGAAGCCCAAAGAGGGG + Intronic
1173705549 20:45107853-45107875 GGAAACTGAGGCCCAGAAAGAGG + Intergenic
1173721357 20:45260863-45260885 GGAAACTGAGGCCCAGAGAAAGG - Intergenic
1173729918 20:45320966-45320988 GGAAACTGAGGCTCCAAGAGAGG + Intergenic
1173733078 20:45341909-45341931 GAAAACTGAGGCTCAGAGAAGGG - Intronic
1173814471 20:45976342-45976364 GGCGGCTGAGGCTCAGAGAGGGG + Intergenic
1173814768 20:45980047-45980069 GGAAATTGAAGCCCAGAGAGGGG + Intergenic
1173836092 20:46126866-46126888 AGAAACTGAGGCTAAGAGAGGGG - Intronic
1173837731 20:46136693-46136715 AAAAACTGAGGCTCAGAGAGGGG + Intergenic
1173854893 20:46243883-46243905 GAAAACTGAGGCACAGAGAGGGG + Intronic
1173855065 20:46244984-46245006 GAAAACTGAGGCTCAGAGAAGGG - Intronic
1173857666 20:46261111-46261133 GAAAACTGAGGCTCAGAGAAAGG - Intronic
1173863608 20:46300079-46300101 GGAAACTGAGGCCCAGGGAGAGG - Intronic
1173902105 20:46598441-46598463 GGAAACTGAGGCCCAGAGAAGGG + Intronic
1173906336 20:46632362-46632384 GTGAACTGACGCTCGGAGTGAGG - Intronic
1174077351 20:47947189-47947211 GGAAACTGAGACTCAGGGAGGGG + Intergenic
1174182865 20:48686080-48686102 GGAAACCGAGGCACAGAGAGGGG - Intronic
1174267843 20:49344870-49344892 GGAAACTGAGGCTCAGAGAAGGG - Intergenic
1174272691 20:49381113-49381135 GGAAATAGAGGCTCAGAGAGGGG - Intronic
1174286073 20:49474485-49474507 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1174300605 20:49579588-49579610 GGAAACTGAAGCTCAAAGAGGGG + Intergenic
1174302745 20:49594123-49594145 TGGAAGGGAGGCTCAGAGAGGGG - Intergenic
1174363866 20:50044506-50044528 GGCAACTGAGGCTGAAAGAGGGG - Intergenic
1174367168 20:50063656-50063678 GGAAACTGAGGCTCAGAGACTGG + Intergenic
1174378599 20:50142119-50142141 GGGAACTGAGGCTCAGAGAAGGG - Intronic
1174383243 20:50171078-50171100 GGAAACTGAGGCCCAGAGAGTGG - Intergenic
1174399309 20:50267461-50267483 GGAAGCTGAGGCTCAGAGAGGGG + Intergenic
1174402655 20:50284225-50284247 AGGAAAAGAGGCTCAGAGAGGGG - Intergenic
1174407547 20:50311986-50312008 GGAAACTGAAGCCCAGAGAGGGG - Intergenic
1174423747 20:50417493-50417515 GGAAACTGAGGCACAGAGAGAGG + Intergenic
1174423755 20:50417563-50417585 GGAAACTGAGGCACAGAGAGAGG + Intergenic
1174425323 20:50428064-50428086 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1174545289 20:51320480-51320502 GGAAACAGGGGCTCAGAGAGGGG + Intergenic
1174574102 20:51524785-51524807 GGAAACTGAGGCCCAGAGCGGGG + Intronic
1174874084 20:54208563-54208585 GGAAACTGAGGCCCAGAGATGGG + Intronic
1175180196 20:57140929-57140951 GGCAACTGAGGCTCAGAGACAGG + Intergenic
1175458565 20:59133746-59133768 GGAAACAGACACTCAGAGAAGGG + Intergenic
1175492181 20:59386749-59386771 GGAAACTGAGGCACAGAGGGAGG - Intergenic
1175526767 20:59639664-59639686 GGGAACTGAAGCTCAGAGAGAGG - Intronic
1175827112 20:61942309-61942331 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
1175914212 20:62418295-62418317 GGAAACTGAGGCTCAGTGTGGGG - Intronic
1176071619 20:63229609-63229631 GGAAACCGAGGCTCAGAGAGGGG - Intergenic
1177484941 21:21745397-21745419 GGGAACTGGAGCAAAGAGAGTGG + Intergenic
1180143229 21:45905693-45905715 AGGAACTGACACACACAGAGGGG - Intronic
1181033436 22:20158858-20158880 GAGAACTGAGGCCCAAAGAGCGG - Intergenic
1181164726 22:20977177-20977199 GGAAACTGAGGCTCTGGGAGGGG - Intronic
1181467427 22:23117727-23117749 GGAAACTGAGGCCCAGAGAAAGG + Intronic
1181509873 22:23384389-23384411 GAGAACTGAGGCCCAAAGAGTGG + Intergenic
1181677667 22:24467302-24467324 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
1181737761 22:24895079-24895101 GGAAACTGATGCTCTGAGAGAGG + Intronic
1181753400 22:25005869-25005891 TGAAACTGAGGCTCAGAGAGAGG - Intronic
1181760721 22:25057109-25057131 TGAACCTGAGGCTCAGAGAGGGG + Intronic
1181892970 22:26080667-26080689 GGAAACTGAGGCTGAGAGATGGG - Intergenic
1181905479 22:26191793-26191815 GGAAACTGAAGCTCAGAGAAGGG - Intronic
1181910866 22:26237129-26237151 GGAAACTGAGGCTCAGGGAGGGG - Intronic
1181921562 22:26324788-26324810 GGAAACTGAGGCCCAGAGATGGG + Intronic
1181946563 22:26522203-26522225 GAAAACTGAGGCTCAGAGAAGGG + Intergenic
1181951540 22:26557339-26557361 GGAAACTCAGGCCCAGAGAGTGG - Intronic
1181955338 22:26584171-26584193 GGAAACTGGGGCTCAGAGAGGGG + Intronic
1181957516 22:26598978-26599000 GGAAATTGAGGTTCAGAGAGGGG - Intergenic
1181978855 22:26752166-26752188 GGAGACCGATGCTCAGAGAGGGG + Intergenic
1181984762 22:26792308-26792330 GGAAACTGAGACTCAGAGATGGG + Intergenic
1181989172 22:26824016-26824038 GAAAACTGAGGCTCAGAGACGGG + Intergenic
1182001359 22:26922401-26922423 AGAAACTGAGGCCCAGAGAGGGG - Intergenic
1182007790 22:26975537-26975559 GGGAACTCAGGCCCAGAGAGGGG - Intergenic
1182032471 22:27170329-27170351 GGAAACTGAGGCTCAGAGAAGGG + Intergenic
1182041574 22:27242334-27242356 GGGACCTAGGGCTCAGAGAGGGG - Intergenic
1182048728 22:27297314-27297336 GAAAACTGAGGCTCAGAGACAGG + Intergenic
1182062189 22:27406200-27406222 GGAAACTGAGGCCCAGAAAGGGG + Intergenic
1182065596 22:27429319-27429341 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1182075662 22:27493769-27493791 GGGAACTGAGGCTCAGAGAGGGG + Intergenic
1182081543 22:27532726-27532748 GGCCACTGAGGCTCAGGGAGTGG + Intergenic
1182096563 22:27630087-27630109 GCAAACTGAGGCCCAGAGAGGGG - Intergenic
1182116509 22:27759600-27759622 GGAAACTGAGGCTCAGCAAGTGG - Intronic
1182124943 22:27809558-27809580 GGAAACTGAGGCACAGAGAAGGG - Intergenic
1182132205 22:27863229-27863251 GAGAAATGAGGCCCAGAGAGAGG - Intronic
1182270588 22:29150867-29150889 GGGAACTGAGGGTCAGAGAAGGG + Intronic
1182278213 22:29203597-29203619 AAGAAATGAAGCTCAGAGAGGGG + Intergenic
1182281292 22:29219081-29219103 AGAAACTGAGGCTCAGAGAGGGG + Intronic
1182357343 22:29728272-29728294 AGGAACTGAAGCTCAGAGTGGGG - Intronic
1182366128 22:29780629-29780651 GGAAACTGAGGGTCAGAGAGGGG - Intergenic
1182369879 22:29803385-29803407 GGAAACTGAGGTTCAGAGAGGGG - Intronic
1182397704 22:30048217-30048239 GGAAACTGAGGCTCAGGGTGGGG - Intergenic
1182422259 22:30254284-30254306 GGAAACTGAGGCTCACAGAGTGG + Intergenic
1182425798 22:30271396-30271418 GGAAACTGAGGCTCAGAAGGGGG - Intergenic
1182428596 22:30287609-30287631 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1182474989 22:30572424-30572446 GGAAACCAAGGCTCAGAGAGGGG - Intronic
1182545941 22:31076473-31076495 AGAAACTGAGGCTCAGAGAGGGG - Intronic
1182660270 22:31920107-31920129 GGAAACTGAGGCCCAGAGAAGGG + Intergenic
1182748364 22:32622885-32622907 GGAAACTGAAGCCCAGGGAGGGG + Intronic
1182770472 22:32792178-32792200 GACAGCTGAGGCTCAGAGAGAGG + Intronic
1182785591 22:32905024-32905046 GAAAACTGAAGCTCAGAGAGGGG - Intronic
1182929453 22:34158861-34158883 AGAAACTGAGGCTCAGAGAGAGG - Intergenic
1183035771 22:35139998-35140020 AAAAACTGAGGCTCAGAGAGAGG + Intergenic
1183060688 22:35334716-35334738 GGAAACTGAGGCACAGAGAGGGG + Intronic
1183064383 22:35353201-35353223 GGAAACTGAGGCCCAGAGAGAGG - Intergenic
1183084296 22:35477168-35477190 GGAAACTGAGGCCCAGAGAGTGG + Intergenic
1183086221 22:35488909-35488931 GGAAACTGAGCCTCAGAGAGAGG + Intergenic
1183163067 22:36127751-36127773 GGAAACTGAGGCTCTGAGAGAGG - Intergenic
1183224836 22:36542538-36542560 GGGGCCTGAGGTTCAGAGAGGGG - Intergenic
1183332680 22:37229813-37229835 GGAGACTGAGGCCCAGAGAGGGG + Intronic
1183334641 22:37239654-37239676 GGAGATTGAGGCTCAGAGAGGGG + Intronic
1183342108 22:37287159-37287181 TGGATCTGAAGCTCAGAGAAGGG + Intronic
1183343699 22:37295599-37295621 GGAACCTGAGGCCCAGAGAGAGG + Intronic
1183346899 22:37313025-37313047 GGAAACTGAGGCCCAGAGATGGG + Intronic
1183358720 22:37372533-37372555 GGAAACTGAGGCCCAGAGAAGGG - Exonic
1183359879 22:37377908-37377930 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1183364511 22:37399964-37399986 GGAAACTGAGGCACAGAGAAGGG + Intronic
1183373733 22:37450170-37450192 GGAAACTGAGGCACAGAGAGGGG - Intergenic
1183387851 22:37525354-37525376 GCAAACTGAGGCACAGAGAGGGG - Intergenic
1183388177 22:37526931-37526953 GGAGACTGAGGCCCAGAGAGAGG - Intergenic
1183432636 22:37774900-37774922 GCAAACTGAGGCTCAGTGAGGGG - Exonic
1183440938 22:37822815-37822837 GGAAATTGAGGCCCAGAGAGGGG - Intergenic
1183470189 22:38001168-38001190 GGAAACTGAGGCTGAGAGAGGGG - Intronic
1183475685 22:38034615-38034637 GGACATTGAGGCTCAGAGAGGGG - Intronic
1183487889 22:38099202-38099224 GGCAACTGAGGCCCAGAGATGGG - Intronic
1183505258 22:38205228-38205250 GAAAACTGAGGCCCAGAGAGAGG + Intronic
1183544801 22:38449747-38449769 GGAAACTGAGGCTCAGCAAGGGG - Intronic
1183546899 22:38459162-38459184 CTGAACTGACACACAGAGAGGGG + Intergenic
1183598310 22:38825339-38825361 AGAAACTGAGGCTCAGAGAGGGG - Intronic
1183649218 22:39144759-39144781 GGAAACTGAAGTTCAGAGAAGGG - Intronic
1183653319 22:39171414-39171436 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1183672710 22:39282648-39282670 GGACACTGAGGCTCAGAGAGGGG - Intergenic
1183674359 22:39291365-39291387 GAAAACTGAGGCCCAGAGAGGGG - Intergenic
1183686795 22:39365698-39365720 GGAAACTGAGGCTCAGGGAAGGG - Intronic
1183723074 22:39573511-39573533 AGGTGCTGAGGCTCAGAGAGAGG - Intronic
1183723565 22:39576151-39576173 GAAAACTGAGGCTCAGAGAGGGG - Intronic
1183735487 22:39642607-39642629 GGAAACTGAGGCTCAGTGAGGGG - Intronic
1183739367 22:39661653-39661675 GGAAACTGAGGCTCAGAGAAGGG - Intronic
1183947189 22:41333101-41333123 GGAAACTGAGGCACAGAGTGGGG + Intronic
1183954701 22:41372496-41372518 GGACATCGACGCTCAGAGAGAGG + Intronic
1183959775 22:41404368-41404390 GGAAACTGAGGCTCAGAGCCAGG - Intergenic
1183987827 22:41579008-41579030 GCAAACTAAGGCTCAGAGAGGGG + Intronic
1184010854 22:41747149-41747171 GGGAACTGAGACTCAGGGAAGGG + Intronic
1184104559 22:42359933-42359955 GGCAACTGAGGCCCAGAGAGAGG + Intergenic
1184119352 22:42440288-42440310 GGAAACTGTGGCTCAGAGAAGGG + Intergenic
1184337285 22:43861517-43861539 AGGCACAGAGGCTCAGAGAGGGG - Intronic
1184365601 22:44049159-44049181 GGAAACTGAGGCCCTGAGAGAGG + Intronic
1184458781 22:44625712-44625734 GGAAACTGAGGCTCAGGGAGGGG - Intergenic
1184497518 22:44850641-44850663 AGGAACTGCTGCTCAAAGAGGGG - Intronic
1184606260 22:45576435-45576457 GGAAACTGAGGCCCACAGAGAGG + Intronic
1184606684 22:45578515-45578537 GGAAACTGAGGCCCAGAGTGGGG - Intronic
1184661018 22:45965527-45965549 GGAAACTGAGGCCCAGAGAAGGG + Intronic
1184799183 22:46749820-46749842 GGAAGGTGATGCTCAGAGAGGGG + Intergenic
1184913918 22:47553957-47553979 GGGAGCTGACGTACAGAGTGGGG - Intergenic
949537554 3:5007504-5007526 GGCAACTGAGGCACAGAGAAGGG - Intergenic
949872607 3:8602110-8602132 GGAAACTGAGGCTGAGAGAGGGG - Intergenic
949897047 3:8775755-8775777 GGAAACCGAGGTTCAGAGAGGGG + Intronic
950018774 3:9771547-9771569 GTAAACTGAGACTCAGAGAGAGG + Intronic
950098135 3:10342037-10342059 GGAAACAGAGGCCCAGAGAGGGG - Intronic
950103902 3:10376445-10376467 GGAAACTGAGGCTCAGATAGGGG + Intronic
950109094 3:10407148-10407170 GGGAACTGGAGCTCCAAGAGGGG - Intronic
950110224 3:10413979-10414001 GGAAACTGTAGCTCAGAGAAGGG - Intronic
950172323 3:10847563-10847585 AGAAACTGAGGCTCAGAGAGTGG + Intronic
950192727 3:10988951-10988973 GTAAACTGAGGCCCAGAGAGAGG - Intergenic
950197401 3:11018464-11018486 GGACACTGAGGCTAAGAGAGAGG - Intronic
950297127 3:11841871-11841893 GGAAACTGAAGTTCAGAGAGAGG - Intronic
950315260 3:11996368-11996390 GGAAACAGAAGCTCAAAGAGGGG - Intergenic
950437055 3:12986439-12986461 GGAAACTGAGGCTCACAGAGGGG - Intronic
950447705 3:13047775-13047797 GGAAACTGAGGCTCAAGGAGAGG + Intronic
950451926 3:13070271-13070293 GGAAACTGAGGCTCAGAGAGGGG - Intronic
950462737 3:13135099-13135121 GGAAACCGAGGCTCAGAGTGGGG - Intergenic
950531236 3:13553364-13553386 GGAAACTGAGGCGCAGAGTGGGG + Intronic
950546077 3:13638784-13638806 GGAAACTGAGGCCCTGAGAGCGG + Intergenic
950551142 3:13666575-13666597 GGAAACTGAGGCTCAGGGAAGGG - Intergenic
950554163 3:13685191-13685213 GGAAACTGAGGCCCAGAGATGGG - Intergenic
950563065 3:13746945-13746967 GGAAACTGAGGCCAAGAGAGGGG + Intergenic
950639223 3:14337567-14337589 GGAAACCGAAGCACAGAGAGGGG + Intergenic
950655754 3:14435228-14435250 GGAGACTGAGGCTCAGAGAAGGG - Intronic
950656917 3:14442356-14442378 GGAAACTGATGCTCAGAGAGGGG + Intronic
951427647 3:22566283-22566305 GGAAACCGAGGCTCAAAGAGGGG + Intergenic
952055302 3:29436998-29437020 GGAAACTGAGGCTTAGAGGGAGG - Intronic
952923690 3:38306619-38306641 GGAAACCGAAGCTCAGAGATGGG + Intronic
952961822 3:38596860-38596882 GGAAACTGAGGCCCAGAGACAGG - Intronic
953018607 3:39100042-39100064 GGAAACTGAGGCTCAGAGATGGG - Intronic
953143340 3:40249690-40249712 GGAAAATGATGCCCAGAGAGGGG + Intronic
953227278 3:41032418-41032440 GAAAACTGACGCAGAGAGAGTGG + Intergenic
953417507 3:42731358-42731380 GGGAACTGGGGCCAAGAGAGAGG - Intronic
953432767 3:42853312-42853334 AGGAACTGAGACTCAGAGAAGGG - Intronic
953679533 3:45029062-45029084 GGAACCTGAGGCTCAGAGAGTGG + Intronic
953755984 3:45646269-45646291 GGCGACTGACGCACAGTGAGGGG - Intronic
953998082 3:47536052-47536074 GGAAACTGATGCCCAGAGAGAGG - Intergenic
954313383 3:49786971-49786993 GGAAACTGAGGCTCAGAGAGGGG + Intergenic
954389052 3:50259488-50259510 GAGAAATGAAGCTCAGAGCGTGG - Intergenic
954582446 3:51710431-51710453 GGAAACGAAGGCTCAGAGAGAGG + Intronic
954747495 3:52795391-52795413 GGAAACTGAGGTCCAGAGAGGGG - Intronic
954795443 3:53159335-53159357 GCAAACTGAGGCTCAGAGAAAGG - Intronic
954853946 3:53626703-53626725 GTAAATTGAGGCTCAGAGAGAGG - Intronic
954942308 3:54385330-54385352 GGAAGCTGAGGCTCAGACAGGGG + Intronic
955155430 3:56412450-56412472 GGAAACTGAGGCTCAGAGTGAGG + Intronic
955216012 3:56985631-56985653 GGAAACTGAGGTTCTGAGAGGGG + Intronic
955240017 3:57169931-57169953 GGAAGCTGATGCTCAGCGAGGGG + Intronic
955318770 3:57959603-57959625 GGAAACTGAGACTCAGAGAGAGG + Intergenic
955407477 3:58634495-58634517 GGAAACTGAGGCTCAGAGAGGGG + Intronic
955754419 3:62213554-62213576 GTGAACAGACACTCAGAGATGGG + Intronic
955941249 3:64149019-64149041 GGGTACTTACGCTCCCAGAGGGG - Intronic
956478708 3:69651447-69651469 GGAATCTGAGGCTCAGAAAGAGG + Intergenic
956517845 3:70069532-70069554 GGGAACTGAAGCTTGTAGAGAGG + Intergenic
956746306 3:72313532-72313554 GAAAACTGAGGCTCAGGGAGAGG + Intergenic
956750891 3:72343038-72343060 GGCTACTGAAACTCAGAGAGGGG + Intergenic
960961833 3:123076289-123076311 GAAAACTGAGGCTCAGAGAAGGG - Intronic
961032942 3:123622325-123622347 GGCTACTGAGGCCCAGAGAGGGG - Intronic
961034318 3:123631843-123631865 AGAAACTGAGGCCCAGAGAGGGG - Intronic
961165709 3:124762413-124762435 GGAAACTGATTCTCAGAGAGGGG - Exonic
961480042 3:127173669-127173691 AGAAACTGAGGCACAGAGAGAGG - Intergenic
961635160 3:128328689-128328711 GGGAACTGCCCCTCAGGGGGTGG + Intronic
961811662 3:129525459-129525481 GCAAACTGAGGCCCAGAGAGGGG + Intergenic
961826104 3:129599913-129599935 GGAAACTGAGGCCAAGAGAGGGG - Intronic
962007203 3:131361159-131361181 GGGATCTGACGCACAGGAAGTGG - Intergenic
962009567 3:131380875-131380897 GGGGTCTGACGCACAGGGAGTGG - Intergenic
962068729 3:132011058-132011080 GGAAACTGAAGCTCAGAAACGGG + Intronic
962311599 3:134330901-134330923 GAAAACTGAGGCTCGGAGAGGGG + Intergenic
962826084 3:139101940-139101962 GGAAACTGAGGCTCTGAGAGGGG - Intronic
962977207 3:140456178-140456200 AGAAACTGAGGCCCAGAGAGGGG - Intronic
964027629 3:152096867-152096889 GGGTACTCAGGCTAAGAGAGTGG + Intergenic
964567800 3:158076596-158076618 GAGACCTGAAGCACAGAGAGAGG - Intergenic
966785621 3:183620151-183620173 GGGAACTGAGGCCCAGTGAGTGG - Intergenic
966918518 3:184597773-184597795 GGAAACTGAGGCCCAGGGAGAGG - Intronic
967136730 3:186519047-186519069 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
967266935 3:187699339-187699361 GAGAAATGAAGCCCAGAGAGGGG - Intronic
967378276 3:188829605-188829627 GGAATCAGAAGCTCAGAGAGGGG + Intronic
967390764 3:188951689-188951711 AGAAACTGAAGCTCAGACAGAGG - Intronic
967654197 3:192026768-192026790 AAAAACTGAAGCTCAGAGAGAGG + Intergenic
967840992 3:194004258-194004280 GGAAACTGAGGCTCAGAGAAGGG - Intergenic
967883359 3:194316944-194316966 GGAAACTGAGGCCCAGAGAAGGG + Intergenic
967891246 3:194365922-194365944 GGAAACTGAGACCCAGAGAGGGG + Intronic
967910613 3:194539684-194539706 GGATACTGAGGATCAGAGAGGGG - Intergenic
967931867 3:194695754-194695776 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
967934634 3:194717089-194717111 GGGATCTGAGGGTCAGAGAGGGG + Intergenic
968284086 3:197498120-197498142 GGGAAATGAAGCTCAAAGAGGGG + Intergenic
968289667 3:197528792-197528814 GGAAACTGAGGCCCAGGGAGGGG + Intronic
968392852 4:207068-207090 GAAAACTTAGGCTCAGAGAGGGG + Intergenic
968705138 4:2074149-2074171 AGCAACTGCTGCTCAGAGAGGGG + Intronic
968809632 4:2793994-2794016 GCAAACTGAGGCACAGAGAGGGG - Intronic
968915415 4:3495107-3495129 GGAAACTGAGGCTCAGAGAGGGG - Intronic
969100831 4:4766918-4766940 GAAAACTGAGGCCCAGAGAGAGG + Intergenic
969109303 4:4831995-4832017 GGAAATTGAGGCTCAGAGACAGG - Intergenic
969128236 4:4970082-4970104 GGAAACTGAGGCTTAGAGAGGGG + Intergenic
969155230 4:5204310-5204332 GGAAACTGAGGCTCAGATAAGGG + Intronic
969167710 4:5331114-5331136 GCAAACTGAGGCTCAGAGAGAGG - Intronic
969329728 4:6467253-6467275 GGAAACTGAGGCTAAGAGGGGGG - Intronic
969354394 4:6616842-6616864 GGAAACCAAGGCTCAGAGAGGGG - Intronic
969422035 4:7103135-7103157 GGGCAGTGAGGCCCAGAGAGAGG + Intergenic
969497079 4:7532332-7532354 GGAAACTGGGGCACAGAGAGGGG - Intronic
969526606 4:7707011-7707033 AGAAACTGAGGCTCTGAGAGGGG + Intronic
969562905 4:7960712-7960734 GGAAACTGAGGCACAGAGAGAGG - Intergenic
969676676 4:8618236-8618258 GGAAACTGAGGCCCAGAGAGGGG + Intronic
969703431 4:8780027-8780049 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
971120787 4:23702372-23702394 TGGAAATGAAGCTCAGAAAGTGG - Intergenic
971151051 4:24031914-24031936 GGAAGCTGAAGCCCAGAGAGGGG + Intergenic
971321329 4:25608251-25608273 GGGAACCAAAGCTCAGAGAGAGG + Intergenic
972239599 4:37175812-37175834 GGGAACTCAAGCTGAGGGAGGGG - Intergenic
973867069 4:55125064-55125086 GGAAACTGAGGCTCAGAGACTGG - Intronic
974198471 4:58608414-58608436 GGAAACTGAAGCTCAGAGAGAGG + Intergenic
974232365 4:59133333-59133355 GTGACCTGAAGCTCTGAGAGAGG - Intergenic
974977379 4:68906978-68907000 GGGAACTTAAGCCCAGAGAAAGG - Intergenic
976848883 4:89522137-89522159 GAAAACTGAGACTCAGAGAGAGG - Intergenic
977202329 4:94131779-94131801 GGAAAATGAGGCACAGAGAGAGG + Intergenic
977666071 4:99649033-99649055 GGGGACTGAAGCCTAGAGAGAGG + Intronic
977934098 4:102780934-102780956 GGGAAGTGAGGCTGAGAAAGAGG - Intergenic
981097129 4:140793253-140793275 GGTAAATGAGGGTCAGAGAGTGG + Intergenic
983291492 4:165812700-165812722 GGGAACTGAAGTTCAGAGAGTGG + Intergenic
984808659 4:183774314-183774336 GGAAACTGAGGCTCAGAAAGGGG - Intergenic
985624456 5:977698-977720 GGGAAGTGGTGGTCAGAGAGGGG + Intergenic
985758450 5:1732896-1732918 AGGTACTGAGGGTCAGAGAGAGG + Intergenic
988838757 5:35062304-35062326 GGAAACTGAGGCTTAGAGGGGGG + Exonic
989748948 5:44867885-44867907 AGGAACTGAGGCTTAGAAAGAGG + Intergenic
991512696 5:67397405-67397427 GAGAATTGAGGCTCAGGGAGTGG - Intergenic
991948719 5:71927053-71927075 GGAAACTGAGGCTGAGAGGGAGG - Intergenic
993651561 5:90529222-90529244 GGAAACTGAGGCTCAGAGGAAGG - Intronic
994046741 5:95318637-95318659 GAAAACTGATGCTCAGAGAAAGG + Intergenic
994111885 5:96015584-96015606 GGAAATTGAAGCTCAGAGAAAGG + Intergenic
996820824 5:127625150-127625172 GGGCACTGACTCTCAGTAAGTGG + Intergenic
997409580 5:133680871-133680893 GGAAATTGGAGCTCAGAGAGGGG + Intergenic
997444366 5:133930597-133930619 GGGAACTGAGGCACAGATAGAGG - Intergenic
997468851 5:134105410-134105432 GGAAACTGCGGCTCAGAGAGCGG - Intergenic
997512255 5:134461753-134461775 AGAAACTAAGGCTCAGAGAGGGG - Intergenic
997724110 5:136105963-136105985 GGAAACTGGGGCACAGAGAGGGG - Intergenic
997739469 5:136241028-136241050 GGGAACTGCAGCTGAGGGAGAGG - Intronic
997885836 5:137629305-137629327 GGAAACTGAGGCCCAGAAAGGGG - Intronic
998006176 5:138658514-138658536 GGGAGTTGAGGCTCAGAGGGTGG + Intronic
998011743 5:138700772-138700794 GGGTGCTGACGCACAGTGAGAGG - Intronic
998129149 5:139642603-139642625 GTAAACTGAGGCTCTGAGAGGGG - Intergenic
998151489 5:139759936-139759958 GGAAACTGAGGCTCAGAGAAAGG + Intergenic
998374219 5:141680706-141680728 GGAAACTGAGGCCCAGAGAGGGG + Intronic
999128731 5:149266448-149266470 GGAAACTGAGGCTGAGAGAAGGG - Intergenic
999136516 5:149323734-149323756 GGAAACTCAGGCCCAGAGAGGGG - Intronic
999242233 5:150134569-150134591 GGAAACTCAGGCGCAGAGAGAGG - Intronic
999245155 5:150150297-150150319 GGGAACTAAGGTCCAGAGAGGGG - Intronic
999246972 5:150160238-150160260 GGACACTGAGGCCCAGAGAGTGG + Intergenic
999260081 5:150232880-150232902 GGAAACTGAGGCCCAGTGAGGGG + Intronic
999288530 5:150408390-150408412 GGGAACAGAGGCACAGAGATTGG - Intronic
999297088 5:150466413-150466435 GGAAACTGAGGCCCAGAGAGGGG - Intergenic
999304134 5:150508904-150508926 AGAAACTGAGGCTCAGAGAAGGG + Intronic
999317654 5:150594561-150594583 GGAAACTGAGGCCCAGGGAGAGG - Intergenic
999321709 5:150619283-150619305 GGAAACTGAGACTCAGAGTGAGG + Intronic
999327637 5:150652928-150652950 GGAAACTGAGGCCCAGAGATTGG - Exonic
999331483 5:150676592-150676614 GAAAACTGAGGCTCAGAGAGCGG + Intronic
999366981 5:151029666-151029688 GGAAACTGAGGCTCACAGAAGGG + Intergenic
999370351 5:151051497-151051519 GGAAACTGAGGCCCAGGGAGAGG - Intronic
999377550 5:151097332-151097354 GGTAACTGAGGCCCAGAGACAGG - Intergenic
999480556 5:151944262-151944284 GAGAACTGAGGCTTGGAGAGAGG - Intergenic
999626829 5:153529907-153529929 GGGTAATAAGGCTCAGAGAGGGG - Intronic
999640529 5:153668096-153668118 GGAAACTGAGGCCCAAAGAGGGG - Intronic
999640550 5:153668231-153668253 GGAAACTGAGGCCCAGAGATGGG - Intronic
999697206 5:154197824-154197846 GGGAACTGAAGCTCGAAGAGGGG + Intronic
999712541 5:154331460-154331482 GGGAACTAAAGCTCAGAAAGGGG - Intronic
999713857 5:154343316-154343338 GGAAACTGACACCCAGAGAGGGG + Intronic
999976128 5:156913816-156913838 GGAAACTGAGGCTCAGAAAGGGG - Intergenic
1000008969 5:157213905-157213927 GGAAACTGAGGCTCAGATAAGGG + Intronic
1000028782 5:157383444-157383466 GGAAACTGAGGCTCAGAGAAGGG + Intronic
1000300087 5:159948958-159948980 GGGAACTGAGTCCTAGAGAGAGG + Intronic
1000483928 5:161815123-161815145 GGAAACTGAAGTTCAGAGGGAGG + Intergenic
1001253755 5:170168128-170168150 AGAAACTGAAGCCCAGAGAGAGG - Intergenic
1001302105 5:170541127-170541149 GGAAACCAAGGCTCAGAGAGTGG - Intronic
1001305306 5:170568055-170568077 GGAAACTGAGCTTCAGAGAGAGG - Intronic
1001401086 5:171446748-171446770 GGAAACTGAGGCTCAGAGTGGGG + Intronic
1001427016 5:171629388-171629410 GTGAATGGAGGCTCAGAGAGAGG + Intergenic
1001435582 5:171696714-171696736 GAAAACTGAGGCTCAGAGAGAGG + Intergenic
1001539407 5:172526848-172526870 AGTAACTGAGGCTCAGAGAGAGG + Intergenic
1001556341 5:172640139-172640161 GGAAATTGAGGCTCTGAGAGTGG - Intergenic
1001562161 5:172676988-172677010 GGAAACTGAGGCCCAGAGAAAGG + Intronic
1001568672 5:172716401-172716423 GGGAACTGAGGCGCACAGGGTGG - Intergenic
1001594753 5:172891042-172891064 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1001654318 5:173337658-173337680 CGGAACTGGGACTCAGAGAGGGG + Intergenic
1001753235 5:174147339-174147361 GGAACCTGAGGCTCAGAGACCGG + Intronic
1001805726 5:174584317-174584339 AGAAACTGAGGCTCAGCGAGGGG - Intergenic
1001808912 5:174612052-174612074 GGGAACGGAGGCTCAGAGAAGGG - Intergenic
1001929642 5:175663875-175663897 GGCAGCTGAGGCTCAGAGAGGGG - Intronic
1001935557 5:175701150-175701172 GGAAACCGAGGCTCAGAGCGGGG + Intergenic
1002108685 5:176893420-176893442 GGTGACTGAGGCTCAGAGAGAGG - Intronic
1002304017 5:178272957-178272979 GGAAACTGAGGCCCAGTGAGGGG + Intronic
1002445544 5:179287957-179287979 GGGAACCGAGGCTTTGAGAGAGG - Intronic
1002576066 5:180174835-180174857 GGAAACCGAGGCTCAGAGAGAGG + Intronic
1002897211 6:1386367-1386389 GGAAACTAAGGCTCAGAGACTGG - Intergenic
1003164096 6:3661137-3661159 GGAAGCTGACGCTCAGAGTGAGG - Intergenic
1003443116 6:6161501-6161523 GGATACTGAAGTTCAGAGAGAGG + Intronic
1003559320 6:7167899-7167921 GAGAACTGAGGCTCAGAGTTCGG + Intronic
1004707858 6:18141189-18141211 GGGAACTGCTGCTCCAAGAGGGG + Intronic
1006314352 6:33281189-33281211 GGAAACTGAAGCTCAGGGAAAGG + Intronic
1006361028 6:33587162-33587184 GGAAACTGAGGCTCAGAAAGAGG - Intergenic
1006592513 6:35168901-35168923 GGAAACTGAGGCCCAGGGAGGGG + Intergenic
1006615957 6:35327075-35327097 GGAAACTGAGGCTCAGAGGTTGG - Intergenic
1006717044 6:36127317-36127339 GGACACTGAAGCTCAGAGAGAGG + Intergenic
1006807444 6:36797853-36797875 AGAAACTGAAGCCCAGAGAGGGG - Intronic
1007107968 6:39296293-39296315 GGAAACTGAGGCACAGAAAGGGG + Intergenic
1007215244 6:40232279-40232301 GAGAACTGAGGTTCAGAGAAGGG + Intergenic
1007238399 6:40407400-40407422 GGAAACAGAGGTTCAGAGAGAGG - Intronic
1007360348 6:41351184-41351206 AGAAACGGACGTTCAGAGAGGGG - Intergenic
1007371458 6:41428990-41429012 GCAAACTGAGGCCCAGAGAGGGG + Intergenic
1007511618 6:42378698-42378720 GGAAGCTGAGGCTGAGAGAGGGG + Intronic
1007632266 6:43279085-43279107 GGAAACTGAGGCACAGAGAGGGG - Intronic
1007695283 6:43728447-43728469 GGAAACTGAGGCACAGAGACGGG + Intergenic
1007737129 6:43988504-43988526 GGAAACTGAGGCACAGAGACTGG + Intergenic
1007828726 6:44621781-44621803 GGAAACTGAGTCCCAGAGAGGGG - Intergenic
1008412524 6:51196667-51196689 GCTAGCTGAAGCTCAGAGAGAGG - Intergenic
1008498406 6:52155879-52155901 GTGCATTGAGGCTCAGAGAGAGG - Intergenic
1008509410 6:52262307-52262329 GGAAACTGAGGCACAGAGTGGGG - Intergenic
1010083493 6:71888623-71888645 GGCAACTGACACTCAGATAGGGG + Intronic
1017758678 6:157551334-157551356 GTAAACTGAGGCTCAGAGACAGG + Intronic
1017890220 6:158631639-158631661 GGGAACTGGGGGTCAGGGAGAGG + Intronic
1018442176 6:163823485-163823507 GGAAACTGAGGCTTAGAGAGGGG + Intergenic
1018709331 6:166486498-166486520 GGGAACTGTCACCCAGACAGAGG - Intronic
1018846574 6:167561031-167561053 GGAAACTGAGGCACAGAGGGAGG - Intergenic
1018885474 6:167931939-167931961 GGAAACTGAGGCTTTGAGAGGGG - Intronic
1019267124 7:124191-124213 GGAGACTGAGGCTCAGAGATGGG - Intergenic
1019287699 7:231849-231871 GGAAACTGAGGCCCAAAGAGGGG - Intronic
1019336963 7:489919-489941 GGAAACTGTGGCTCAGAGAGGGG + Intergenic
1019441349 7:1049038-1049060 GGGAGCGCACGCTCAGACAGCGG - Intronic
1019493092 7:1324109-1324131 GGAGACTGAGGCTCAGAGGGGGG + Intergenic
1019498026 7:1349547-1349569 AGAAACTGAGGCTCAAAGAGGGG - Intergenic
1019510373 7:1414640-1414662 GGAAACTGAGGCTCTGAGAGGGG + Intergenic
1019533320 7:1514529-1514551 GGAAACTGAGGCTTAGAGAAGGG - Intergenic
1019557129 7:1638147-1638169 GGAAACTGAGGCCAAGAGAGAGG + Intergenic
1019730182 7:2625385-2625407 GGAAACTGAGGCTCCGAGAAGGG - Intergenic
1020130447 7:5556203-5556225 GGAAACTGAGGCCCAGAGAGAGG - Intronic
1021378600 7:19939073-19939095 GGGAACTCACTCTGAGAGACAGG - Intergenic
1021578927 7:22131889-22131911 AGCAACTGAAGCTCTGAGAGTGG + Intronic
1022488067 7:30795491-30795513 GGGTTCTGAGGCCCAGAGAGGGG + Intronic
1022527083 7:31045134-31045156 GGAAACTGAGGCCCAGAGAAGGG - Intergenic
1023333085 7:39140030-39140052 AAAAACTGAGGCTCAGAGAGTGG - Intronic
1025247378 7:57327591-57327613 GGAAACTGAGGCACAGAGAGAGG - Intergenic
1025249327 7:57341568-57341590 GAAAACTGAGGCTCAGAGAGGGG - Intergenic
1025249739 7:57343897-57343919 GGAAACTGAGGCTCGGGGAGTGG - Intergenic
1026652339 7:72226421-72226443 GGAAACTGAGGCCCAAAGAGGGG - Intronic
1026964659 7:74431428-74431450 GGGAACTGAGGCTCTGAGAGGGG + Intergenic
1026972198 7:74475377-74475399 GGGTACTGGGGCCCAGAGAGGGG + Intronic
1029450645 7:100640475-100640497 GGGGACTGAGGCTCTGAGGGTGG - Intronic
1029548319 7:101222914-101222936 GGAAACTGAGGCACAGAAAGGGG - Intronic
1029609069 7:101617021-101617043 GGAAACTGAAGCCCAGAGAGAGG + Intronic
1029881403 7:103814778-103814800 GGAAACTGAGGCCCAGAGAGGGG - Intronic
1031206398 7:118763934-118763956 AGGAACTCCAGCTCAGAGAGAGG + Intergenic
1033235949 7:139637867-139637889 AGAAGCTGAGGCTCAGAGAGGGG + Intronic
1033486352 7:141792734-141792756 AGAAACTGATGCCCAGAGAGGGG + Intergenic
1034122052 7:148636989-148637011 GGAAACTGAGTCCCAGAGAGGGG - Intergenic
1034278323 7:149834145-149834167 TGGAACTGAGGCTCAGATATGGG - Intergenic
1034441889 7:151089878-151089900 GGAAACTGAGGCTCAGAGAAGGG + Intronic
1034444896 7:151108816-151108838 GGGCATTGACACCCAGAGAGGGG - Intronic
1034547783 7:151800386-151800408 GGAAACTGACGACCAGAGATGGG - Intronic
1034566365 7:151918873-151918895 GGAAACTGAGGCTCAGAGGGTGG - Intergenic
1035020683 7:155798260-155798282 GTGAACAGACGCTCAGGGGGTGG + Intergenic
1035232949 7:157477295-157477317 GGGAACTGATGCTGAGCCAGTGG - Intergenic
1035626701 8:1076374-1076396 GGAAACTGAGGCTCGGAGACGGG - Intergenic
1035647824 8:1242207-1242229 GGGAACTGAGGGCCTGAGAGAGG + Intergenic
1035715297 8:1749505-1749527 GGAAACTGAGGCCCAGAGACAGG + Intergenic
1036606989 8:10316345-10316367 TGAAACTGACACTCAGAGAGAGG - Intronic
1037835161 8:22211308-22211330 GGGAAGTGAGGCCCAGAGATGGG + Intronic
1037945986 8:22989921-22989943 GGAAACTGGAGCTCTGAGAGGGG - Intronic
1038062785 8:23930902-23930924 GGAAACTGATACCCAGAGAGAGG + Intergenic
1038668881 8:29565204-29565226 GGAAATTGAGGCTCAGAGAGGGG + Intergenic
1039081232 8:33736103-33736125 GGAAACTGAGGCTTAGAGAGAGG + Intergenic
1039195748 8:35029539-35029561 TAGAACTGAAGTTCAGAGAGAGG + Intergenic
1039746202 8:40430415-40430437 GGAAACTGACTACCAGAGAGGGG + Intergenic
1039884834 8:41648908-41648930 GGAAACTGAGGCACAGAGAGAGG + Intronic
1041444383 8:57934035-57934057 GGAAACTGAAGCACAGAGAAGGG + Intergenic
1041782446 8:61592075-61592097 CGGAACTGAAGCTCACAGACTGG - Intronic
1042243413 8:66687492-66687514 GGAAACTGAGGCACAGAGAGGGG + Intronic
1042845773 8:73168302-73168324 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1043206196 8:77444923-77444945 GGGAACTGGAGCACAGAAAGAGG - Intergenic
1044625350 8:94231194-94231216 GGGAACTGAGGCAGAGAGAGGGG + Intergenic
1045034944 8:98169587-98169609 GTACACTGAGGCTCAGAGAGTGG - Intergenic
1045188685 8:99862746-99862768 GAGAACTGAAGATCAGAGAGAGG - Intronic
1046593698 8:116235939-116235961 GGAAACTGAAGCTCAGTGAGAGG - Intergenic
1046907460 8:119588982-119589004 AGAAATTGAGGCTCAGAGAGGGG - Intronic
1047191267 8:122681160-122681182 GGAAACCAAGGCTCAGAGAGGGG - Intergenic
1047204509 8:122792668-122792690 GGGAACTGAGGCACAGAGAAGGG + Intronic
1047504162 8:125465698-125465720 GGAAACTGATGCCCAGAAAGAGG - Intergenic
1047511645 8:125520423-125520445 GGTAACTGAGGCCCAGAGAGGGG + Intergenic
1047803323 8:128332486-128332508 AGAAGCTGAGGCTCAGAGAGAGG - Intergenic
1047900301 8:129413889-129413911 GGAAAATGAGGCTCAGAGAAAGG + Intergenic
1048138461 8:131769726-131769748 GGAAACTGAGGCCCAGAGGGAGG - Intergenic
1048257027 8:132912884-132912906 AGGAACTGAGGCCCAGAGAAGGG - Intronic
1048268171 8:133005609-133005631 GGAAACTGAGGCTCAGAGAAGGG + Intronic
1048310553 8:133319316-133319338 GTCAGCTGAGGCTCAGAGAGGGG - Intergenic
1048314338 8:133351007-133351029 GGAAACTGAGGCCCAGAGAAGGG + Intergenic
1048580335 8:135725234-135725256 GGGAACAGAGACGCAGAGAGGGG + Intergenic
1048889552 8:138935440-138935462 AGAATCTGAGGCTCAGAGAGGGG - Intergenic
1049195645 8:141314249-141314271 GGAAACTGAGGCTCAGGGAGGGG - Intergenic
1049195796 8:141315029-141315051 GGAAACTGAGGCACAGAGAGGGG + Intergenic
1049201872 8:141344245-141344267 GGAAACTGCGGCCCAGAGAGGGG + Intergenic
1049203008 8:141350981-141351003 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1049258792 8:141627832-141627854 GGAAATTGAGGCCCAGAGAGGGG - Intergenic
1049362799 8:142220258-142220280 GGAAACTGAGGCTCAGAGAGGGG + Intronic
1049419988 8:142512154-142512176 GGAGACTGAGGCCCAGAGAGAGG + Intronic
1049572794 8:143377554-143377576 GGAAACTGAGGCCCAGAGGGAGG + Intronic
1049814701 8:144592742-144592764 GGGAGCTGCTGCTCAGAGAAAGG + Intronic
1050279670 9:4037069-4037091 GAAAACTGGTGCTCAGAGAGTGG - Intronic
1051263604 9:15289495-15289517 GGAGACTGAAGCTCACAGAGAGG + Intronic
1051263841 9:15291918-15291940 GGAGACTGAAGCTCACAGAGAGG - Intronic
1052390701 9:27875973-27875995 GGAAACTGAGACTCAGACAGGGG - Intergenic
1052493337 9:29194062-29194084 GGAAGCTGCAGCTCAGAGAGGGG - Intergenic
1052835307 9:33245868-33245890 GGAAACTGAGACTCAGAGAGTGG + Intronic
1052851358 9:33380379-33380401 GGAAACTGAGGCCCAGAGAGTGG + Intergenic
1052855098 9:33402153-33402175 GGAAACTGAGGCCCAGAGAGAGG + Intronic
1053066761 9:35074563-35074585 GGAAACTGAGGCCTAGAGAGAGG + Intronic
1053279320 9:36807279-36807301 AGGAAGTGATGCTCAAAGAGAGG - Intergenic
1053305947 9:36985017-36985039 GGATACTGAGGCTCAGAGAGGGG + Intronic
1053306810 9:36990250-36990272 GGAAACTGAGGCTCAGAGATTGG + Intronic
1053382234 9:37658388-37658410 GGGATCTGAGTCCCAGAGAGGGG - Intronic
1055032349 9:71783367-71783389 GGGAGCTGACGCACGGAGGGTGG + Intronic
1055436020 9:76293039-76293061 GAAAACTGAAGCTCAGAGAGGGG + Intronic
1055728184 9:79254005-79254027 AGGGACTGTCACTCAGAGAGTGG + Intergenic
1055759816 9:79595281-79595303 GAGCAGTGACACTCAGAGAGTGG + Intronic
1055947335 9:81703423-81703445 GGAAACTGAGGCCCGGAGAGTGG - Intergenic
1056195465 9:84224420-84224442 GGGAACTGACGTACAGAAATTGG - Intergenic
1056223393 9:84471571-84471593 GGAAACTGATGCCCAGAGAAGGG + Intergenic
1056942028 9:90964268-90964290 GGAAACTGAGGCTCAGGAAGGGG + Intergenic
1056943501 9:90975036-90975058 GTGAACTGAGGCCCTGAGAGCGG + Intergenic
1057097886 9:92328467-92328489 GGAAACTGAAGCACAGAAAGGGG - Intronic
1057131885 9:92659847-92659869 GGGAACTGGAGCTCAGTCAGAGG - Intronic
1057145431 9:92755932-92755954 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1057182091 9:93035734-93035756 GGAAACTGAGGCCCAGAGAGGGG + Exonic
1057182507 9:93037689-93037711 GGAAGCTGAGGCTCAGACAGGGG + Intergenic
1057307591 9:93921188-93921210 GGAAACTGAGGTTCAGAGAGGGG - Intergenic
1057702674 9:97375175-97375197 GTAAACTGAGGCTCAGAAAGGGG + Intronic
1057722625 9:97545249-97545271 GGGAACTGAGGCACAGAGCAAGG - Intronic
1057747025 9:97760637-97760659 AGAAATTGAGGCTCAGAGAGGGG + Intergenic
1057748690 9:97772591-97772613 CAAAACTGAGGCTCAGAGAGGGG + Intergenic
1057752582 9:97804200-97804222 GGAAACTGAAGACCAGAGAGGGG - Intergenic
1057793142 9:98137357-98137379 GGGAACTAAGGCCCATAGAGAGG + Intronic
1057802595 9:98199234-98199256 GGAAACTGAGGGCCAGAGAGGGG + Exonic
1057891433 9:98872978-98873000 GGAAACTGAGGCTCAGATAAGGG - Intergenic
1057892556 9:98880383-98880405 GGAAACTGAGCCTCAAAGAGAGG - Intergenic
1057917589 9:99068879-99068901 GGCAGCTGAGGCTCAGAGAATGG - Intronic
1058420501 9:104828743-104828765 GGAAAGTGAGGCCCAGAGAGGGG - Intronic
1058680033 9:107432581-107432603 GAAAACTGAGGCCCAGAGAGGGG - Intergenic
1058683629 9:107462047-107462069 AGAAACTGAGGCTCTGAGAGGGG - Intergenic
1058759857 9:108120077-108120099 GAAAACTGAGGCCCAGAGAGAGG + Intergenic
1059326906 9:113509305-113509327 AGAAACTGAGGCTCAGCGAGGGG - Intronic
1059335147 9:113564476-113564498 AGAAACCGAGGCTCAGAGAGGGG + Intronic
1059338988 9:113586795-113586817 GGAAACTGTGGCTCACAGAGGGG - Intronic
1059353340 9:113681484-113681506 GGAAACTGAAGATCAGAGTGAGG + Intergenic
1059388556 9:113984433-113984455 GGAAACAGAGGCTCAGAGAAGGG + Intronic
1059391387 9:114001759-114001781 GGAAACTGAGGCCCAGAGATGGG + Intronic
1059422620 9:114201652-114201674 AGAAACTGAAGCTCAGAGAGGGG - Intronic
1059435202 9:114271815-114271837 GGAAACTGAGGTTCAGAGAAGGG - Intronic
1059436418 9:114279265-114279287 AGGAACTGAGGCTCAGTGAGAGG - Intronic
1059450772 9:114370372-114370394 GGGGCCTGAGGCTGAGAGAGGGG - Intronic
1059455218 9:114396299-114396321 GGAAACTGAGGCTCAAAGAAAGG - Intergenic
1059612309 9:115911790-115911812 GGAAACTGAAGCTCAGGGAGGGG - Intergenic
1059653538 9:116336776-116336798 GGAAACTGAGGCCCAGAGAAGGG - Intronic
1059695386 9:116725611-116725633 TGAAACTGAAGCTCAGAGAGAGG + Intronic
1059739231 9:117133464-117133486 GGACACTGAGGCCCAGAGAGTGG + Intronic
1059769607 9:117413916-117413938 CAGAACTGAGGCTCAGAGAAGGG + Intronic
1059770381 9:117418090-117418112 GGGAAATGAAGCTCAGTGAGGGG + Intergenic
1059964838 9:119603405-119603427 GGGAACTGAGGTCCAGAAAGAGG + Intergenic
1060011117 9:120043483-120043505 GGAACATGAGGCTCAGAGAGGGG - Intergenic
1060023371 9:120150973-120150995 GGGAACTGAGGCCCAGAGAAGGG + Intergenic
1060047106 9:120349771-120349793 GAGAACTGATGCTCTGAGAGTGG - Intergenic
1060153099 9:121301049-121301071 AGAAACTGAGGCTCAAAGAGGGG - Intronic
1060153387 9:121302606-121302628 GGAAACTGAGGCTCAGCAAGGGG - Intronic
1060217721 9:121748444-121748466 GGAAACTGAGGCTTAGAGACAGG - Intronic
1060262322 9:122087102-122087124 GGGAACTGAGGCTTAGAGAGGGG - Intronic
1060269756 9:122132101-122132123 GGAAACGGAGGCTCAGAGAGAGG - Intergenic
1060283135 9:122227265-122227287 GAAAACCGAGGCTCAGAGAGGGG + Intronic
1060294614 9:122334785-122334807 GGATACTGAAGCACAGAGAGGGG + Intergenic
1060437587 9:123607661-123607683 TGGACCTGAAGCTCAGAGAGAGG + Intronic
1060447965 9:123709272-123709294 GGGCACTGGTGCTCAGAGGGGGG - Intronic
1060508583 9:124216251-124216273 AGAAACTGAGGCTCAGGGAGCGG - Intergenic
1060519587 9:124286843-124286865 AGGAACTAAAGCTCAGAGAGGGG - Intronic
1060551352 9:124486904-124486926 GGAAACTGCAGCTCAGAGAGGGG - Intronic
1060551725 9:124488718-124488740 GGAAATAGAAGCTCAGAGAGGGG + Intronic
1060721617 9:125983382-125983404 GGAAGCTGAGGCTCCGAGAGAGG - Intergenic
1060722605 9:125988977-125988999 GGAAACTGAGGCTCAGAATGGGG + Intergenic
1060735628 9:126064970-126064992 GGAAACTGAGGCTTAGAGAGGGG + Intergenic
1060742476 9:126108604-126108626 GGGAACACACACACAGAGAGGGG - Intergenic
1060823897 9:126676682-126676704 GCAAACTGAGGCTCAGAGAGGGG - Intronic
1060892243 9:127196276-127196298 AGAAACTGAGGCTCAGAGAAAGG + Intronic
1060895648 9:127215512-127215534 GGGTCCTGAGGCTCAGAAAGGGG + Intronic
1060912886 9:127364587-127364609 AGAAACTGAGGCCCAGAGAGAGG + Intronic
1060939213 9:127534135-127534157 GGAAACCGAGGCTCAGAGAGGGG - Intronic
1060971464 9:127740557-127740579 GGGAACTAAGGCTCAGAGACAGG + Intronic
1060971596 9:127741593-127741615 GGAAACTGAGGCCCAGAGAAGGG + Intronic
1060976781 9:127769826-127769848 GGAGACTGAGACTCAGAGAGGGG - Intronic
1060992891 9:127858770-127858792 AGAAACTGAGGCTCAGAAAGTGG - Intergenic
1060999356 9:127894332-127894354 GAGAACTGAGGCCCAGACAGGGG + Intronic
1061006153 9:127929437-127929459 GGACACTGAGGCCCAGAGAGAGG + Intronic
1061010031 9:127949418-127949440 GGGAACCAAGACTCAGAGAGGGG + Intronic
1061022568 9:128025744-128025766 GGAAACTGAGGTTCAGAGAGGGG + Intergenic
1061049962 9:128189444-128189466 AGAAACTGAGGCCCAGAGAGGGG - Intronic
1061056161 9:128224114-128224136 GGACACTGAGGCCCAGAGAGGGG + Intronic
1061101833 9:128498066-128498088 AGAAACTGAGCCTCAGAGAGGGG - Intronic
1061150883 9:128827333-128827355 GGAGACTGAGGCCCAGAGAGGGG - Intronic
1061158338 9:128878907-128878929 GGAAACTGAGGCTTAGAGAGGGG + Intronic
1061179354 9:129014605-129014627 GGAAACTGAGGCCCAGAGATAGG + Intronic
1061211383 9:129195406-129195428 GGAAACTGAGGCCCAGAGAGGGG + Intergenic
1061231193 9:129316803-129316825 AGAAACTGAGGCCCAGAGAGGGG - Intergenic
1061320941 9:129829030-129829052 GGAAACTGAGGCTTAGAAAGGGG + Intronic
1061397705 9:130352616-130352638 GGAGACTGAGGCCCAGAGAGGGG + Intronic
1061399717 9:130361781-130361803 GGAAACTGAGGCTGACAGAGGGG - Intronic
1061407827 9:130402555-130402577 GGAAACTGAGGTCCAGAGAGTGG + Intronic
1061425236 9:130494354-130494376 GGAAACAGAGGCACAGAGAGGGG + Intronic
1061502537 9:131012322-131012344 GGAAACTGAGGCTGAGAGAGGGG - Intronic
1061544059 9:131293723-131293745 GGAAACTGAGGCTCAGAGACAGG - Intronic
1061899436 9:133665527-133665549 GGAAACTGAGGCTCCAAGAGAGG + Intronic
1061930747 9:133831898-133831920 GGAAACTGAGGTCCAGAGAGGGG - Intronic
1061932755 9:133841743-133841765 GGAAACTGAGGCTCAGAGACAGG - Intronic
1061946805 9:133913116-133913138 GGGAGCTGGCACTCTGAGAGGGG + Intronic
1062024618 9:134334629-134334651 GGAAACTGAAGCCCACAGAGGGG - Intronic
1062167135 9:135113506-135113528 GGGAACTGAGGCACAGAGAGGGG + Intronic
1062193598 9:135260291-135260313 GGAAACTGAGGCTTGGAGAGAGG + Intergenic
1062283764 9:135763883-135763905 GGAAGCTGAGGCTCAGAGTGGGG + Intronic
1062334823 9:136060510-136060532 TGGAGCTGACCCTCAGGGAGGGG - Intronic
1062395214 9:136350045-136350067 GGAAACTGAGGCCCAAAGAGAGG - Intronic
1062434014 9:136538416-136538438 GGAAACTGAGGCCCAGGGAGGGG + Intronic
1185595902 X:1306702-1306724 AGGAACAGAGGCACAGAGAGGGG + Intronic
1186891951 X:13967759-13967781 GGGAACTTACAGTCAGAGATTGG + Intergenic
1187991719 X:24881450-24881472 GGAAACTGAGGCTCAGAAAGAGG + Intronic
1189231631 X:39456396-39456418 GAAAACTGATGCTCATAGAGGGG - Intergenic
1190109257 X:47579406-47579428 GGAAACTGAGGCTCAGGGAGAGG - Intronic
1190435447 X:50420015-50420037 GGAAACTGAGACTCAGAAAGAGG - Intronic
1190458052 X:50644312-50644334 GGAAACAGAAGCCCAGAGAGTGG - Intronic
1190712491 X:53080838-53080860 GAAAACTGAAGCTCAGAGAGGGG + Intergenic
1190868372 X:54404138-54404160 GGAAACTGGTGCACAGAGAGGGG + Intergenic
1191706339 X:64098176-64098198 GGGAGCTGAAGCCCAGAGAGGGG + Intergenic
1191860839 X:65665756-65665778 GGAAACTCAAGCCCAGAGAGGGG + Intronic
1191885404 X:65882928-65882950 GGAAACTGAACCTCAGAGAAGGG + Intergenic
1191887482 X:65903635-65903657 GGAAACTGAGGCTTAGAGAGGGG + Intergenic
1191975645 X:66868204-66868226 GGAAACTCATGCTCAGAGAAGGG + Intergenic
1192043972 X:67652508-67652530 GGAAAGTGAGGCTCAGAGAGAGG + Intronic
1192142042 X:68654156-68654178 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1192149739 X:68704855-68704877 GGAAACTGAGGTTCAGACAGAGG + Intronic
1192184690 X:68939091-68939113 AGAAACTGAGGCTCAGAGAATGG - Intergenic
1192191649 X:68994767-68994789 AAGGACTGAGGCTCAGAGAGGGG + Intergenic
1192197370 X:69037645-69037667 GGAAACTGAGGCTCAGAGATGGG - Intergenic
1192204820 X:69088861-69088883 AGAAACTGAGGCTCAGAGAAGGG - Intergenic
1192206348 X:69099201-69099223 AGAAATTGAGGCTCAGAGAGGGG + Intergenic
1192211406 X:69130203-69130225 GGACACTGAGGCTCAGAAAGGGG - Intergenic
1192212964 X:69139426-69139448 AGAAACTGAGGCCCAGAGAGGGG + Intergenic
1192215044 X:69152226-69152248 GGAAACTGAGGCTCAGAAGGGGG - Intergenic
1192559124 X:72113890-72113912 GGAAACTGAGGGTCAGAAAGAGG - Intergenic
1193049675 X:77086732-77086754 AGGAGCTCACGCTCAGAGAAAGG - Intergenic
1193397791 X:81005726-81005748 GGAAACTGAAGCACAGAAAGAGG - Intergenic
1194671927 X:96744331-96744353 GGAAAGTGAAGCTTAGAGAGAGG + Intronic
1195118941 X:101729823-101729845 GGAAACTGAGGCTAAGAGAGAGG + Intergenic
1195367007 X:104136055-104136077 GGAAGCTGAGGCTCAGAGAAGGG - Intronic
1195431275 X:104792133-104792155 GGAAACTGAGGTTCAGAAAGAGG + Intronic
1195479011 X:105321274-105321296 GACAACTGAAGCTCAGAGAGGGG + Intronic
1195615822 X:106911149-106911171 GGAAATTGAGGCTCAGAGATTGG - Intronic
1195700249 X:107699917-107699939 GGAAACTGAGGCTGGGAGAGAGG - Intergenic
1196031722 X:111099793-111099815 GGAAACTGAGGCCTAGAGAGGGG - Intronic
1196679840 X:118459518-118459540 GGAAACTGAGGCACAGGGAGAGG - Intergenic
1196788899 X:119446424-119446446 GGAAACTGAGGCTCAGGGACAGG - Intronic
1196893644 X:120312275-120312297 GGAAACTGAATCTCAGAGAAGGG + Intergenic
1196899257 X:120367126-120367148 GGAAACTGAGGCTCAGAGAGGGG - Intronic
1196941696 X:120783196-120783218 GGAAACTGAGTCTCAGAGAGAGG + Intergenic
1197223664 X:123935982-123936004 GGAAACTGAGGCTCAAAAAGAGG - Intergenic
1197702459 X:129609635-129609657 GGAAACTGAGGTTCAGAGAGGGG - Intergenic
1197861631 X:130977543-130977565 CGGAACTGAGGCCCAGTGAGGGG - Intergenic
1198051996 X:132959096-132959118 GGAAACTGAGGCCCAGAGAGGGG + Intronic
1198110938 X:133502164-133502186 GGAAATTGAGGCCCAGAGAGGGG - Intergenic
1198133462 X:133723290-133723312 GGGAACTGAGGCCCAGAAAAGGG + Intronic
1198220694 X:134599037-134599059 GGAAACTAAAGCCCAGAGAGGGG - Intronic
1198223466 X:134624045-134624067 GGAAACTGAGGCTGAGAAAGTGG + Intronic
1198277150 X:135105853-135105875 GGAAACTGAGGCTCTGAGATAGG + Intergenic
1198519675 X:137440165-137440187 AGAAACTGAAACTCAGAGAGGGG - Intergenic
1198892486 X:141413778-141413800 GAGAACTGAGGATCAGAGGGAGG + Intergenic
1199540496 X:148953059-148953081 GGAAACTGAGGTTCAGAAAGGGG - Intronic
1199673854 X:150168103-150168125 GACAACTGACACACAGAGAGAGG + Intergenic
1199691834 X:150314360-150314382 GGAAACTGAGGATCAGAGAAGGG - Intergenic
1199740699 X:150733665-150733687 GGAACCTGAGGCACAGAGAGAGG - Intronic
1199823760 X:151477108-151477130 GAATACTGAGGCTCAGAGAGGGG - Intergenic
1200056241 X:153462839-153462861 GGAAGCTGATGCCCAGAGAGGGG - Intronic
1201291102 Y:12421315-12421337 GGGAGCTGGAGGTCAGAGAGAGG - Intergenic