ID: 903189010

View in Genome Browser
Species Human (GRCh38)
Location 1:21646035-21646057
Sequence GAGGGAACTGACGCTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8723
Summary {0: 1, 1: 16, 2: 459, 3: 2225, 4: 6022}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189010_903189013 -8 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189013 1:21646050-21646072 GTTCCCTCATCTGTAAAATGGGG 0: 23
1: 594
2: 2828
3: 6721
4: 11858
903189010_903189012 -9 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189012 1:21646049-21646071 AGTTCCCTCATCTGTAAAATGGG 0: 30
1: 766
2: 3523
3: 8849
4: 15187
903189010_903189017 8 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189017 1:21646066-21646088 AATGGGGATGGACAGTAGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 172
903189010_903189018 9 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189018 1:21646067-21646089 ATGGGGATGGACAGTAGTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 290
903189010_903189011 -10 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189011 1:21646048-21646070 CAGTTCCCTCATCTGTAAAATGG 0: 37
1: 931
2: 4071
3: 9755
4: 16832
903189010_903189016 -4 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189010_903189019 29 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189019 1:21646087-21646109 GGGACAAACAGTCATCTGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189010 Original CRISPR GAGGGAACTGACGCTCAGAG AGG (reversed) Intronic
Too many off-targets to display for this crispr