ID: 903189016

View in Genome Browser
Species Human (GRCh38)
Location 1:21646054-21646076
Sequence CCTCATCTGTAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903189010_903189016 -4 Left 903189010 1:21646035-21646057 CCTCTCTGAGCGTCAGTTCCCTC 0: 1
1: 16
2: 459
3: 2225
4: 6022
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189004_903189016 14 Left 903189004 1:21646017-21646039 CCCTGGGCCACCACTTCCCCTCT 0: 1
1: 0
2: 3
3: 52
4: 438
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189009_903189016 -3 Left 903189009 1:21646034-21646056 CCCTCTCTGAGCGTCAGTTCCCT 0: 1
1: 5
2: 129
3: 689
4: 1914
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189003_903189016 15 Left 903189003 1:21646016-21646038 CCCCTGGGCCACCACTTCCCCTC 0: 1
1: 0
2: 2
3: 43
4: 512
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189008_903189016 -2 Left 903189008 1:21646033-21646055 CCCCTCTCTGAGCGTCAGTTCCC 0: 1
1: 3
2: 69
3: 406
4: 1128
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189006_903189016 7 Left 903189006 1:21646024-21646046 CCACCACTTCCCCTCTCTGAGCG 0: 1
1: 0
2: 3
3: 34
4: 329
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189005_903189016 13 Left 903189005 1:21646018-21646040 CCTGGGCCACCACTTCCCCTCTC 0: 1
1: 0
2: 5
3: 52
4: 525
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556
903189007_903189016 4 Left 903189007 1:21646027-21646049 CCACTTCCCCTCTCTGAGCGTCA 0: 1
1: 8
2: 50
3: 242
4: 778
Right 903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG 0: 15
1: 99
2: 349
3: 811
4: 1556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903189016 Original CRISPR CCTCATCTGTAAAATGGGGA TGG Intronic
Too many off-targets to display for this crispr