ID: 903192518

View in Genome Browser
Species Human (GRCh38)
Location 1:21664621-21664643
Sequence CAGGCAAGGACTCCTCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903192518 Original CRISPR CAGGCAAGGACTCCTCAAGG AGG Intronic
900013782 1:135861-135883 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
900065289 1:726847-726869 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
900522281 1:3111478-3111500 CAGGCAAGGAGGCCTCGAAGAGG + Intronic
900982621 1:6055060-6055082 CAGGAAAGGACACCTCATGAGGG + Intronic
901296627 1:8165844-8165866 CAGGCAACTTCTCCACAAGGTGG - Intergenic
903131148 1:21280246-21280268 CAGGAAGGGTCTCCTGAAGGTGG + Intronic
903192518 1:21664621-21664643 CAGGCAAGGACTCCTCAAGGAGG + Intronic
903730855 1:25494284-25494306 CAGGGAAGGCCTCGTGAAGGAGG + Intronic
904356207 1:29941693-29941715 CAGGGAAGGCTTCCTGAAGGAGG - Intergenic
905399818 1:37692936-37692958 CAGGCAGAACCTCCTCAAGGAGG + Exonic
907317467 1:53581645-53581667 CAGGGAAGGCCTCCTGGAGGAGG + Intronic
908841295 1:68282490-68282512 AAGGCAATGACTGCTAAAGGGGG + Intergenic
911520068 1:98919106-98919128 AAGGAAAGGAATCCTCAAGGAGG + Intronic
912950781 1:114118817-114118839 GAGGCAACGCTTCCTCAAGGGGG + Intronic
915286915 1:154859016-154859038 CAGGGGAGGCCTCCTCAGGGGGG - Intronic
915531769 1:156506499-156506521 CAGGGAAAGCCTCCTAAAGGAGG - Intergenic
919819225 1:201462403-201462425 GAGGCAAAGACTCCCCAAAGAGG + Intergenic
921069607 1:211648251-211648273 CAGACAGGGATTCCTCCAGGTGG + Intergenic
922798238 1:228352028-228352050 GGGGCAAGGGCTCCTCAGGGTGG + Intronic
923336133 1:232971781-232971803 CAGGGAAGGTCTCTTCAAGGAGG + Intronic
924200925 1:241657643-241657665 CAGGGAAGGCCTCTTTAAGGAGG - Intronic
1063048019 10:2414031-2414053 CAGGCAATGACTGTTCAAGAAGG + Intergenic
1065124329 10:22559720-22559742 CAGGCCAGGACTTCTCCAAGTGG + Intronic
1065546217 10:26823847-26823869 AAGGCAAGAACTCCTCAAAGAGG + Intronic
1065807477 10:29408318-29408340 CAGGGAAGGCCTCCTTAAGAAGG + Intergenic
1067712567 10:48661732-48661754 CAGGCAAGGACCTCTCAGGGAGG - Intergenic
1069675196 10:70241352-70241374 CAGGCAAACTCTCCTCATGGTGG - Intergenic
1069706797 10:70463776-70463798 CAGGAAAGGCCTCTCCAAGGAGG + Intergenic
1069773002 10:70911234-70911256 CAGGCAAAGACTCCCCCCGGAGG - Intergenic
1071836169 10:89419737-89419759 CAAGCAGCGACCCCTCAAGGTGG - Exonic
1073452416 10:103617684-103617706 CATGCAAGGACACCTCATGAGGG - Intronic
1075069152 10:119309157-119309179 CAGGGAAGGCTTCCTGAAGGAGG - Intronic
1075265546 10:120997414-120997436 CAGGGAAGGTTTCCTGAAGGAGG + Intergenic
1076369374 10:129941716-129941738 GAGGCAGGAACCCCTCAAGGAGG + Intronic
1076970126 11:128075-128097 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
1077244528 11:1529774-1529796 CAGCCAGGGCCTCCTGAAGGAGG + Intergenic
1078342085 11:10504854-10504876 CAGGGAAGGCCTCTCCAAGGAGG - Intronic
1078465217 11:11545352-11545374 CAGGCAAGGACTCAGGAAAGAGG + Intronic
1078572326 11:12469904-12469926 GAAGCCAGGACTCCTAAAGGTGG - Intronic
1080685322 11:34510615-34510637 TAGGCCAGGCCTGCTCAAGGGGG + Intronic
1080689257 11:34542300-34542322 CAGGGAAGGCTTCCTGAAGGAGG - Intergenic
1081203108 11:40242053-40242075 CAGGCAAGGAGCCTTCCAGGAGG - Intronic
1083143349 11:60739534-60739556 CCGGCAAGGACCCCTGGAGGTGG + Intronic
1083318195 11:61828909-61828931 GAGGCAGGGACTCCCCAAGAGGG + Intronic
1083369770 11:62169259-62169281 CAGCCAAGGACTCAGCAACGAGG - Intergenic
1085201658 11:74705758-74705780 CAGGCAAGGCCTTCTCAGGTGGG - Intronic
1088777353 11:113098663-113098685 CAGATAAGGACTCCTTGAGGAGG + Intronic
1089314688 11:117583499-117583521 CAGGGAAGGCATCCCCAAGGAGG - Intronic
1089769361 11:120792125-120792147 CAGGGAAGGCTTCCTGAAGGAGG + Intronic
1089964946 11:122648051-122648073 CAGGCAAGGCCTCTTAAAGGAGG + Intergenic
1093696537 12:22166846-22166868 CAGGTTAGGACTCTTCAAGGAGG + Intronic
1096199434 12:49671226-49671248 TAGGCCAGGACTCCCCAAGGGGG - Intronic
1096501111 12:52064262-52064284 CAGGCCAGGGCTCCTGATGGTGG - Intergenic
1096876191 12:54632260-54632282 CAGCCAAGGTCACCTCAAGCAGG - Exonic
1100022120 12:90082070-90082092 CAGACAAGTAATTCTCAAGGGGG - Intergenic
1101001498 12:100362230-100362252 CAGGCAAGGAGTCACCATGGTGG + Intronic
1102037834 12:109782398-109782420 CAGGCAGGCAGTCCTCAAGGAGG + Intergenic
1102442612 12:112975127-112975149 CAGGCAAGGACTCCAGGAGAAGG + Intergenic
1103342321 12:120227688-120227710 CAGGCAAGGACTAGGCAAGAGGG + Intronic
1104072328 12:125356628-125356650 GAGGCAGGGAGACCTCAAGGGGG - Intronic
1104450999 12:128868093-128868115 GAGGCAGGGCCTCCTCAGGGTGG + Intronic
1107733062 13:43367769-43367791 CAGGGAAGGAATCCTGGAGGGGG + Intronic
1109639782 13:65175298-65175320 CTGGCTAGGACTCCCAAAGGGGG - Intergenic
1111174144 13:84571407-84571429 CAGGCACGTTCTCCTCAAGGTGG + Intergenic
1111699192 13:91664348-91664370 CAAGCAGGGACTCCTCACAGAGG - Intronic
1111898705 13:94173641-94173663 CAAGCTAGCACACCTCAAGGTGG + Intronic
1111980938 13:95014417-95014439 CATGCAATGACTAATCAAGGTGG + Intergenic
1112315713 13:98360503-98360525 CAGGCAAGGATGCATCGAGGTGG + Intronic
1114982409 14:28181385-28181407 CAGGAAAGAACTCCTCGAGGGGG + Intergenic
1115395914 14:32908130-32908152 CATGAAAGGACTCCTCCAGGAGG - Intergenic
1115722406 14:36177513-36177535 CCAGTAAGGACTCCTCGAGGGGG - Intergenic
1115853228 14:37603660-37603682 CAGGCAAAGCCTCCTCAGCGAGG + Intronic
1117477306 14:56109359-56109381 CAGGAAAAGACTCTTAAAGGAGG - Intergenic
1118599523 14:67462100-67462122 CAGGCGAGGTCTCCTGGAGGTGG + Intronic
1119394485 14:74316194-74316216 CAGGGAAGGACTCTCCGAGGAGG + Intronic
1121537925 14:94703933-94703955 CAGGGAAGGCCTCTCCAAGGAGG + Intergenic
1121943380 14:98094547-98094569 CAAGCAAGAACTCATCAAGACGG + Intergenic
1122439763 14:101722593-101722615 CATTCAACGACTCCTCAATGTGG - Intergenic
1122859013 14:104573950-104573972 CAGGCACTGACTGCCCAAGGTGG + Intronic
1123929807 15:25160505-25160527 TAGGGAAGACCTCCTCAAGGAGG - Intergenic
1125363390 15:38888449-38888471 CAGGGAAGGATTTCTCAAGTAGG - Intergenic
1127905727 15:63374355-63374377 CAGGGAAGGCCTCCTGGAGGAGG - Intronic
1128930709 15:71702775-71702797 CAGGAAAGGCCTCTCCAAGGAGG - Intronic
1129424922 15:75455797-75455819 CAGGCGAGGAGTCCTGAATGGGG + Intronic
1130160388 15:81393145-81393167 CAGGGAAGCTCTCCTCCAGGTGG - Intergenic
1132493753 16:249727-249749 CAGGAAAGCACTACTCAAGGAGG - Intronic
1132903774 16:2271925-2271947 GGGGCAAGGCCTCCTCCAGGAGG - Intergenic
1133045927 16:3088275-3088297 CAGGAAAGGACATTTCAAGGAGG - Intergenic
1134846362 16:17444160-17444182 CAGGGAAGGCCTCCTTGAGGAGG - Intronic
1137720832 16:50626445-50626467 CAGGGGAGGCCTCCTGAAGGAGG + Intronic
1137744802 16:50812725-50812747 AATGCAAGGACTCCTGGAGGGGG - Intergenic
1138507294 16:57484737-57484759 CAGGGAAGGCCTCCTGGAGGAGG - Intronic
1139083506 16:63556114-63556136 CAGGCAAGGCATCCTGAAGGAGG + Intergenic
1140886336 16:79247107-79247129 CAGGGAAGGCCTCCCCGAGGTGG + Intergenic
1141626763 16:85265579-85265601 CAGGGAAGGCTTCCTGAAGGAGG - Intergenic
1142450551 16:90171057-90171079 GAGGCCAGGCCTCCTCAAGTTGG + Intergenic
1142457010 17:62634-62656 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
1144842145 17:18193716-18193738 CTGGGAAGGACCCCTCAAGATGG - Intronic
1147662349 17:42123419-42123441 CAGGAAAGGCACCCTCAAGGTGG + Intronic
1148345106 17:46897941-46897963 CAGGTGAGGACTGCTCAAGGAGG + Intergenic
1151847519 17:76667627-76667649 CTCTCAAGGACTCCTCAGGGTGG + Intergenic
1153877286 18:9385301-9385323 CAGGCAAGGCCTCCTCATTCAGG + Intronic
1154498370 18:14979142-14979164 CAGGCAAGCAGCCCACAAGGGGG + Intergenic
1156019287 18:32581011-32581033 CAGGCACGGTCTCCCCAGGGTGG - Intergenic
1157427028 18:47592916-47592938 CAGGGAAGGCTTCCTGAAGGAGG + Intergenic
1157733514 18:50025426-50025448 CAGCCCGGAACTCCTCAAGGAGG + Intronic
1160216519 18:76937341-76937363 CAGGCAAGTGCTCCTCAGAGAGG + Exonic
1160646924 19:197993-198015 GAGGCCAGGCCTCCTCAAGTTGG - Intergenic
1161442323 19:4299113-4299135 CAGGGAAGGCCTCCTTGAGGTGG + Intronic
1161502336 19:4623270-4623292 CAGGCAAGGCTTCCGGAAGGAGG - Intergenic
1162079969 19:8211979-8212001 CAGGGAAGGCCTCCTGGAGGAGG + Intronic
1162250099 19:9435397-9435419 CAGGCAAGGTCTCTCTAAGGAGG + Intronic
1163684191 19:18701324-18701346 CATGTGACGACTCCTCAAGGGGG - Intronic
1164637044 19:29799263-29799285 CAGGAAAGGCCTCCTCCAGGAGG + Intergenic
1164887324 19:31792361-31792383 CAGGCAAAGATTTCTCAGGGGGG + Intergenic
1166353005 19:42209472-42209494 CAGGAAAGGCTTCCTGAAGGAGG + Intronic
1167029333 19:46946926-46946948 CAGGCAATGATACCCCAAGGTGG - Intronic
1167381669 19:49142031-49142053 CAGGCATGAACTCCTGGAGGAGG + Exonic
925300587 2:2808887-2808909 AAGGCAAGGACACCTCTAGAGGG + Intergenic
926094396 2:10071756-10071778 CAGACAGGGGCTCCTCCAGGGGG + Intronic
927467253 2:23346837-23346859 CAGGGAAGGACTCCCCAAAGAGG + Intergenic
927480156 2:23447338-23447360 CAGTCAAGGCCTCCTCGAGGTGG - Intronic
927964176 2:27258888-27258910 CAGGTTTGGACTCCTCAGGGAGG + Exonic
929711631 2:44272396-44272418 CAGACACGGCCTCCTCAAGCTGG - Intergenic
929895665 2:45958589-45958611 GAGGCCAGGACATCTCAAGGGGG - Intronic
930209056 2:48615742-48615764 CAGGCAATGACTACTAGAGGAGG - Intronic
931628060 2:64274849-64274871 TACTCAAGGACTCCTGAAGGAGG + Intergenic
933770864 2:85743107-85743129 CAGGGAAGGCTTCCTGAAGGAGG + Intergenic
934853709 2:97716529-97716551 CAGGGAAGGCCTCCTGGAGGAGG + Intronic
935097289 2:99957837-99957859 CAGGCCAGGACTTCTAAAGCAGG + Intronic
935134864 2:100291298-100291320 CAGGGCATGACTCATCAAGGAGG - Intronic
936048258 2:109203172-109203194 CGGGCAAGGCATCCTCAATGAGG - Intronic
936403520 2:112183569-112183591 CAGGTCAGGACTCCTCAGGCTGG + Intronic
937287957 2:120765091-120765113 CAGGGAAAGCCTCCTGAAGGGGG - Intronic
940361263 2:152798725-152798747 CAGGGAAGGCTTCCTGAAGGAGG + Intergenic
943332189 2:186572932-186572954 CATGTATGGACTCCTTAAGGTGG + Intergenic
945697747 2:213129333-213129355 CAGGCAAAGCCTCGCCAAGGAGG + Intronic
946015283 2:216599330-216599352 CAAGGAAGGCCTCCCCAAGGAGG - Intergenic
946127257 2:217573900-217573922 CAATCAAGGACTGCTGAAGGAGG - Intronic
947458989 2:230286176-230286198 CAGGAAAGAACTCATCTAGGAGG - Intronic
947479190 2:230481927-230481949 CAGGCAAGGCCTCTCCATGGAGG - Intronic
947546235 2:231012190-231012212 CAGGCTCAGACTCCTCCAGGAGG + Intronic
948054982 2:235004269-235004291 CAGGCAATGACACCTTAAGAAGG - Intronic
948316862 2:237034361-237034383 CAGTCAAGTACTCTTCATGGGGG + Intergenic
948569180 2:238906791-238906813 CAGGCATGGGCTCCCCAAGGCGG - Intronic
1169870272 20:10241604-10241626 CAGGGAAGGTCTCTCCAAGGAGG + Intronic
1171987124 20:31668224-31668246 CAGGGAAGGCCTCCCCTAGGAGG - Intronic
1172185827 20:33030554-33030576 CAGGGACGGACTCCTTATGGAGG - Intergenic
1172645369 20:36465817-36465839 CAGGCAACAACTTCTCAAAGTGG - Intronic
1173010623 20:39178441-39178463 CAGGCAAGGATTCCCCAAGGAGG + Intergenic
1174516337 20:51095274-51095296 CATACAAGGATTCCTCAAGCTGG - Intergenic
1174946528 20:54992427-54992449 CAGGCAATGCCTCTTCAAAGTGG - Intergenic
1174961434 20:55161529-55161551 CAGGAAAGTATTCCTAAAGGCGG - Intergenic
1179097822 21:38331300-38331322 CAGGCAAAGACTTGTCATGGAGG - Intergenic
1179715125 21:43282428-43282450 CAGGCAAGGACGCCTGCAGGAGG + Intergenic
1180869904 22:19140169-19140191 CTGCCAAGGACTCCCCACGGGGG + Intronic
1181468841 22:23125782-23125804 CAGGCAAGGACTCCAGCAGGAGG - Intronic
1181492150 22:23267296-23267318 GATGCAAGGACTCCTCCAGGTGG + Intronic
1181947350 22:26528576-26528598 CAGGAAAGGACTCTACAAGATGG + Intronic
1183330138 22:37215015-37215037 CAGATAAGGAATCCTGAAGGAGG - Intergenic
1183531056 22:38353550-38353572 CAGGGCTGGACTCCTCCAGGTGG - Intronic
1183849134 22:40569411-40569433 AAGGCAATGACTGCTAAAGGAGG + Intronic
1184434109 22:44459614-44459636 CAGGGAAGGCTTCCTAAAGGAGG - Intergenic
1184727257 22:46354353-46354375 CTGGCAAGGTCCCCTGAAGGTGG - Intronic
1185281588 22:49972151-49972173 CAGGCCAGGGCTCCTCCACGCGG - Intergenic
949823420 3:8139428-8139450 CAAGCAAGGACTTTTAAAGGTGG + Intergenic
949893863 3:8754533-8754555 CAGGGAAGGACTCTTCACTGGGG + Intronic
950727602 3:14927210-14927232 CAGGCAAAGGCCCCTCAGGGTGG - Intronic
951829878 3:26914772-26914794 AAGGCAAGAACTCATCAACGGGG + Intergenic
955791315 3:62591373-62591395 CAGGAAAGGACTCTCCAAGGAGG + Intronic
957607677 3:82423703-82423725 CATGCAAAGCCTCCTGAAGGGGG - Intergenic
958595480 3:96216800-96216822 TAGGCAAAGACACCTCAGGGTGG + Intergenic
960635246 3:119778765-119778787 CAGGGAAGGTCCTCTCAAGGTGG + Intergenic
961746103 3:129064346-129064368 CAGGCAGGGATTTCCCAAGGTGG + Intergenic
962349320 3:134645028-134645050 CGGGAAGGGAATCCTCAAGGAGG + Intronic
962479169 3:135783515-135783537 CAGGCAAGGTCTCCTCCAGCTGG + Intergenic
962749674 3:138424629-138424651 CAGGCAACACCTCCTCAAGTTGG - Intergenic
963047820 3:141116246-141116268 CTGACATGGACTCCACAAGGGGG - Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
965104248 3:164338592-164338614 AGGGAAAGGCCTCCTCAAGGAGG + Intergenic
966656409 3:182363490-182363512 CAGGGAAGGTTTCCTGAAGGAGG + Intergenic
967877001 3:194274217-194274239 CAGGAAAGGCCTCCTGGAGGAGG - Intergenic
969232763 4:5843073-5843095 GAGGTAAGGACTCCTCAACTTGG - Exonic
969531309 4:7732644-7732666 CAGGGAAGGCCTCCTGGAGGCGG - Intronic
973797466 4:54442805-54442827 AGGGCATGGACTCCTCAGGGAGG + Intergenic
979046512 4:115873188-115873210 CAGGCAAGAACCACTCAAGCAGG + Intergenic
979374541 4:119930573-119930595 CATGCAAGGGATCCTCAAGAAGG - Intergenic
982417302 4:155150761-155150783 AAGGCATGGACACATCAAGGTGG + Intergenic
983939156 4:173523260-173523282 CAGGCAGGGAGAACTCAAGGCGG + Intergenic
987114393 5:14714484-14714506 CAGGCAAGGGCTCTTGGAGGAGG + Intronic
987174124 5:15289522-15289544 CAGGGAAGGCTTCCTGAAGGAGG - Intergenic
988117636 5:26918291-26918313 CAGGAAAGGCCTCCCTAAGGAGG - Intronic
993004197 5:82413000-82413022 CAGACAAGGCCTCCCTAAGGAGG - Intergenic
994498345 5:100541910-100541932 TAGGCAAGAAATACTCAAGGAGG - Intronic
994696606 5:103079758-103079780 CAGGCAAGTCCTGCCCAAGGAGG + Intergenic
995623857 5:114056038-114056060 CAGCCAAGGACTCAAGAAGGAGG + Intergenic
995950314 5:117704676-117704698 CAAGGAAGGACTCTTTAAGGAGG + Intergenic
997804948 5:136907580-136907602 CAGGCAAGGAGTGAGCAAGGAGG - Intergenic
997986385 5:138504643-138504665 CAGGGAAGGACTCCTGGAGATGG + Intergenic
999273111 5:150309517-150309539 CAGGCAAGGGAGCCTCAAGGAGG - Intronic
999481134 5:151949171-151949193 CAGGCAAGACTTCCTGAAGGAGG + Intergenic
1000418518 5:161010323-161010345 CAGAGAAGGACTCTCCAAGGAGG - Intergenic
1001901736 5:175436597-175436619 CAGGAAAGGACTCCACAAACTGG + Intergenic
1002339188 5:178503852-178503874 CAGGTAAGGATTCCCCAAGGCGG + Intronic
1002616952 5:180461849-180461871 GAGGCTAGGTCTCCTCAAGGAGG + Intergenic
1003332729 6:5143171-5143193 CAGGCTTGGCCTCCTCAATGTGG - Intronic
1004190661 6:13460941-13460963 CAGGTGAGGACACCTCAAGAAGG + Intronic
1006877205 6:37308120-37308142 AAGGCAAGGCATCCACAAGGAGG - Intronic
1007836885 6:44680907-44680929 CAGGGAAGGCTTCCTGAAGGAGG - Intergenic
1012073068 6:94647765-94647787 CAGGCAAAAAATCCTCAAGATGG - Intergenic
1013813938 6:114075342-114075364 GAGGCAAGGACTCTTCAAGGTGG - Intronic
1014753283 6:125276468-125276490 CAGGCAAGGAATCATCAATTAGG + Intronic
1015461377 6:133495514-133495536 CAGGCAAGGACTCTTCATTATGG + Intronic
1019058151 6:169237380-169237402 CAGGCAAATACCCCTCTAGGCGG - Intronic
1020241914 7:6401744-6401766 CAGGCAAGGCCTCCCCACGGAGG - Intronic
1021201915 7:17736663-17736685 CTTGCAAGAACTCCTGAAGGAGG + Intergenic
1023840813 7:44096541-44096563 CAGGCACAGACTGCACAAGGAGG - Intergenic
1024484602 7:49903911-49903933 CAGACATTGCCTCCTCAAGGCGG - Intronic
1025847056 7:65209412-65209434 GAAGCAAGGACTCCTGAAGAAGG + Intergenic
1025897299 7:65715307-65715329 GAAGCAAGGACTCCTGAAGAAGG + Intergenic
1032406647 7:131660745-131660767 CAGTGAAGGACTGCTGAAGGGGG + Intergenic
1032427634 7:131834336-131834358 CACGCAGGGGCTCCTCAAGATGG - Intergenic
1032447768 7:131999363-131999385 CAGGGAAGGCCTCCTGGAGGTGG + Intergenic
1032975542 7:137218482-137218504 CAGGCAAGGCCTCCTGAAGCAGG - Intergenic
1034433490 7:151052246-151052268 CAGGCAAGGGCTCCAGAAGAGGG - Intronic
1036435795 8:8732053-8732075 CAGACATGGACTCTTCAATGAGG + Intergenic
1036454834 8:8897562-8897584 CAGGCAAGGACTCCTGCCGTGGG + Intergenic
1037829915 8:22181362-22181384 CAGGGAAGGCTTCCTGAAGGAGG - Intronic
1039658393 8:39435032-39435054 CTTGCAAGAACTCCTGAAGGAGG + Intergenic
1040563003 8:48541140-48541162 CGGGGAAGGCCTCCCCAAGGTGG - Intergenic
1041400241 8:57435258-57435280 CAGGCAAGGGTTCATCAAGAAGG - Intergenic
1042524093 8:69746618-69746640 TAGGAAAGGCCTCCTCAAGGGGG + Intronic
1045288397 8:100811450-100811472 CAGGTAAGGAGTCCTCAGGGTGG + Intergenic
1045393084 8:101734301-101734323 CAGAGAAGGCCTCCCCAAGGAGG - Intronic
1047442561 8:124891243-124891265 CAGGCGAGAACACCTCAAGCTGG - Intergenic
1047651697 8:126929863-126929885 AAGGCACGTAATCCTCAAGGAGG + Intergenic
1047779465 8:128099488-128099510 CAGGCAAGGCTTCCAGAAGGAGG - Intergenic
1048016426 8:130501443-130501465 CAGGCAAGGTTTCTTAAAGGAGG + Intergenic
1048648986 8:136453643-136453665 TAGGAAAGAACTCCTCAATGAGG + Intergenic
1049555226 8:143278242-143278264 CCAGCAAGGACGCCTCAAGTAGG - Intergenic
1049648621 8:143751797-143751819 CCTGCAAGGAATGCTCAAGGAGG - Intergenic
1049795965 8:144497371-144497393 CAGCCAAGGGCTCCTGAAGCAGG + Exonic
1052381149 9:27772368-27772390 CAGGCAAGAACTCCTGAAGTGGG + Intergenic
1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG + Intronic
1053470892 9:38345614-38345636 CAGGGAAGGAACCCTCAAGGAGG - Intergenic
1057547824 9:96031331-96031353 CAGGGAAGGTCTCCCTAAGGAGG + Intergenic
1057693109 9:97304322-97304344 CAGGCAAGGATTTCTTAAGCAGG + Intergenic
1057852332 9:98575232-98575254 CAGGAAAGGCTTCCTGAAGGAGG + Intronic
1060752740 9:126184272-126184294 CAAGGAAGGCTTCCTCAAGGAGG - Intergenic
1061012489 9:127963812-127963834 CAACCAGGGACTCCTCCAGGAGG - Intronic
1062754406 9:138279599-138279621 GAGGCCAGGCCTCCTCAAGTTGG + Intergenic
1203578310 Un_KI270745v1:23759-23781 GAGGCCAGGCCTCCTCAAGTTGG + Intergenic
1186883027 X:13885514-13885536 CGGGCCAGGACTCCTAGAGGTGG + Intronic
1187981857 X:24765605-24765627 CAGGAAAGGTCTCATCAAGAAGG - Intronic
1189509188 X:41644771-41644793 GAGACAAGTACGCCTCAAGGGGG - Intronic
1190275309 X:48895547-48895569 CAGGAAAGGCCTCTTGAAGGAGG + Intronic
1190398746 X:50010727-50010749 CAGGCAAGGATTCTGCAAGGGGG + Intronic
1193850975 X:86537018-86537040 CAGGCAAAGACTTGTCATGGTGG - Intronic
1195203117 X:102568279-102568301 CAGCCAAGGAATCCGAAAGGTGG + Intergenic
1195737746 X:108031187-108031209 CAGGGAAGGCCTCATGAAGGAGG + Intergenic
1199564245 X:149197826-149197848 CTTGCAAGAACTCCTGAAGGAGG - Intergenic