ID: 903197120

View in Genome Browser
Species Human (GRCh38)
Location 1:21699032-21699054
Sequence CTGTGCATGTACATGCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903197120_903197123 12 Left 903197120 1:21699032-21699054 CCCAAATGCATGTACATGCACAG 0: 1
1: 1
2: 2
3: 30
4: 238
Right 903197123 1:21699067-21699089 TCGCCCAAGCTGGAGTGCAGTGG 0: 1326
1: 70153
2: 225370
3: 246825
4: 153730
903197120_903197126 23 Left 903197120 1:21699032-21699054 CCCAAATGCATGTACATGCACAG 0: 1
1: 1
2: 2
3: 30
4: 238
Right 903197126 1:21699078-21699100 GGAGTGCAGTGGCACAATCTCGG 0: 14825
1: 56358
2: 118884
3: 139454
4: 107895
903197120_903197122 2 Left 903197120 1:21699032-21699054 CCCAAATGCATGTACATGCACAG 0: 1
1: 1
2: 2
3: 30
4: 238
Right 903197122 1:21699057-21699079 TCTTGCTCTGTCGCCCAAGCTGG 0: 396
1: 19492
2: 99602
3: 156448
4: 187088

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903197120 Original CRISPR CTGTGCATGTACATGCATTT GGG (reversed) Intronic
901350568 1:8592205-8592227 TCTTGCATGTAAATGCATTTAGG - Intronic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
903952295 1:27003195-27003217 CTGTGAATGTGCATGCACTGTGG - Intergenic
905008472 1:34730193-34730215 CTGTGTATGCACATCTATTTGGG - Intronic
905254857 1:36673867-36673889 GTGTGCATGTGCATGCAATTTGG + Intergenic
906178025 1:43792661-43792683 GTGTCCACCTACATGCATTTTGG - Intronic
906583193 1:46953242-46953264 CTGTCTTTGTAGATGCATTTTGG - Intergenic
906601184 1:47130806-47130828 CTGTCTTTGTAGATGCATTTTGG + Intergenic
907222049 1:52914354-52914376 CTGTGTGTGTGCATGCATGTTGG + Intronic
907419948 1:54340520-54340542 CTGTGCGTGGACTTGCTTTTGGG - Intronic
907634147 1:56116738-56116760 ATGAGCAGGTACATGCATTCAGG + Intergenic
908073302 1:60487702-60487724 CTGTTCATGTACAAGTCTTTGGG - Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
916408112 1:164517858-164517880 GTGTGAATGTACATCCATTGTGG - Intergenic
916958155 1:169861799-169861821 TTCTGCATGGACATGAATTTTGG - Intronic
917148746 1:171922161-171922183 GTGTGCATGCACATGCACTTGGG + Intronic
917895741 1:179485069-179485091 CTGTGCATGTTCACGCATGGGGG - Intronic
918832627 1:189417364-189417386 ATGTGCATGTACATATATGTAGG + Intergenic
920739017 1:208562499-208562521 CTTTGCATATACTTTCATTTAGG + Intergenic
920764831 1:208822132-208822154 TCGTGCATGTCCATGCAATTTGG - Intergenic
922974739 1:229774848-229774870 TTTTGCATTTACATGCATTTAGG + Intergenic
1063662170 10:8042487-8042509 CTGTGCATGTAAATATACTTGGG - Intergenic
1063930274 10:11021107-11021129 ATGACCATATACATGCATTTAGG + Intronic
1065090554 10:22229078-22229100 CTGTTGAAATACATGCATTTCGG + Intergenic
1066203535 10:33164799-33164821 TCCTGCATTTACATGCATTTTGG - Intergenic
1067190497 10:44064037-44064059 CTGTGCATGTCCATGAATTATGG - Intergenic
1067574135 10:47397156-47397178 CTGTGCCTGGATATGCATGTAGG + Intergenic
1068341511 10:55710368-55710390 GTGTGCATGCACGTGCATGTAGG - Intergenic
1068765704 10:60760901-60760923 CTGTACATGCACAAGCATTATGG - Intergenic
1069214986 10:65808704-65808726 CTATGCATGTAATTGCATTTTGG + Intergenic
1071941099 10:90592756-90592778 TTGTGCATATAAATACATTTGGG - Intergenic
1072179689 10:92969644-92969666 TTGTGCATGTTTATTCATTTTGG + Intronic
1072556664 10:96521275-96521297 CTGTACATCCAAATGCATTTGGG + Exonic
1073420170 10:103418266-103418288 ATGTGCACGTACATGCATGCTGG + Intronic
1073814354 10:107189671-107189693 GTGTGCTTGTACTTTCATTTGGG + Intergenic
1073854373 10:107657892-107657914 CTCTCCATGTACATGAAATTAGG - Intergenic
1074463453 10:113660188-113660210 ATGTATATGTACATGCATGTGGG - Intronic
1075175982 10:120161414-120161436 CTGTGCATGTATGTGCTTTTTGG + Intergenic
1078383707 11:10868399-10868421 CTGTGGATTCACATGCAGTTGGG + Intergenic
1079162357 11:18006875-18006897 CTGTGTATGTTCATGTATTCTGG + Intronic
1079497153 11:21058486-21058508 CTGTGCATTTAGATGTATTATGG + Intronic
1085153562 11:74272161-74272183 GTGTGCATGCATGTGCATTTGGG - Intronic
1087222087 11:95557520-95557542 CTGTGCATGCACATTCAGATTGG + Intergenic
1087463012 11:98468908-98468930 GTGTACATGTACATTCATTGAGG + Intergenic
1088894159 11:114065138-114065160 CTGATCCTGCACATGCATTTAGG + Intronic
1088966381 11:114725793-114725815 CTCTTCATTTACGTGCATTTTGG + Intergenic
1091519679 12:1225077-1225099 GTGTGTATATACATACATTTGGG + Intronic
1094082225 12:26549873-26549895 CTGAGAATGTCTATGCATTTTGG - Intronic
1094212706 12:27909470-27909492 GTGTGCATGTGCATGCATGTTGG + Intergenic
1095042833 12:37462717-37462739 TTTTGCATGTACATTCATTAGGG + Intergenic
1095570607 12:43680824-43680846 GTGTGCATGTATATTCATATAGG + Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1108566677 13:51706377-51706399 TTGTGTATGAACATGCACTTGGG + Intronic
1109528607 13:63608794-63608816 CTGTGTATGTATATGTGTTTTGG + Intergenic
1109966362 13:69703010-69703032 CAGGGAAAGTACATGCATTTTGG - Intronic
1110683135 13:78339922-78339944 CTCTGTATGTGCATTCATTTGGG + Intergenic
1112000115 13:95202341-95202363 CTCTGCATGTACATACACGTGGG + Intronic
1114263917 14:21059964-21059986 CTCTGTATGTATATGCATATGGG - Intronic
1115742141 14:36399592-36399614 CTTTGGATGTACCTGCATTTAGG - Intergenic
1116327646 14:43552065-43552087 TTGTGCATTTATATGTATTTTGG - Intergenic
1117287278 14:54298678-54298700 CCTTGAATGTGCATGCATTTAGG - Intergenic
1118658952 14:67986042-67986064 CTGTGTGTGTATGTGCATTTGGG + Intronic
1119074642 14:71623978-71624000 CAGTGCATGTACATGTGTTCAGG + Intronic
1120048414 14:79835781-79835803 CTGTGCAAGTATAAGGATTTAGG + Intronic
1121925397 14:97922779-97922801 GTGTGCCTGAGCATGCATTTAGG - Intergenic
1122130083 14:99599917-99599939 TTGTGTATGTACATGCAAATAGG - Intronic
1123136416 14:106031537-106031559 CTATGCCTGGACATGCATGTAGG + Intergenic
1124645583 15:31435713-31435735 CTGTGCATACACATGCATGTGGG - Intergenic
1124681716 15:31737501-31737523 CACTGCATGCACTTGCATTTTGG + Intronic
1125433017 15:39616424-39616446 CTGTGAATGTCCAAGCACTTTGG - Intronic
1125675301 15:41499019-41499041 CTATGCATGTGCATTCATTATGG + Intronic
1126992536 15:54397657-54397679 CATGGCATGTACATGCATTAAGG + Intronic
1136115184 16:28089968-28089990 GTATGCATGTGCATGCATGTGGG - Intergenic
1138447393 16:57073011-57073033 CTGTCCATGTACCTGCATCTCGG + Intronic
1139294385 16:65887519-65887541 CTCTTCATGTACATGCATAGAGG + Intergenic
1139907887 16:70379303-70379325 CTGAGCGGGTACAAGCATTTTGG - Exonic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141783394 16:86180678-86180700 ATGTGTATATACATGCATGTGGG - Intergenic
1144217931 17:13072977-13072999 CTCTCCATGTACAGACATTTGGG - Intergenic
1149995036 17:61401835-61401857 GGGTGGATGTACATGCGTTTGGG - Exonic
1152028763 17:77828497-77828519 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028767 17:77828564-77828586 GTGTGTATGTATATGCATGTGGG + Intergenic
1152028776 17:77828662-77828684 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028782 17:77828778-77828800 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028787 17:77828820-77828842 GTATGCACGTACATGCATGTGGG + Intergenic
1152028792 17:77828877-77828899 GTGTGCACGTATATGCATGTGGG + Intergenic
1152028798 17:77828991-77829013 GTGTGCATGCATATGCATGTGGG + Intergenic
1152028801 17:77829031-77829053 GTATGCACGTACATGCATGTGGG + Intergenic
1152028806 17:77829088-77829110 GTGTGCATGTATATGCATGTGGG + Intergenic
1152028811 17:77829202-77829224 GTGTGCATGTATATGCATGTGGG + Intergenic
1153656539 18:7287767-7287789 GTGTGCATGTATACGCATTTAGG - Intergenic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1155690535 18:28616574-28616596 TTGTAAATGTACATGCATTTTGG - Intergenic
1155727489 18:29106376-29106398 CTATGCAAGTACAACCATTTTGG - Intergenic
1159548307 18:69868760-69868782 ATGTGCATGTGCGTGCATTTGGG - Intronic
1160353221 18:78203118-78203140 ATGTGCACGTGCATGTATTTTGG + Intergenic
1162210296 19:9086158-9086180 CTCTCCATGTACATCCATTAGGG + Intergenic
1162409899 19:10499399-10499421 GAGTACATCTACATGCATTTTGG - Exonic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1162530418 19:11232854-11232876 CTGTGTATGTATATGCATGGGGG + Intronic
1165226292 19:34357561-34357583 CTGTCCACATACATGCTTTTGGG - Intergenic
1166558055 19:43714677-43714699 GGGTGCGTGTCCATGCATTTTGG + Intergenic
1166738407 19:45099603-45099625 CCGTGCCTGTACATGCAGTTGGG + Intronic
927346398 2:22048178-22048200 TTGTGCATGTGCATGCATGCAGG - Intergenic
928544227 2:32314055-32314077 TGGTACATGTACATGCATTTCGG - Exonic
928585794 2:32756740-32756762 CTGGATATGTACATCCATTTTGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
932293887 2:70608485-70608507 CTGTGCAAGTAGATGGGTTTCGG - Intronic
932727251 2:74189988-74190010 TTGTGGATGAACATGGATTTTGG + Intergenic
933437756 2:82270099-82270121 CAGTGCAGATGCATGCATTTGGG + Intergenic
935790884 2:106589171-106589193 TTGTACATGTACATACATGTTGG - Intergenic
937870682 2:126783851-126783873 GTGTGCATGTGCATGAACTTGGG - Intergenic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
940216149 2:151305499-151305521 CTGGGCATGTAGATGCATGTTGG - Intergenic
941101815 2:161305096-161305118 CTTTGTATATACATACATTTTGG + Intergenic
941341398 2:164309494-164309516 CTGTCCATGTGAAGGCATTTAGG + Intergenic
941442063 2:165550852-165550874 CTGTGCAAGAACAGCCATTTGGG + Intronic
941482533 2:166034832-166034854 CTTTCCATGTACATGCATTGAGG + Intronic
942795809 2:179817789-179817811 CTGTGTGTGTGCATGCATGTTGG + Intronic
943107564 2:183565463-183565485 TTGTGCTTGTCCATGAATTTTGG + Intergenic
944998464 2:205321501-205321523 TTGTGCATATACATTCATATGGG - Intronic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
947968334 2:234301070-234301092 ATGTGCATGTACATGTCTATGGG - Intergenic
948600381 2:239104561-239104583 CTGTGCCTGTACACACATGTGGG - Intronic
948658227 2:239490075-239490097 CTGTGCCTGTCCTTGTATTTGGG + Intergenic
1170354753 20:15479905-15479927 CTCTGCATATTCATGCATATAGG - Intronic
1171266186 20:23773821-23773843 CTGTGCATGTACATGTGAGTAGG - Intergenic
1171320870 20:24242969-24242991 CTGTGCATGTGCATGTATGCAGG - Intergenic
1171407302 20:24920059-24920081 GTGTGCCTGTACTGGCATTTTGG + Intergenic
1173971262 20:47154204-47154226 CTCTCCATGTACATGCATTGAGG - Intronic
1174305107 20:49609505-49609527 CTGTGGATTTACATGGATTAAGG + Intergenic
1175783716 20:61699232-61699254 CGGTGGCTGTAAATGCATTTGGG + Intronic
1176254484 20:64144121-64144143 ATATGCATGTATATGCATGTGGG + Intergenic
1176254489 20:64144209-64144231 ATATGCATGTATATGCATGTGGG + Intergenic
1176985257 21:15428640-15428662 CTTGTCATATACATGCATTTAGG - Intergenic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
950874121 3:16254686-16254708 CTGGGCATGTACCCCCATTTGGG + Intergenic
951315395 3:21183924-21183946 TTGTGGATCCACATGCATTTAGG - Intergenic
952882782 3:37995476-37995498 GTGTACATGTACATACATTTGGG - Intronic
953791126 3:45949180-45949202 CTCTGCTTGTAGACGCATTTAGG - Intronic
954868080 3:53746557-53746579 CTGTGCCTGTACATTGGTTTGGG + Intronic
956357382 3:68409119-68409141 CTGTACATGTACATGTGTGTGGG - Intronic
957386746 3:79505922-79505944 CTGTGCATCTACATACACTGTGG - Intronic
957405704 3:79773674-79773696 ATGTGCCTGTACAGGCAGTTTGG + Intergenic
961901360 3:130215193-130215215 GTGTGCATGTGTGTGCATTTTGG - Intergenic
962662231 3:137614625-137614647 ATGTGCATGTATGTGCATGTTGG - Intergenic
963666127 3:148189073-148189095 GTGTGCTTGTACATTCATTCTGG - Intergenic
964110872 3:153086021-153086043 GTGCGCATGTATATGTATTTAGG + Intergenic
964762018 3:160143225-160143247 CTGGGCATGTGCATATATTTAGG - Intergenic
968518712 4:1025632-1025654 CTGTGCGTGTGCGTGCATTTGGG - Exonic
969312763 4:6363645-6363667 ATGTCCATGAACATGGATTTGGG + Intronic
969335978 4:6510541-6510563 GTGTGCATGCACATGCATGTGGG - Intronic
969361228 4:6665232-6665254 GTGTGCATGTGCATACATGTGGG - Intergenic
971663579 4:29453079-29453101 CTGTGCAGGTACATGGGTTCTGG - Intergenic
972204108 4:36750082-36750104 ATGTGTATATACATGCATATTGG - Intergenic
974272771 4:59673952-59673974 TGGGGCATGTATATGCATTTGGG + Intergenic
974693622 4:65335628-65335650 GTGTGTATTTTCATGCATTTTGG - Intronic
976779120 4:88738755-88738777 CAATGGATGTACATGCCTTTTGG + Intronic
978058368 4:104303169-104303191 GTCTAGATGTACATGCATTTTGG - Intergenic
980017180 4:127663287-127663309 CTGTGCATGTACATACACCCAGG - Intronic
980582007 4:134767605-134767627 CTATGCATATACATGTTTTTGGG - Intergenic
980591334 4:134893294-134893316 CTATGTATACACATGCATTTGGG - Intergenic
984267022 4:177507586-177507608 CTGTGAATATAAATGCACTTAGG + Intergenic
984638462 4:182139925-182139947 CTCTCAATGTGCATGCATTTTGG - Intergenic
985833786 5:2256220-2256242 CTCTGTATGTGCATGCATATGGG + Intergenic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
989086769 5:37685020-37685042 CTGTGCATGTTCATGCAGCCAGG + Intronic
990111254 5:52327903-52327925 CTGTGCAGGTCCAAGGATTTGGG + Intergenic
990553529 5:56908573-56908595 GTGTGCGTGTGCATGCATCTGGG + Intergenic
990852188 5:60218805-60218827 AGGAGCATGTAAATGCATTTTGG - Intronic
992145411 5:73842295-73842317 CTGTGAATGAACATGCACATAGG + Intronic
992267172 5:75030944-75030966 CTCTGCATGTACATGCCAATGGG + Intergenic
993109338 5:83636692-83636714 CTCTGCATATATATGAATTTTGG + Intergenic
994872367 5:105368022-105368044 CTTTGGATGTACATCCATTGTGG - Intergenic
995119669 5:108522330-108522352 CTTTGCATATACATGCAGTTGGG + Intergenic
995787706 5:115847925-115847947 CTGTGAACGTATAAGCATTTGGG - Intronic
996102027 5:119453763-119453785 CTCTGCATGGGCATGTATTTGGG + Intronic
996191702 5:120551669-120551691 CTGTGCATGTATATAAATGTAGG + Intronic
997306228 5:132838697-132838719 ATGTGCATGTGGATGAATTTTGG + Intergenic
1001101554 5:168818550-168818572 CTTGTCATGTACTTGCATTTCGG + Intronic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1002309363 5:178305510-178305532 CTGTGCATTTACATGCCTGGGGG + Intronic
1003023617 6:2533496-2533518 CTGTGGTTCTATATGCATTTTGG - Intergenic
1003207942 6:4030669-4030691 CTGTTAATGTAAATGTATTTTGG + Intronic
1003322033 6:5060381-5060403 CTTTGCAGGTACATTCATGTAGG + Intergenic
1003654332 6:7991766-7991788 GTGTGCATGTATATGCATGCAGG - Intronic
1004300301 6:14451684-14451706 CTGTGAACGAACATGCAATTGGG + Intergenic
1004780217 6:18900143-18900165 CTCTGCATGTACAGGCCTTGAGG + Intergenic
1005397472 6:25397937-25397959 GTGTGCATGTGCATGCAGTGAGG + Intronic
1005534372 6:26740665-26740687 GTGTGCGTCTGCATGCATTTGGG + Intergenic
1006437216 6:34032261-34032283 CTGTGCATGTACATGCTCAGTGG - Intronic
1007382203 6:41497757-41497779 ACGTGCATGCACATGCATTGGGG - Intergenic
1013057865 6:106602229-106602251 CTGTGATTCCACATGCATTTTGG + Intronic
1016041198 6:139433451-139433473 CTGTACATATACATGAATTGGGG + Intergenic
1016319831 6:142830844-142830866 GTGTGGATGTGCATGCATTCTGG - Intronic
1016663873 6:146611815-146611837 CTGTACATGTACTAGCCTTTGGG + Intronic
1018489430 6:164276347-164276369 CTGAGCATGAGCAAGCATTTTGG - Intergenic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1019934986 7:4248876-4248898 GTGTGCTTGTACTTGTATTTAGG - Intronic
1020020529 7:4864371-4864393 CAGTGAATGTACATGCAGTGAGG - Intronic
1021317836 7:19171820-19171842 TTTGGCATGTACATGGATTTTGG + Intergenic
1021485828 7:21167436-21167458 CAGTTTATGTACCTGCATTTTGG - Intergenic
1022062147 7:26808212-26808234 CTGTTCATGGACATTTATTTGGG - Intronic
1022361350 7:29662338-29662360 TTGGACTTGTACATGCATTTGGG + Intergenic
1023523070 7:41068222-41068244 TTGTGCCTGTAAATGCTTTTTGG - Intergenic
1023630975 7:42164073-42164095 CTGTGTTTTTGCATGCATTTTGG - Intronic
1023872971 7:44272631-44272653 CTCTGCATGAACATGCATGACGG + Intronic
1025053310 7:55745487-55745509 CTGGGCCTGTACATGCCCTTGGG + Intergenic
1025689709 7:63747966-63747988 CTGGGCCTGTACATGCCCTTGGG - Intergenic
1025735679 7:64144656-64144678 CTGTGAATGGACATGCAGTCAGG - Intronic
1029878171 7:103776028-103776050 GTGTGCATGTGCATGCATCCCGG + Intronic
1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG + Intronic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1031194899 7:118600877-118600899 GTGTGTATATACATGCATGTGGG - Intergenic
1031277536 7:119748371-119748393 CTGTGAATGTGCATGCAAATAGG + Intergenic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1033079558 7:138282410-138282432 CTGGGCACTTACAGGCATTTTGG - Intergenic
1035048704 7:155985761-155985783 GTGTGCATGTGCATGCATGCAGG + Intergenic
1035623121 8:1049973-1049995 CTGTGCATGTGCATACACGTAGG - Intergenic
1036177956 8:6557099-6557121 GTGTGAATGAACATGAATTTGGG - Intronic
1036216226 8:6882202-6882224 GTGTGCATGTACGTGCATTTAGG + Intergenic
1036216232 8:6882346-6882368 GTGTGTGTGTACGTGCATTTAGG + Intergenic
1036914855 8:12795591-12795613 CAGTGCATGTATATGTTTTTAGG - Intergenic
1037731830 8:21532514-21532536 GTGTGCATGTGCATGCATGTAGG - Intergenic
1038120708 8:24611421-24611443 CTGTGGATATGCATGCCTTTAGG + Intergenic
1038890410 8:31715275-31715297 AGGTGCATGTACATAGATTTAGG + Intronic
1038911815 8:31973226-31973248 CTGTGGATATACAGGCTTTTGGG + Intronic
1039129287 8:34243462-34243484 GTGTGCATGTGTATGTATTTTGG + Intergenic
1039884844 8:41649008-41649030 CTGTGTGTGTACCTGCATTCAGG + Intronic
1040586273 8:48745417-48745439 CTCAGCCTGTTCATGCATTTTGG + Intergenic
1041145918 8:54875614-54875636 TGGTGCATTTACAAGCATTTAGG - Intergenic
1041430839 8:57778874-57778896 TTGTGCATGTGCATGTGTTTTGG - Intergenic
1042074613 8:64978221-64978243 CTGTGTGTGAAAATGCATTTTGG + Intergenic
1042710879 8:71715937-71715959 GTTTGCATGGACATGCATTAGGG - Intergenic
1044022363 8:87121018-87121040 CTGGGCATGTACTTTCATTGTGG + Intronic
1044736469 8:95284105-95284127 TGTTGCATGTACATGCAGTTTGG - Intergenic
1045361419 8:101437202-101437224 CTGTGCGTGCACATGCCTGTCGG + Intergenic
1047735300 8:127759844-127759866 GTGTGCATGGGCATGCATTCTGG + Intergenic
1050161420 9:2723676-2723698 CTTTGCTTCTACATTCATTTGGG + Intronic
1050462038 9:5885280-5885302 CTGTGAATGTACAAACAGTTCGG - Intronic
1051166172 9:14264477-14264499 CTGTGCATTTAAGAGCATTTAGG + Intronic
1053271605 9:36753498-36753520 CTGTGCGTGTGCAGGCATGTGGG + Intergenic
1056199693 9:84263217-84263239 CTTTGCACGCACATGCATGTAGG - Intergenic
1056961476 9:91128204-91128226 GTGTGCATGTACATGTTTGTGGG + Intergenic
1057722129 9:97540832-97540854 ATGTTCGTGTACAAGCATTTGGG + Intronic
1058232064 9:102437957-102437979 ATGTAAATGTACATACATTTTGG - Intergenic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1060759762 9:126237305-126237327 GTGTGCATGTGCATGCATTTGGG + Intergenic
1061835965 9:133330175-133330197 CTGTAGATGCACATACATTTAGG + Intergenic
1062190573 9:135245914-135245936 CTCTGGATATACATGAATTTGGG + Intergenic
1185487384 X:493180-493202 CTGTACACGTATATGCATATGGG - Intergenic
1185970786 X:4660571-4660593 CTCTCCAATTACATGCATTTTGG - Intergenic
1186061940 X:5718463-5718485 CTCTGTATGTTCCTGCATTTTGG - Intergenic
1186720933 X:12302981-12303003 CTGGCAATGAACATGCATTTTGG + Intronic
1188075034 X:25765103-25765125 TGGTGCATGTACAAGAATTTTGG + Intergenic
1188872418 X:35389374-35389396 CTCTGCATGTATATAAATTTTGG - Intergenic
1189637108 X:43023094-43023116 CAGTGGAGGTACAGGCATTTGGG + Intergenic
1190060249 X:47206241-47206263 CGGTCCATGTACATGCCTGTGGG - Exonic
1190155149 X:47985112-47985134 ATGTTCATGTACAGGCTTTTAGG - Intronic
1191800423 X:65073245-65073267 CTGTCCATGCACATGCATAGTGG + Intergenic
1192148314 X:68696346-68696368 GTGTGCATGGGCATGCATTCGGG + Intronic
1193407414 X:81120002-81120024 TTGTGCATGCACTTGCATCTTGG - Intronic
1193628759 X:83853692-83853714 ATGCTCATGTGCATGCATTTTGG + Intergenic
1194041048 X:88942397-88942419 CTGTCCATTTACATGCTTTTTGG + Intergenic
1194202009 X:90963777-90963799 CTGTTGATGTGCATGCGTTTAGG - Intergenic
1195563671 X:106316190-106316212 GTGTGTGTGTGCATGCATTTAGG - Intergenic
1199868276 X:151873896-151873918 GTGTGCGTGTGCATGCATCTGGG + Intergenic
1200547846 Y:4539228-4539250 CTGTTGATGTGCATGCGTTTAGG - Intergenic
1201746031 Y:17374894-17374916 GTGTGCATGTATATGCCTGTGGG + Intergenic