ID: 903199048

View in Genome Browser
Species Human (GRCh38)
Location 1:21718170-21718192
Sequence ATGTACACACAGATGCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903199048_903199049 19 Left 903199048 1:21718170-21718192 CCTCACTGCATCTGTGTGTACAT 0: 1
1: 0
2: 2
3: 23
4: 266
Right 903199049 1:21718212-21718234 ATAGAATCAGATAAACATAATGG 0: 1
1: 0
2: 2
3: 26
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903199048 Original CRISPR ATGTACACACAGATGCAGTG AGG (reversed) Intronic
900536476 1:3180313-3180335 ACGTACACACAGGTGGAGTGAGG + Intronic
901685983 1:10943614-10943636 ATGTAACCAGAGAAGCAGTGTGG - Intergenic
902561809 1:17282287-17282309 ATGTAGACACAGAAACAGAGAGG - Intronic
903199048 1:21718170-21718192 ATGTACACACAGATGCAGTGAGG - Intronic
904605061 1:31693470-31693492 ATGGACACACACATGCACGGTGG + Intronic
906162405 1:43660069-43660091 ATGTACACACAGATGTAAACCGG - Intronic
907519274 1:55012483-55012505 ATGTCCACATTTATGCAGTGGGG + Intergenic
908222991 1:62027087-62027109 ATGTATACAGAGATTCAGTTTGG - Intronic
908448916 1:64230502-64230524 ATGTACACACAGAGGATGTTGGG - Intronic
909703840 1:78557045-78557067 ATGTGCTCCCAGATTCAGTGTGG - Intergenic
909721331 1:78773809-78773831 ATGTAAACACCGCTGCATTGGGG - Intergenic
910213009 1:84813189-84813211 ATATACACACACATGCATGGAGG + Exonic
910666929 1:89735455-89735477 ATGCACACACACATCAAGTGGGG - Intronic
911053525 1:93692267-93692289 GTGCACACACAGCTGCTGTGGGG + Intronic
913443503 1:118925014-118925036 ATGGACAAAAAGATGGAGTGGGG + Intronic
914839979 1:151240362-151240384 ATGTACAGAGATACGCAGTGAGG + Intronic
916763839 1:167841373-167841395 ATGTAAAGACAGAGGAAGTGAGG - Intronic
916774250 1:167943701-167943723 GTGTTCACACAGATGCAGAGTGG - Intronic
918484256 1:185012679-185012701 ATGAACACACAGATTCTGTTTGG - Intergenic
920686203 1:208110735-208110757 ATTCCCACACAGATGCAGCGGGG + Intronic
922060465 1:222085555-222085577 ATGTACAAACAGAGGCATTCTGG - Intergenic
1063303541 10:4875711-4875733 AGGGACACACAGAGGCAGTGTGG + Intergenic
1064698378 10:17990783-17990805 TTGTACAAACAGATGCAGATTGG + Intronic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1065138593 10:22698178-22698200 ATGTACGCACATGGGCAGTGTGG - Intronic
1065158975 10:22899462-22899484 ATTTGAACACAGATGCAGAGAGG + Intergenic
1065241625 10:23711073-23711095 ATGTGCATACAGAAGGAGTGAGG + Intronic
1069040648 10:63692296-63692318 ATGTTCACACATATGAATTGAGG - Intergenic
1069861307 10:71473364-71473386 ATGAACACACAGGTGCACAGAGG - Intronic
1072885917 10:99273748-99273770 ATAGACAAACAGATGCAGGGAGG + Intergenic
1074255920 10:111802415-111802437 ATACAAACACAGTTGCAGTGGGG + Intergenic
1074418015 10:113284284-113284306 ATTCACACAGGGATGCAGTGAGG + Intergenic
1074703887 10:116114885-116114907 ATCTTCACAGGGATGCAGTGAGG - Intronic
1075250995 10:120873258-120873280 ATGAAAACACAGATTTAGTGTGG + Intronic
1075444188 10:122502489-122502511 ATGTAGAAACAGATCCAGTGAGG - Intronic
1076034392 10:127186863-127186885 ATGCACACACAGATACAGGAGGG + Intronic
1078940864 11:16003805-16003827 ATGTACCCATAGTTGCGGTGTGG + Intronic
1080759965 11:35239108-35239130 ATGTTCAGGCAGAAGCAGTGTGG - Intergenic
1080937848 11:36882376-36882398 ATGTGCCCACAGATGTGGTGTGG + Intergenic
1081994769 11:47356308-47356330 ATGTGTAAGCAGATGCAGTGTGG - Intronic
1082716295 11:56618333-56618355 ATATACCCACAGGTGCAGAGGGG - Intergenic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1084028826 11:66468821-66468843 ATCTTCACAAAGATGCTGTGAGG + Exonic
1085770421 11:79320651-79320673 ATGTAGACAGAGTTGCAATGTGG - Intronic
1085862921 11:80255824-80255846 ACGTACACACACACACAGTGAGG + Intergenic
1087414350 11:97834106-97834128 AGGCACACACAAAGGCAGTGAGG - Intergenic
1088028439 11:105216049-105216071 TTTTACAGACAGAGGCAGTGTGG - Intergenic
1088299006 11:108335346-108335368 ATGTACAGACATGTACAGTGAGG + Intronic
1088914411 11:114216539-114216561 ATGTACACCCAGCTGCTTTGGGG + Intronic
1089212033 11:116810971-116810993 TTGCACACACAGGTGCAGCGTGG - Intergenic
1089881555 11:121778431-121778453 ACGTACACACACATGCTGTGGGG - Intergenic
1090399201 11:126438014-126438036 ATGTACACACACATACTCTGGGG + Intronic
1091111164 11:132969530-132969552 ATTTAAACACAGTTGCAGGGGGG - Intronic
1093116467 12:15217951-15217973 GTGTACAAACACATGCAGTGGGG + Intronic
1095109679 12:38279282-38279304 ATGAACACACAGATGAAAGGTGG - Intergenic
1097781677 12:63713979-63714001 ATGGAGACAATGATGCAGTGGGG - Intergenic
1100583137 12:95954920-95954942 ATGCACACACACATCCAGTATGG + Exonic
1100853613 12:98739067-98739089 GTGTGCAAACAGATGCAGAGAGG + Intronic
1103680217 12:122687923-122687945 ATGTACACACGGTTGGAGAGAGG - Intergenic
1104355835 12:128086486-128086508 ATCTACACACAGGTGCACTCAGG - Intergenic
1109133323 13:58615235-58615257 ATGTACAAAGAAAGGCAGTGAGG + Intergenic
1111133670 13:84010107-84010129 GTGTATACACACATGCAGAGAGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1114222419 14:20708771-20708793 ATGTACTCACAGCTGCTGGGAGG - Intergenic
1115457361 14:33618913-33618935 ATGTAGAAAGAGAAGCAGTGAGG + Intronic
1115908225 14:38225007-38225029 ATGTACAGAAAAATGAAGTGAGG + Intergenic
1117023019 14:51591179-51591201 ATTTACACAAAGACGCAGTATGG - Intronic
1117097218 14:52311311-52311333 ATGTCCCCACTCATGCAGTGAGG + Intergenic
1117484044 14:56175960-56175982 ATGTAAACACAGGAGCTGTGGGG - Intronic
1119547008 14:75479320-75479342 AGGTACACCCAGCTGGAGTGGGG - Intergenic
1121035019 14:90696039-90696061 ATGTTCTCAAAGATGCAGAGTGG - Intronic
1122218732 14:100221832-100221854 ATGAAAACACAGATGGGGTGAGG + Intergenic
1122572670 14:102717906-102717928 ATGAACACACTGCTGCACTGTGG - Intronic
1123758981 15:23418099-23418121 ATGTACACACAGATCACCTGGGG - Intergenic
1124433835 15:29631745-29631767 GTGTCCACAGAGATGGAGTGGGG - Intergenic
1125118439 15:36123071-36123093 ATGTAGACACAGAATCAGTTTGG - Intergenic
1125751593 15:42032946-42032968 ACTCACACACACATGCAGTGGGG - Intronic
1127488494 15:59440387-59440409 ATGTACACCCAGGTACAGTGGGG + Intronic
1128142599 15:65312587-65312609 ATTTACACACTGAGCCAGTGTGG - Intergenic
1129727313 15:77908153-77908175 GTGTGCACACACATGCTGTGAGG - Intergenic
1130270337 15:82442893-82442915 TTGTGCACACACATGCTGTGAGG + Intergenic
1130275630 15:82474936-82474958 TTGTGCACACACATGCTGTGAGG - Intergenic
1130462681 15:84170214-84170236 GTGTGCACACACATGCTGTGAGG + Intergenic
1130467990 15:84202328-84202350 TTGTGCACACACATGCTGTGAGG - Intergenic
1130485698 15:84397179-84397201 GTGTGCACACACATGCTGTGAGG + Intergenic
1130489997 15:84424575-84424597 GTGTGCACACACATGCTGTGAGG - Intergenic
1130496276 15:84471214-84471236 TTGTGCACACACATGCTGTGAGG + Intergenic
1130501583 15:84503325-84503347 GTGTGCACACACATGCTGTGAGG - Intergenic
1130590282 15:85206926-85206948 TTGTGCACACACATGCTGTGAGG - Intergenic
1131738996 15:95366189-95366211 GTATCCACACTGATGCAGTGAGG - Intergenic
1132266219 15:100473265-100473287 GTGTACACATATATCCAGTGTGG - Intronic
1133859097 16:9577098-9577120 GAGAACACACAGATGCAGAGAGG - Intergenic
1134457361 16:14404764-14404786 ATGTACACACAGATCACCTGGGG + Intergenic
1137063437 16:35812369-35812391 AGGTTCACACAGATGCCCTGAGG - Intergenic
1140178560 16:72690448-72690470 ATATACCCTCATATGCAGTGAGG + Intergenic
1144199618 17:12928508-12928530 ATGTACACACACACACAGTATGG - Intronic
1144678686 17:17178359-17178381 ATGTACTGACAGATGCTGGGAGG + Intronic
1144834890 17:18151562-18151584 ATGGACACTCAGGTACAGTGAGG - Intronic
1145283226 17:21483682-21483704 TTGTACTCACAGAAGCAGAGAGG + Intergenic
1147425912 17:40345772-40345794 CTGCACACACAGGTGGAGTGGGG - Intronic
1148485238 17:47986647-47986669 ATGTCCACAGAGATGCATTTGGG - Intergenic
1148601504 17:48897811-48897833 ATGTACCCACATATACAATGAGG - Intergenic
1152061345 17:78078073-78078095 ATGTGCACACAGAGGCTGTTTGG - Intronic
1152285824 17:79412806-79412828 ATATACACACACATGCATAGAGG - Intronic
1153273599 18:3347325-3347347 GTGAACACACAGGTCCAGTGTGG - Intergenic
1153909597 18:9695399-9695421 ATGTAGACTCAGGTGCTGTGGGG - Intergenic
1154103616 18:11500070-11500092 ACATACACACAGAGGAAGTGCGG - Intergenic
1156794402 18:41025209-41025231 AAATACACAAAGATACAGTGTGG + Intergenic
1157174993 18:45443556-45443578 ATTTACACAGAAAGGCAGTGGGG + Intronic
1157863668 18:51162923-51162945 CTGTACACAAACAGGCAGTGGGG - Intergenic
1158008179 18:52697272-52697294 ACATACACACACATGCAATGTGG + Intronic
1158514160 18:58117384-58117406 ATTAACACACAGAAGCAATGTGG - Intronic
1159942992 18:74422833-74422855 ATGTACACACATCTGCAGCTTGG - Intergenic
1160224278 18:77000000-77000022 ATGTAGACTCAGATGCTGGGGGG + Intronic
1160740308 19:682546-682568 AGGGGCACACAGAGGCAGTGGGG - Exonic
1161299300 19:3535152-3535174 ATGAACAGACGGAGGCAGTGAGG - Intronic
1162057883 19:8075711-8075733 ATGCACACAAAAATGCAATGAGG - Intronic
1163023188 19:14494906-14494928 ACGGCCACACAGAAGCAGTGTGG + Intronic
1165805417 19:38577873-38577895 GTGTAGACACAGCTGGAGTGTGG - Intronic
1165899000 19:39159899-39159921 ATAAAGACACAGATCCAGTGGGG - Intronic
1166275199 19:41748810-41748832 ATTCACACACACATTCAGTGAGG - Intronic
1166412492 19:42565334-42565356 ATTCACACACACATTCAGTGAGG + Intergenic
1166567220 19:43772547-43772569 ATTTCCACAAAGATGCTGTGTGG + Intronic
1167255540 19:48425797-48425819 ATATATACATAGATACAGTGAGG + Intronic
1167483583 19:49747265-49747287 ATGTGCACGAAGGTGCAGTGTGG + Intronic
1167889571 19:52528568-52528590 ATGTACACAGAGATGAAGGACGG + Intronic
1167961852 19:53112265-53112287 ATGTCCACCCACAGGCAGTGTGG + Intronic
925380842 2:3424857-3424879 ATGTACAAACAGATGCACCAGGG - Intronic
925550808 2:5072200-5072222 ATGCACACACAGATGCACACAGG + Intergenic
926404860 2:12540825-12540847 ATGTGCACACAAAGGCTGTGAGG - Intergenic
927398977 2:22688874-22688896 ATGTGCACAAAGATGCTATGTGG + Intergenic
928051137 2:27996482-27996504 ATTTAAACACACAAGCAGTGTGG + Intronic
928400689 2:30976580-30976602 ATGCACACACAGCTGCCGTCTGG - Intronic
929376549 2:41293686-41293708 CTCAACACACAGATGCTGTGAGG - Intergenic
930366839 2:50449961-50449983 ATGGCCACACAGATGCCATGTGG + Intronic
935076431 2:99748919-99748941 ATCGACACACAGAAGCAGTGAGG - Intronic
935926623 2:108076714-108076736 ATGTACACAGAGCAGCTGTGTGG + Intergenic
936451277 2:112635622-112635644 ATGTAAAGACTGATGCCGTGTGG + Intergenic
936590810 2:113802096-113802118 ATCTACTCACAGAGGCAGTTTGG - Intergenic
937726028 2:125167687-125167709 ATGCCCACACAGAGACAGTGAGG - Intergenic
938166253 2:129029502-129029524 ATGTACACACCAACTCAGTGAGG - Intergenic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943644718 2:190397873-190397895 ATGAACACAGAGATTCAGTCTGG + Intergenic
946216829 2:218190575-218190597 ATGTACACACTGATGTATTTAGG + Intergenic
946605068 2:221394963-221394985 CTCCACACACAGATGCAGGGAGG - Intergenic
946669546 2:222088205-222088227 ATGCACACACAGATTGAGAGAGG - Intergenic
946760930 2:222992488-222992510 ATGTAGAGACAGCTGTAGTGTGG - Intergenic
948055475 2:235006913-235006935 AAGGACACACAGATGCGGCGTGG - Intronic
1169274393 20:4223934-4223956 ATGCACACACAGCTGCAGTGGGG - Intronic
1169303784 20:4470590-4470612 ATGTACACAAAGGTATAGTGTGG + Intergenic
1172647620 20:36481030-36481052 ATGCACACAAAGATGATGTGTGG + Intronic
1172697216 20:36831171-36831193 ATGTACATAGAGATGGAGTCTGG - Intronic
1174565824 20:51463843-51463865 ATGTACCCACAGATGCACTGAGG - Intronic
1175419789 20:58823966-58823988 AAGTACACACCTATGCAGCGAGG + Intergenic
1175836750 20:62000957-62000979 ATCTACACACAGATGCGCAGGGG + Intronic
1176086319 20:63297111-63297133 ATGTGCACACACTTCCAGTGTGG + Intronic
1176599502 21:8778851-8778873 ACACACACACAGCTGCAGTGAGG + Intergenic
1179249801 21:39663389-39663411 AAGAACACACAGAAGCAGTAGGG - Exonic
1179721626 21:43319442-43319464 CTGTACACACAGAGGGGGTGGGG + Intergenic
1181014173 22:20059349-20059371 ATGACCACACAAATGCTGTGAGG - Intronic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1183000344 22:34852043-34852065 ATGTACAAAGAGATAAAGTGGGG - Intergenic
1183148953 22:36021974-36021996 ATGAGCAGACAGATGGAGTGAGG - Intronic
1183298197 22:37044366-37044388 ATTTGCACAAAGATGCAGTGGGG - Intergenic
1185175428 22:49323859-49323881 ATGCACTCACAGCTGCACTGGGG - Intergenic
949726201 3:7048654-7048676 ATGGACACATATATGCATTGTGG + Intronic
950110527 3:10415824-10415846 ATGTCCAGACAGATGCTATGTGG + Intronic
950757120 3:15184305-15184327 AAATACACACTGATGCATTGTGG + Intergenic
953223203 3:40992225-40992247 ATGTGCACACTGGTGCAGTCAGG - Intergenic
954235274 3:49252270-49252292 ATTTACACACTGAGGGAGTGAGG + Intronic
955623849 3:60895373-60895395 ACATACACACACATACAGTGAGG - Intronic
956036384 3:65096706-65096728 AGGTACTCAAAGAGGCAGTGTGG + Intergenic
956791003 3:72680015-72680037 ATGTAACCACAGAAGCTGTGTGG + Intergenic
957766218 3:84628504-84628526 ATGTACACGCTGATGGAATGTGG - Intergenic
960696930 3:120405629-120405651 CTGTGCACACATCTGCAGTGGGG - Intronic
962150927 3:132892678-132892700 ATGTACATACAGAAACAGAGAGG + Intergenic
964945570 3:162219557-162219579 ATGTTCAGACAAATGCAGAGAGG - Intergenic
965948142 3:174267650-174267672 AAGTACTCTAAGATGCAGTGTGG - Intronic
965954856 3:174357531-174357553 ATGTACACACACATGAAGAGGGG - Intergenic
966267802 3:178067444-178067466 ACGTACACACAAATCCACTGGGG + Intergenic
966985872 3:185179858-185179880 ATGTGAGCACAGATGCAGGGAGG + Intergenic
968544056 4:1187008-1187030 ATATACCCACAGTTGCAATGTGG - Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969304850 4:6319725-6319747 ATGTACACACACAGTCAGAGAGG + Intergenic
969648796 4:8450659-8450681 ATAAACACACAGATGTATTGGGG - Intronic
970260454 4:14218884-14218906 CTGTACACACAGAGGCATTGTGG + Intergenic
972140875 4:35957890-35957912 ATTTACACACACATGCATGGTGG + Intronic
972202582 4:36733158-36733180 ATTTAAAATCAGATGCAGTGTGG - Intergenic
973188365 4:47357707-47357729 ATGTTCAGAGAGCTGCAGTGAGG + Intronic
974083905 4:57239455-57239477 ATGTAACCACAGCTGCAGGGGGG - Intergenic
974559078 4:63494016-63494038 AAGTGAACACAGCTGCAGTGTGG - Intergenic
977412921 4:96690718-96690740 ATGAACAGACATCTGCAGTGAGG + Intergenic
979478097 4:121181863-121181885 ATGTAGAGACAGATTCATTGTGG - Intronic
982853302 4:160346791-160346813 ATGTACACACATATTCATTGTGG + Intergenic
983415710 4:167450853-167450875 ATATACACATACATGAAGTGTGG - Intergenic
984125966 4:175811086-175811108 ATGTACACACACATACTTTGAGG - Intronic
984705984 4:182847564-182847586 AGGTATACCCAGATGCAGTCAGG - Intergenic
985096023 4:186413994-186414016 TTGTAAACACACATACAGTGTGG + Intergenic
985630788 5:1012952-1012974 ATCAACACAGAGATGCAGGGTGG + Intronic
986479087 5:8166430-8166452 ATGTACACACACATGCTGTCAGG + Intergenic
986851183 5:11816145-11816167 ACCTACAAACACATGCAGTGTGG + Intronic
988121583 5:26970450-26970472 GTGTATACATAGATGCAGTGAGG - Intronic
988461504 5:31442799-31442821 GTGTCCAGGCAGATGCAGTGAGG - Intronic
988535860 5:32067461-32067483 ATGTACACATACATGCACTCAGG - Intronic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
988974235 5:36499534-36499556 CTCAACACACCGATGCAGTGGGG - Intergenic
989232881 5:39105942-39105964 ATCTTCACAGAGATGAAGTGGGG - Intronic
989791027 5:45402064-45402086 ATGTACACACACATACTATGGGG - Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991442253 5:66663202-66663224 ATGTATACACACATGCACTGAGG - Intronic
993254365 5:85569714-85569736 ATGGTCAGAGAGATGCAGTGTGG + Intergenic
993453725 5:88103359-88103381 ATATACACACAGAAGCTATGAGG - Intergenic
995821171 5:116234684-116234706 ATTTACACACAGATCGAGTTAGG + Intronic
999081292 5:148846207-148846229 ATATCCACACAGATGAACTGAGG + Intergenic
999230291 5:150057718-150057740 ATGCTCACTCAGATGGAGTGTGG - Intronic
1001092751 5:168753262-168753284 ATTTACACACAGCCCCAGTGGGG - Intronic
1006555766 6:34865062-34865084 ATACACACACACATACAGTGTGG + Intronic
1007229117 6:40335926-40335948 GTGTACACACATCTGCAATGCGG + Intergenic
1007810818 6:44484586-44484608 ATGTGCACACACATGCCCTGGGG + Intergenic
1009461959 6:63924113-63924135 ATGTAAAATCATATGCAGTGAGG - Intronic
1009953206 6:70420219-70420241 ATGAACCCACAGATGCCCTGAGG - Intronic
1010639670 6:78308970-78308992 ATGTACATACAGAGGCAGGTAGG - Intergenic
1011346992 6:86381147-86381169 AGCAAGACACAGATGCAGTGGGG - Intergenic
1013474753 6:110497046-110497068 ATCTACACAGAGAAGCAGAGAGG - Intergenic
1014503659 6:122226333-122226355 ATGTACCCTCAGAAGAAGTGTGG - Intergenic
1018220031 6:161568754-161568776 ATGTACACACATATATAGTATGG - Intronic
1020130062 7:5554825-5554847 GTGTACACACAAGTGCACTGGGG + Intronic
1020774383 7:12434995-12435017 ATCTACTCACAGATGCATTCTGG + Intergenic
1021689222 7:23216036-23216058 ATATACACAGTGAGGCAGTGAGG + Intergenic
1022338540 7:29446528-29446550 ATGTCCAGGCAGATGCAGGGAGG + Intronic
1022725146 7:32974518-32974540 ATGTGCCCACAGATGTAATGGGG - Intronic
1022940278 7:35230073-35230095 ATGGAGACAATGATGCAGTGGGG - Intronic
1023935708 7:44738310-44738332 CTGTATAAACACATGCAGTGGGG + Intergenic
1024523791 7:50330819-50330841 ATGAAAAGACAGAAGCAGTGGGG + Intronic
1024598470 7:50959941-50959963 AGGGCCACACAGGTGCAGTGTGG + Intergenic
1025048455 7:55713327-55713349 ATGTGCCCACAGATGTAATGGGG + Intergenic
1027477100 7:78646812-78646834 ATGTAGAGAGAGATGAAGTGAGG - Intronic
1030295206 7:107918352-107918374 AGGCACAAACAGATTCAGTGAGG - Intronic
1031858301 7:126948382-126948404 ATGTACACACAGATGTGTTTGGG + Intronic
1031882355 7:127211444-127211466 ATGCCCACACAGATGGAGGGTGG + Intronic
1032437541 7:131912495-131912517 AGGTAGGAACAGATGCAGTGGGG - Intergenic
1032587541 7:133161386-133161408 ATGTACACACACATAAAGTGTGG - Intergenic
1035411355 7:158645308-158645330 ATATAAAAACAGATGCAGGGTGG + Intronic
1035613446 8:984723-984745 ATGTAAAAACAGATGCAATAAGG - Intergenic
1035690847 8:1558289-1558311 TTGTACACTCAGCTGTAGTGTGG + Intronic
1037162193 8:15787086-15787108 ATTAACTCACAGAAGCAGTGTGG - Intergenic
1038143577 8:24872582-24872604 AGGCACACAGACATGCAGTGAGG - Intergenic
1038325124 8:26567192-26567214 ATGGACAGACAGATGATGTGTGG - Intronic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1039146737 8:34455694-34455716 ATGGACACACACATGTACTGAGG + Intergenic
1040497274 8:47977362-47977384 GTGTATGCACAGATGCAGTCTGG + Exonic
1041208757 8:55525044-55525066 AGGTACACAAAGAGGAAGTGGGG + Exonic
1041531412 8:58872113-58872135 ATATACACACACATACAGAGTGG + Intronic
1042764769 8:72308919-72308941 ATGCACACACACACCCAGTGGGG + Intergenic
1043306902 8:78806212-78806234 ATGTGCACACTGATGCCGGGAGG + Intergenic
1044656863 8:94557594-94557616 GTGGACACACACATGAAGTGAGG + Intergenic
1044815610 8:96109224-96109246 GTTTACACACACATGCAGTCAGG + Intergenic
1046414676 8:113897335-113897357 ACACACACACAGATGCAGGGTGG + Intergenic
1046485346 8:114880489-114880511 ATGCACCCACAGATGCAGAGAGG - Intergenic
1048729032 8:137417686-137417708 ACATACACACATATGCAGTATGG + Intergenic
1051198140 9:14586383-14586405 TGGTCCAGACAGATGCAGTGAGG - Intergenic
1051409357 9:16773196-16773218 CTGTACACACACATGCACTATGG + Intronic
1051638457 9:19202755-19202777 TTGGACAGACAGATGCAGGGGGG - Intergenic
1052744534 9:32427270-32427292 TGGTAAACACAGATGCAGTGTGG - Intronic
1053128617 9:35602770-35602792 ATATACACAAATATGGAGTGGGG + Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054971083 9:71087609-71087631 ATGTACCCAGTCATGCAGTGAGG - Intronic
1055228323 9:74028632-74028654 ATGTGCACAGAGTTACAGTGAGG + Intergenic
1056551475 9:87656605-87656627 GTGTAAACACTGCTGCAGTGTGG - Intronic
1059553345 9:115252625-115252647 ATTCTCACACAAATGCAGTGGGG - Intronic
1059756594 9:117299564-117299586 ATGTACAAAGGGATACAGTGGGG + Intronic
1059779520 9:117511621-117511643 ATGTGCAGACAGGTGCAGAGAGG + Intergenic
1059962011 9:119574772-119574794 GTGTACACGCATATGAAGTGGGG - Intergenic
1061368094 9:130182896-130182918 AAGTCCTCACAGGTGCAGTGTGG + Intronic
1061424840 9:130492464-130492486 ACAGACACACAGATGCAGAGTGG - Intronic
1062062168 9:134502498-134502520 CTCTGCACCCAGATGCAGTGGGG + Intergenic
1186158836 X:6754815-6754837 ATTTACAGACATGTGCAGTGTGG + Intergenic
1186178331 X:6948490-6948512 ATGTGCACACATATCCACTGGGG + Intergenic
1188908754 X:35820268-35820290 ATGTACAAACTGAAGCAGTCAGG + Intergenic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1190715961 X:53103787-53103809 ATGTGGATACAGATGCTGTGTGG - Intergenic
1194382720 X:93215500-93215522 GTGAATACACAGATGCACTGTGG + Intergenic
1196635387 X:117995955-117995977 ATGTACACCCATGTGCAGGGAGG - Intronic
1197705134 X:129629501-129629523 ATGAAGAAACAGATGCAGAGAGG + Intergenic
1199497415 X:148468388-148468410 ATGTACACACAAATACAATTTGG + Intergenic
1202368193 Y:24180797-24180819 GTGTGCACACACATGCTGTGAGG + Intergenic
1202372504 Y:24208385-24208407 GTGTGCACACACATGCTGTGAGG - Intergenic
1202498281 Y:25461735-25461757 GTGTGCACACACATGCTGTGAGG + Intergenic
1202502592 Y:25489320-25489342 GTGTGCACACACATGCTGTGAGG - Intergenic