ID: 903201680

View in Genome Browser
Species Human (GRCh38)
Location 1:21745171-21745193
Sequence ATGCTTGCTGTACCTTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903201680 Original CRISPR ATGCTTGCTGTACCTTATAT AGG (reversed) Intronic
903201680 1:21745171-21745193 ATGCTTGCTGTACCTTATATAGG - Intronic
908077724 1:60539286-60539308 ATGGTTCCTGTTCCTTATAATGG + Intergenic
910617417 1:89215019-89215041 ATTCTTGCTGTACTTTGTGTGGG + Intergenic
911989675 1:104677410-104677432 TTGCTTTCTGTACAATATATGGG + Intergenic
914780856 1:150783207-150783229 ATACTTTCTGTATCTTATTTTGG - Intergenic
914854015 1:151337026-151337048 ATGTTTGCTGTAATTTATCTAGG - Intergenic
918361644 1:183764887-183764909 ATTCTTGCTGCACTTTATATGGG - Intronic
919225980 1:194702177-194702199 ATAATTTCTGTAACTTATATTGG - Intergenic
1065287077 10:24196485-24196507 ATTCTTGCTGTACCAAGTATCGG + Intronic
1067076333 10:43186938-43186960 ATTCTTGTTGTACATTCTATGGG + Intergenic
1067922991 10:50478904-50478926 GTGGTTCCTGTACCTTGTATGGG - Intronic
1073586310 10:104713415-104713437 ATGCTAGCTGTACGTTTTTTGGG + Intronic
1074729573 10:116355253-116355275 ATTTTTGCTGTACCTTTTCTAGG + Intronic
1082237089 11:49831542-49831564 ATGCTTCCTGTATCTTATCCTGG + Intergenic
1085506311 11:77062561-77062583 ATGCTTGTTGTACATTGAATTGG + Intergenic
1087730221 11:101769831-101769853 AGGCTTGCTTAACCTTAAATAGG + Intronic
1092228512 12:6764355-6764377 CTGCTTGCCCTGCCTTATATGGG - Intronic
1094383162 12:29865586-29865608 ATCTCTGCTGTACTTTATATGGG + Intergenic
1096947670 12:55425885-55425907 TTGCTTACTGTATCTTTTATAGG - Intergenic
1100212049 12:92407709-92407731 GTGCTTAATGTACCATATATTGG - Intergenic
1100925070 12:99536178-99536200 ATTCTTGATGTACATTCTATGGG - Intronic
1101382132 12:104223283-104223305 AGGCTTGCTGCACTCTATATAGG + Intronic
1104366482 12:128182689-128182711 ATGCTTTCTCTACCTTATCTAGG + Intergenic
1106248583 13:27967910-27967932 CTGCTCGCTGTACCTTGAATTGG + Intronic
1106520035 13:30488993-30489015 ATGCTTGCTGTGCTGAATATTGG - Intronic
1106652028 13:31701449-31701471 ATGCTTGATGAAACTTATCTGGG + Intergenic
1109662801 13:65487041-65487063 TTGCTTGCTGTAATTTTTATTGG - Intergenic
1109950043 13:69489627-69489649 ATTCTTGCTGTACTTTATGTGGG + Intergenic
1116842086 14:49829414-49829436 ATGCTTGCTTTTCCTTTTATTGG + Exonic
1116919391 14:50556798-50556820 ATCCATGTTGTACCATATATTGG + Intronic
1124937678 15:34187655-34187677 ATGTTTGCTGTACTTTGTATGGG - Intronic
1125327705 15:38553698-38553720 AGGCGTGCTGTACATTTTATAGG + Intronic
1127281225 15:57495137-57495159 ATGCTTCCTGTAGCTTTTACAGG + Intronic
1130368377 15:83261570-83261592 ATGCTTGCTCTTCCATTTATAGG + Intronic
1132304756 15:100802961-100802983 TTGCTTGCTCTGCCTTATTTGGG - Intergenic
1145290534 17:21542147-21542169 AAGATTGCTATACCTTATAAAGG + Intronic
1146239251 17:31200853-31200875 ATTCTTCCTATACCATATATAGG - Intronic
1149171473 17:53816786-53816808 ATGTTTGCTATACCAAATATTGG - Intergenic
1151658202 17:75505496-75505518 ATGATTGCTGTTACTTATTTGGG - Intronic
1154413441 18:14156889-14156911 ATTCTTCCTGTACCATATATAGG + Intergenic
1156987695 18:43368269-43368291 ATGCTTGCTGCAACTTGAATAGG - Intergenic
1157017534 18:43735311-43735333 ATACTTTCTGTATCTGATATAGG - Intergenic
1157726417 18:49967782-49967804 ATGCTGGCTGTACCTTGGAATGG + Intronic
1159198505 18:65150223-65150245 ATTCTTGCTGTACTTTGTGTGGG - Intergenic
926849301 2:17177476-17177498 ATGCTTGCAGTACCCTGTATAGG - Intergenic
929893728 2:45939873-45939895 ATGCTTGCTGTAAATTGTTTTGG + Intronic
930682849 2:54275675-54275697 ATGCTTGATGTTCCTTAGAAAGG - Intronic
931083738 2:58805323-58805345 ATGTTTGCTGTCCCTTGTTTAGG + Intergenic
931919172 2:66994282-66994304 ATGCTTGGCGTTCCTTACATGGG - Intergenic
934590099 2:95541133-95541155 ATGCTTCCTGTATCTTATCCTGG + Intergenic
935651175 2:105383293-105383315 ATGCTTCCTGAACCTTTTCTTGG - Intronic
942220948 2:173768429-173768451 ATTCTTCCTTTGCCTTATATCGG - Intergenic
942727254 2:179023905-179023927 ATGCTTGATATACATTATACAGG + Intronic
943552908 2:189363310-189363332 ATGCTTCCTGGACCTGATAAAGG - Intergenic
948283783 2:236768862-236768884 ATGCTTTCTGTGCCAAATATTGG + Intergenic
1169741619 20:8901170-8901192 ATGCTTGTTGTAAGTTATTTGGG - Intronic
1170561015 20:17558581-17558603 CCGCTTGCTGTACCTTCTACGGG + Intronic
1172580654 20:36044667-36044689 ATGTTTGCTGTGCCTGATTTGGG + Intergenic
1176859579 21:14001358-14001380 ATTCTTCCTGTACCATATATAGG - Intergenic
1177039498 21:16089859-16089881 ATGCTTGCTGAACTTTTCATTGG + Intergenic
1178115228 21:29410127-29410149 GTGCATGTTGTACCTGATATAGG - Intronic
951265297 3:20558574-20558596 ATTTTTACTATACCTTATATGGG - Intergenic
956587939 3:70884042-70884064 ATTCTTGCTCTGTCTTATATGGG + Intergenic
959272579 3:104232187-104232209 ATTTTTACTGTACCTTTTATAGG - Intergenic
967679882 3:192348839-192348861 ATGATTACAGTACCTTTTATAGG + Intronic
967682950 3:192386327-192386349 ATGCTAGCTGCAGCTTATCTTGG + Intronic
972082276 4:35168036-35168058 ATTTTTTCTGTACCTTATTTTGG + Intergenic
973200928 4:47501329-47501351 CTGCTTACTGTGCCTTATAGAGG - Intronic
976622389 4:87142388-87142410 ATGCATGCTGTAACTTTTAGGGG - Intergenic
977402725 4:96554326-96554348 ATGCTTGTTTTAACTTACATTGG - Intergenic
978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG + Intronic
982730121 4:158946818-158946840 CTGCTTTCTTTACCTTCTATTGG - Intronic
984806368 4:183755405-183755427 ATGTTTCCTGTACCTTTTCTAGG + Intergenic
989643552 5:43605176-43605198 ATGTTTAATGTAACTTATATGGG - Intronic
989761070 5:45017585-45017607 ATTTTTACTGTACCTTTTATAGG + Intergenic
990280055 5:54240433-54240455 ATACTTGATGTACCTTACAGTGG - Intronic
990369633 5:55104253-55104275 TTGCTGTCTGTTCCTTATATGGG - Intronic
993277262 5:85876531-85876553 AGGATTGCTGTATCTTATATTGG + Intergenic
993856138 5:93077888-93077910 AAGAGTGGTGTACCTTATATTGG + Intergenic
1003232521 6:4267543-4267565 ACGCTTGGTGTAACTTTTATTGG + Intergenic
1008464984 6:51820370-51820392 ATGCTTGCTGCTCCTTCTATAGG - Intronic
1011959863 6:93073996-93074018 ATGCTGACTTGACCTTATATGGG - Intergenic
1012705288 6:102519612-102519634 ATCACTTCTGTACCTTATATTGG - Intergenic
1013625087 6:111928926-111928948 ATGCATACTGTACTTTGTATTGG - Intergenic
1017615723 6:156244455-156244477 ATGCTTGCAGGACTTTATAAGGG - Intergenic
1022632240 7:32096108-32096130 CTGCCTGCTGTACCCTATTTTGG - Intronic
1030194763 7:106842659-106842681 ATGCTTGCATTATCTTATAGGGG + Intergenic
1039316989 8:36384625-36384647 AAGCTTTCTGCACCTTACATAGG - Intergenic
1039496415 8:37984148-37984170 ATTTTTACTGTACCTTTTATAGG + Intergenic
1047670783 8:127143803-127143825 ATGCTTGCTGTACTTTCTGTGGG - Intergenic
1051358201 9:16259146-16259168 ATGCCCGCTGAGCCTTATATGGG + Intronic
1052389569 9:27863346-27863368 ATGCTTGGTCCCCCTTATATAGG + Intergenic
1056899891 9:90588339-90588361 ATGCTTGATGGGTCTTATATTGG + Intergenic
1058497165 9:105571572-105571594 ATGCCTGTAGTAGCTTATATAGG + Intronic
1058882177 9:109295152-109295174 GTGCTTGGTGCACCTTATAAAGG + Intronic
1059826662 9:118037451-118037473 ATGCTTTGTGTACTTTATAGTGG - Intergenic
1187653389 X:21438294-21438316 ATTCTTACTGTACCTTTTCTGGG - Intronic
1187957846 X:24537480-24537502 ATGCTTGTTATACCTTTTTTAGG + Intronic
1190752577 X:53375122-53375144 ATGCTTGCAGTCCCTTCTAAGGG - Exonic
1192235742 X:69294498-69294520 ATTCTGGCTGTACTTTTTATTGG + Intergenic
1194473672 X:94332071-94332093 ATTCTTACTGTACCTTTTCTAGG + Intergenic
1195308231 X:103606931-103606953 ATGCTTCTTGGACCTTATGTAGG + Intergenic
1200754683 Y:6979606-6979628 ATGCTTGCTGTATTCTAGATGGG + Intronic