ID: 903204865

View in Genome Browser
Species Human (GRCh38)
Location 1:21773892-21773914
Sequence CTTTGGGAGGGCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270098
Summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903204858_903204865 -8 Left 903204858 1:21773877-21773899 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903204865 Original CRISPR CTTTGGGAGGGCAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr