ID: 903209402

View in Genome Browser
Species Human (GRCh38)
Location 1:21808305-21808327
Sequence AGGGTGTTACAGGGGTTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903209387_903209402 28 Left 903209387 1:21808254-21808276 CCTGACCTCAGGTGGTCTGCCTG 0: 102
1: 8372
2: 27462
3: 64351
4: 91507
Right 903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG No data
903209393_903209402 -1 Left 903209393 1:21808283-21808305 CCTCCCAAAGTGCTGGGTTTACA 0: 1272
1: 294433
2: 266841
3: 153371
4: 134134
Right 903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG No data
903209390_903209402 9 Left 903209390 1:21808273-21808295 CCTGTCTTGGCCTCCCAAAGTGC 0: 3193
1: 67348
2: 183905
3: 230078
4: 178472
Right 903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG No data
903209395_903209402 -4 Left 903209395 1:21808286-21808308 CCCAAAGTGCTGGGTTTACAGGG 0: 19
1: 4964
2: 305243
3: 274095
4: 153058
Right 903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG No data
903209388_903209402 23 Left 903209388 1:21808259-21808281 CCTCAGGTGGTCTGCCTGTCTTG No data
Right 903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG No data
903209397_903209402 -5 Left 903209397 1:21808287-21808309 CCAAAGTGCTGGGTTTACAGGGT No data
Right 903209402 1:21808305-21808327 AGGGTGTTACAGGGGTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903209402 Original CRISPR AGGGTGTTACAGGGGTTACA GGG Intergenic
No off target data available for this crispr