ID: 903209904

View in Genome Browser
Species Human (GRCh38)
Location 1:21812112-21812134
Sequence CTTCTGGGAGGAGGACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903209904_903209918 28 Left 903209904 1:21812112-21812134 CCTGTGGGTCCTCCTCCCAGAAG 0: 1
1: 0
2: 2
3: 26
4: 230
Right 903209918 1:21812163-21812185 CTGGTTCCTGTCTGGCAGAAGGG 0: 1
1: 0
2: 1
3: 20
4: 188
903209904_903209919 29 Left 903209904 1:21812112-21812134 CCTGTGGGTCCTCCTCCCAGAAG 0: 1
1: 0
2: 2
3: 26
4: 230
Right 903209919 1:21812164-21812186 TGGTTCCTGTCTGGCAGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 241
903209904_903209915 20 Left 903209904 1:21812112-21812134 CCTGTGGGTCCTCCTCCCAGAAG 0: 1
1: 0
2: 2
3: 26
4: 230
Right 903209915 1:21812155-21812177 TGAGTTTCCTGGTTCCTGTCTGG 0: 1
1: 0
2: 0
3: 22
4: 197
903209904_903209910 -6 Left 903209904 1:21812112-21812134 CCTGTGGGTCCTCCTCCCAGAAG 0: 1
1: 0
2: 2
3: 26
4: 230
Right 903209910 1:21812129-21812151 CAGAAGCCCTATGGCTGAACCGG 0: 1
1: 0
2: 2
3: 17
4: 123
903209904_903209913 9 Left 903209904 1:21812112-21812134 CCTGTGGGTCCTCCTCCCAGAAG 0: 1
1: 0
2: 2
3: 26
4: 230
Right 903209913 1:21812144-21812166 TGAACCGGATCTGAGTTTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 63
903209904_903209917 27 Left 903209904 1:21812112-21812134 CCTGTGGGTCCTCCTCCCAGAAG 0: 1
1: 0
2: 2
3: 26
4: 230
Right 903209917 1:21812162-21812184 CCTGGTTCCTGTCTGGCAGAAGG 0: 1
1: 0
2: 0
3: 39
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903209904 Original CRISPR CTTCTGGGAGGAGGACCCAC AGG (reversed) Intergenic
900403634 1:2483037-2483059 GCTCTGGGAAGAGGACCCAGCGG + Intronic
900492937 1:2961699-2961721 CGCCTTGGAGGAGGGCCCACAGG - Intergenic
900820418 1:4882486-4882508 CTTCTGGGTGGAGGCACCAAAGG + Intergenic
901341936 1:8502574-8502596 CTTCTGGGAGGTGTGCCCAGCGG + Intronic
902219142 1:14953785-14953807 CTTCTGGGAAGTGGACTCAATGG - Intronic
902384250 1:16067404-16067426 CTTCTGGGAGAGGGAGCCACAGG - Intronic
902454364 1:16521349-16521371 CTTCTGCGCGGTGGAGCCACGGG + Intergenic
903209904 1:21812112-21812134 CTTCTGGGAGGAGGACCCACAGG - Intergenic
904318836 1:29683458-29683480 CTTCCCGGAGGAGGAGACACTGG - Intergenic
904405213 1:30283858-30283880 ACCCTGGGAGGAGGATCCACGGG + Intergenic
904856046 1:33499000-33499022 CTTCTGGGAGGAGGCTACAGTGG - Intergenic
905692598 1:39954578-39954600 CTTCTGGCAGGGGCAGCCACTGG + Intergenic
910071395 1:83218474-83218496 CGTTTGGGAGGAGGACCAAAAGG + Intergenic
910292379 1:85612105-85612127 CTTCTGGAAGGGTGAACCACAGG - Intergenic
912715259 1:111979050-111979072 CTTCTGGGAGGAGAACCAAATGG - Intronic
915129753 1:153688150-153688172 GTGCTGGGCTGAGGACCCACAGG + Exonic
916579746 1:166096699-166096721 ATTCAGGGAGGAAGACCAACTGG - Intronic
916728308 1:167543550-167543572 CTTCTTGGAGAACCACCCACAGG - Intronic
916874962 1:168959445-168959467 TTTCTGGGAGCAGAAGCCACTGG - Intergenic
919504150 1:198376380-198376402 ATGCAGGGAGGAGGACACACTGG + Intergenic
920066558 1:203273582-203273604 CTGCAGCGGGGAGGACCCACAGG + Intronic
920071765 1:203307324-203307346 CTTGTACGAGGAGGCCCCACTGG + Exonic
922902337 1:229146853-229146875 CCTCTGAGAGGAGGACTCAGGGG - Intergenic
1063560096 10:7118230-7118252 CTTCTCAGAGGAGAACCCAGCGG + Intergenic
1068019760 10:51566727-51566749 CGACTGGATGGAGGACCCACAGG + Intronic
1069724207 10:70566956-70566978 CTCCAGGGAGGAGCACTCACTGG + Exonic
1071717442 10:88111649-88111671 ACTCTTGGAGGAGGATCCACTGG + Intergenic
1071719861 10:88132079-88132101 CTTCTGGGAGGAGGCCCAGCTGG - Intergenic
1072414611 10:95236804-95236826 CCTCTGTGAGGAGGACACAGTGG + Intergenic
1074368038 10:112875906-112875928 CTTCTGGAGGGAGGAACCTCTGG + Intergenic
1075396813 10:122133676-122133698 CTTCTGGGAGGAAGGGTCACTGG - Intronic
1076714561 10:132356780-132356802 ATTCTGGAGGGAGGAGCCACCGG - Intronic
1077369202 11:2173708-2173730 CTACTGTGGGCAGGACCCACAGG - Intergenic
1077995036 11:7445695-7445717 CATCTGGGAAGACGGCCCACAGG + Intronic
1078391817 11:10941450-10941472 CTTCTGGGATTAGGACACAAAGG + Intergenic
1078471861 11:11594184-11594206 CTTCTGGAATGAGGTCCCTCTGG - Intronic
1078844325 11:15107812-15107834 CTTCTGGAAGGAGGACAGCCTGG - Intergenic
1082233587 11:49798049-49798071 CATCTGGGAGGTGTACCCAACGG - Intergenic
1083852598 11:65376932-65376954 CTTCCGGGAGGAGGGGCCCCGGG - Exonic
1084186895 11:67477938-67477960 CGTCTGGGAGGTGTACCCAACGG - Intergenic
1084584630 11:70050466-70050488 CTACAGGGAGGAGGAGCCATAGG - Intergenic
1085314555 11:75536529-75536551 CTTCCTGGAGGAGGAGACACGGG - Intergenic
1085521084 11:77139256-77139278 TTCCTGGGGGGAGGCCCCACAGG + Intronic
1089298012 11:117481374-117481396 GTTCTGGGAGGGGGACCCACAGG + Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1091792333 12:3279003-3279025 CTGCTAGGAGGATGACCAACAGG - Exonic
1095181856 12:39155039-39155061 CTGCTGGGAGGATGACCAATGGG + Intergenic
1095986423 12:48002496-48002518 CCTCTGGGAGGAGGAGCGACTGG + Intronic
1096214604 12:49792308-49792330 CCTCTGGGAGGAGGACCCCTGGG - Intronic
1096510199 12:52123595-52123617 CTCCTGGGAGGAGCAGCCTCTGG + Intergenic
1096586927 12:52628933-52628955 CCTCTGGGAGGGAGACCCACAGG + Intergenic
1097779625 12:63687074-63687096 CGTCTGGGAGGTGTACCCAATGG + Intergenic
1103881941 12:124172844-124172866 CCTGTGGGAGGAGGCCCCACCGG + Intronic
1104542564 12:129680889-129680911 CTGGTGGGAGCTGGACCCACAGG + Intronic
1104605116 12:130182614-130182636 CCTGGGGGAGGAGGACCCACTGG - Intergenic
1104749577 12:131229832-131229854 CTGCTGGGAGCACTACCCACGGG - Intergenic
1105790847 13:23797313-23797335 CTCCTGGGCTGTGGACCCACTGG + Intronic
1106563918 13:30869583-30869605 CTTCAGCGAGGAGGAGACACGGG + Intergenic
1113665802 13:112141648-112141670 CTTCTGGGACGAGGACCAGTGGG + Intergenic
1113723234 13:112577358-112577380 TTTTTGGGAGGAAGACCCCCAGG - Intronic
1114828902 14:26114324-26114346 CTTCTGGGAGGAGAATCCTCAGG - Intergenic
1119780423 14:77273334-77273356 CTCCTGGGCGGATGACCCACAGG - Intergenic
1129054616 15:72810144-72810166 CTTCCTGGAGGAGGATCAACTGG + Intergenic
1129274900 15:74438572-74438594 CTGCTGGGAGCACGACCCTCAGG - Intergenic
1130317061 15:82805289-82805311 CTTCTGGGAAGAGAATTCACAGG - Intronic
1130317171 15:82806456-82806478 CTTCCGGGAAGAGAACTCACAGG + Intergenic
1130742770 15:86619038-86619060 CTTCTGTAATGAGGACCCTCAGG + Intronic
1131345907 15:91647853-91647875 CTCCTGGGATGAAGGCCCACAGG + Intergenic
1132149168 15:99447482-99447504 CTTCAGGGACGAGGAGCCGCAGG - Intergenic
1132555495 16:570193-570215 CTTCTGGGAGGAGAAAGCAGCGG - Intronic
1132947163 16:2538036-2538058 CTTCGGGGAGGAGGACGCTGAGG + Exonic
1133260145 16:4543992-4544014 TTTGAGGCAGGAGGACCCACTGG + Intergenic
1134482961 16:14634109-14634131 CTTCGGCGGGGAGGACCCAATGG - Intronic
1135323441 16:21511864-21511886 CCTCTGGAAGGCGGACCCTCCGG - Intergenic
1135540083 16:23323258-23323280 CTTCTTGGAGGAGGTGGCACTGG + Intronic
1136334926 16:29605129-29605151 CCTCTGGAAGGCGGACCCTCCGG - Intergenic
1136408556 16:30063887-30063909 CTTCAGGGAGGAGGGCACATGGG - Exonic
1138497409 16:57416676-57416698 CTTCAGTCAGGAGGAACCACAGG - Intergenic
1138538488 16:57673506-57673528 CTGCTGGGAGGAGGACTATCAGG + Intronic
1139484919 16:67249970-67249992 CTGGTGGGAGGAGGGACCACTGG - Intronic
1140739726 16:77930399-77930421 CCTCGGGGAGAAGGGCCCACAGG + Intronic
1141821590 16:86449876-86449898 CTTGTGGGAGGAGAACCCGTGGG + Intergenic
1142035646 16:87860949-87860971 CCTCTGGAAGGCGGACCCTCCGG - Intronic
1142106173 16:88304088-88304110 GTTCTGGGAGGAGGACTTGCTGG + Intergenic
1142315794 16:89344141-89344163 GCTCTGGGAGGAGCACACACGGG + Intronic
1142623959 17:1180575-1180597 CTCCTGGGCGGAGGACAAACTGG + Intronic
1142625455 17:1188862-1188884 CTTCTGGGAGGGGCAGCCAGAGG - Intronic
1142672955 17:1495846-1495868 CTCCTTGAGGGAGGACCCACTGG - Exonic
1144887668 17:18474718-18474740 GTTCTGGGTGGTGGTCCCACAGG - Intergenic
1145144548 17:20469582-20469604 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145176000 17:20700984-20701006 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145271342 17:21406490-21406512 ATTCTGGGAGCAGAAGCCACAGG - Intronic
1145309547 17:21693894-21693916 ATTCTGGGAGCAGAAGCCACAGG - Intronic
1146883761 17:36457681-36457703 CTTCTGGGAGTCAGCCCCACAGG - Intergenic
1147318607 17:39632859-39632881 CTTCTGAGGGGAGGGGCCACTGG + Intronic
1148321527 17:46758321-46758343 TTCCTGGGAGGAGGACCCTGAGG + Intergenic
1150218433 17:63482866-63482888 CTGCTTGGAAGAGGACCCCCAGG - Intergenic
1151682833 17:75630791-75630813 CTTCTAGCAGGAGGATCCCCAGG - Exonic
1152807946 17:82366065-82366087 CTTTTGGAAGGAGGTCCCAGGGG - Intergenic
1154095947 18:11414780-11414802 TGGCTGGGAGGAGGAGCCACTGG + Intergenic
1155507154 18:26545650-26545672 CTGCAGGCAGGAGTACCCACTGG - Intronic
1156723475 18:40099026-40099048 CTTCTGGTGTGAGGATCCACTGG + Intergenic
1157259560 18:46166526-46166548 GTGCTGGGAGGATGGCCCACTGG - Intergenic
1158216116 18:55102405-55102427 CTTCTGGGAGGACAGACCACAGG + Intergenic
1158662592 18:59402095-59402117 CTTCTTGGAGGAGGAAACCCTGG + Intergenic
1160185708 18:76674786-76674808 CTCCAGGCAGGAGGAGCCACAGG + Intergenic
1160912879 19:1482944-1482966 CTTCTGGGATGAGAACCCACAGG - Exonic
1161455834 19:4369414-4369436 CTTCTGGGCGGAGGCCACCCCGG + Intronic
1161868240 19:6850559-6850581 CTTCAGGGAGGAGTAACTACTGG - Intronic
1162468806 19:10859769-10859791 CTTCTGTGGGGAAGACCCATGGG + Intronic
1163883713 19:19948382-19948404 CTTTTGGGAGGAGGTTCCAGGGG - Intergenic
1164238876 19:23366075-23366097 CGTCTGGGAGGTGTACCCAACGG - Intronic
1164456502 19:28411832-28411854 CATCTGGGTTGAGGACACACAGG - Intergenic
1165148902 19:33749722-33749744 CCTCAGGGAGGTGCACCCACTGG - Intronic
1166195533 19:41203387-41203409 CTTCTGAGAGGAGGATCCCTGGG + Intronic
925284481 2:2706761-2706783 ATTCTGGAAGCAGGAGCCACAGG - Intergenic
925372545 2:3357333-3357355 CAGCTGTGAGGAGGACCCAGTGG + Intronic
926326908 2:11792881-11792903 CTGCTGGGAGGAGGAGACCCAGG - Intronic
927490518 2:23518209-23518231 CATGTGGGAGGAGGAGCCATAGG - Intronic
927933855 2:27063713-27063735 GTTCAGGGAGGATGACACACAGG + Intronic
928078725 2:28289170-28289192 CTTCTGGGAGAGACACCCACAGG - Intronic
928229312 2:29482625-29482647 CTTCTGTGCTGAGGACCCATAGG - Intronic
928434841 2:31248321-31248343 CTTCCTGGAGGAGGAGGCACTGG - Intronic
929833783 2:45375266-45375288 CTTCTGGGTGGGGGAGCCTCAGG + Intergenic
931515772 2:63050171-63050193 CGCCTGGGAAGAGCACCCACTGG - Intronic
931928679 2:67104481-67104503 CTTCTGGGTGGAGGTCACAGAGG - Intergenic
931943607 2:67280905-67280927 ATTTTGGTAGGAGGACACACTGG + Intergenic
933704542 2:85279910-85279932 CTGCTGGGAGGAGACCACACTGG - Intronic
934766635 2:96883555-96883577 TTTCTGGCAGGAGGACCCTGCGG + Intronic
935129088 2:100247886-100247908 CTGGTGGAAGGAGGACACACCGG - Intergenic
938262105 2:129903630-129903652 CTGCTGGAAGCAGGTCCCACAGG - Intergenic
941197677 2:162470732-162470754 CGTCTGGGAGGTGTACCCAACGG + Intronic
941731462 2:168922462-168922484 CTTCTGGAAGGAGGAGACAAGGG - Intergenic
941801309 2:169662986-169663008 CTGCAGTGAGGAGGACCCTCAGG - Intronic
945915174 2:215696204-215696226 CTACTGGGTGAAGGACCTACTGG + Intergenic
946941284 2:224772450-224772472 CTTCTGCAAGGAGGACGCCCTGG - Intronic
947792044 2:232873947-232873969 CCTCTGGCAGGAGGCCCCATGGG - Intronic
948363408 2:237438368-237438390 CTCCTGGGTGGAGGATCTACAGG - Intergenic
948728653 2:239949924-239949946 CTCCTGAGACCAGGACCCACAGG - Intronic
948924840 2:241088765-241088787 CACCTGGGAGGAGGGGCCACGGG + Exonic
1169276939 20:4239637-4239659 CAACTGGAAGGAGTACCCACTGG + Intronic
1169791486 20:9414676-9414698 CTTGTGGGAGGACGCACCACTGG + Intronic
1169895135 20:10496722-10496744 CTTCTGGGAGTAGCACCCAAGGG + Intronic
1170883910 20:20321793-20321815 TTTCTGGGAGGAGGGCCAAATGG - Intronic
1172148998 20:32777563-32777585 GCTCTGGGGGGAGGACACACAGG - Intronic
1172214920 20:33228539-33228561 CTTGTGGGATGGGCACCCACTGG + Intergenic
1173618635 20:44419605-44419627 CCTGTGGGAGGAGGACCTGCAGG - Intronic
1173809546 20:45947762-45947784 CTGCGGGGAGGAGGAGCCCCAGG + Exonic
1173907798 20:46641523-46641545 CTTCTAGGAGGAGGTACCATTGG + Intronic
1174183666 20:48690589-48690611 ATTCTGGGAGGAGGGTCCATTGG - Intronic
1174416780 20:50372802-50372824 CTTCTGGGAAGAGGACAAACAGG - Intergenic
1174446590 20:50594978-50595000 CTTCTGAGGGGAGGTCCCACGGG + Intronic
1175172790 20:57091944-57091966 GTGCTGGGAGGTGGACCCCCAGG + Intergenic
1176052220 20:63125912-63125934 CTTCTGTGGGGAGGAGCCGCTGG + Intergenic
1178113386 21:29392713-29392735 CATCTGGGAGGTGTACCCAACGG - Intronic
1179624570 21:42641486-42641508 CTGTTGGGAGGAGGATCCTCCGG - Intergenic
1179930413 21:44567832-44567854 CTTCAGGGAAGAGGTCACACTGG + Exonic
1180702729 22:17790509-17790531 CTCCTGGGAGGAGGCCCACCTGG - Exonic
1180832626 22:18913705-18913727 CTGCTGGGAAGAGGCCTCACTGG - Intronic
1181067238 22:20312688-20312710 CTGCTGGGAAGAGGCCTCACTGG + Intergenic
1182301036 22:29337289-29337311 CTGCTGGGAGGAGGACGTGCTGG + Intronic
1183076695 22:35431840-35431862 TTTCTGGAAGGAGGGCCCCCTGG - Intergenic
1183563992 22:38599701-38599723 CTTCTGGGAAGAGGACGCGGGGG + Intronic
1183639258 22:39083352-39083374 CTTGCTGGAGGTGGACCCACTGG - Intronic
1184296050 22:43526279-43526301 CTTCTGGGAAAGGGACCCAGAGG + Intergenic
1184452765 22:44592669-44592691 CTGCTGGGCGGGGGAACCACGGG - Intergenic
1203282712 22_KI270734v1_random:139010-139032 CTGCTGGGAAGAGGCCTCACTGG - Intergenic
959156063 3:102667232-102667254 CTTGAGGGAGGAGGAGGCACAGG - Intergenic
964722669 3:159782892-159782914 CTTCTGGGAGGAGAGCTCTCTGG - Intronic
965079857 3:164021684-164021706 CTTCTGGGAGGAGGTTCCTGGGG + Intergenic
966011791 3:175087395-175087417 CGTCTGGGAGGTGTACCCAACGG + Intronic
966697892 3:182811542-182811564 CTTCTGGGGGGATGAGCCAAAGG - Intronic
966724848 3:183099802-183099824 CTTCTGGGAGAAGAACCCTGGGG + Intronic
967775447 3:193381538-193381560 CTTCTGGGAGAAGCAGCCTCAGG + Intergenic
967824493 3:193867726-193867748 CCTCTGGGAGCATTACCCACAGG + Intergenic
968392039 4:201474-201496 CCTCTGGGTGGTGGACCTACTGG + Intergenic
968954635 4:3711986-3712008 CAGCTGGGACGAGGACCCACAGG - Intergenic
969466094 4:7357318-7357340 CATCTGGGATTAGGAACCACTGG - Intronic
969510160 4:7613030-7613052 TTTCTGCGGGGAGGAGCCACAGG + Intronic
970669442 4:18379106-18379128 CTTCTTGGAGGAAGAGTCACTGG + Intergenic
973754928 4:54064843-54064865 CTTCTGGGTGGCGGACCCTGGGG + Intronic
975198847 4:71560858-71560880 CTAATTGGAGGAGGACCCTCTGG - Intronic
981005578 4:139871671-139871693 GCTCAGGGAGGAGGACCCAGGGG - Intronic
984862970 4:184256377-184256399 CTTCTTGGAGAAGGACTCAACGG - Intergenic
985293232 4:188407316-188407338 CTTATGGGAGGGGGGCACACAGG - Intergenic
985537550 5:473517-473539 GTCCTGGGAGGAGGCCCCAGCGG - Intronic
985634310 5:1028478-1028500 CTTATGGGATGAGGCCCCACGGG + Intronic
985913204 5:2898650-2898672 GTCCTGGGAGGATGTCCCACAGG - Intergenic
987249067 5:16080273-16080295 CTTCTAGGAGGAGGAGCAAGTGG - Intronic
987453643 5:18117036-18117058 CTTGGGGGAGGAGGAACCATAGG - Intergenic
987620307 5:20331686-20331708 CTGGGGGGAGGAGGACCCCCTGG - Intronic
991505970 5:67324735-67324757 CTTCTGGGAGAGACACCCACAGG - Intergenic
992643550 5:78791521-78791543 GATCTGGGAGGGGGACTCACGGG - Intronic
993913603 5:93713837-93713859 CCTCTCTTAGGAGGACCCACAGG - Intronic
995140330 5:108728298-108728320 CCACTGAGAGGAGGACCCTCCGG - Intergenic
997740770 5:136251835-136251857 AATCTGGGAGGAGGGGCCACGGG - Exonic
997826722 5:137112969-137112991 CTTTTGTGTGGAGGACGCACGGG + Intronic
998214625 5:140227776-140227798 CTTCTGCCATGAGGACCCCCAGG + Intronic
998754386 5:145360108-145360130 TTTGGAGGAGGAGGACCCACAGG - Intergenic
999329078 5:150660614-150660636 CTTCCCAGAGGAGGACACACTGG - Intergenic
999703987 5:154254953-154254975 CTTCTGGGAGGAGCTCCTACAGG - Intronic
1000011270 5:157235343-157235365 CTTCTGGGAGGAGGCAACATTGG - Intronic
1001531241 5:172463332-172463354 CTCCAGGCAGGAGGACCCAATGG + Intergenic
1001597447 5:172907186-172907208 CTGCTGCAAGGAAGACCCACTGG - Intronic
1004022421 6:11787615-11787637 CTTCTGGGAGGAGGTTCCTGGGG - Intronic
1006750883 6:36376067-36376089 CTTCTTTGAGGAGGCCCGACGGG - Intronic
1006992177 6:38224456-38224478 CTTCAGGGAAGAGGACCCTTGGG + Intronic
1007321954 6:41034042-41034064 CTTCAGGAAGGAGGCCCCATGGG + Exonic
1007756583 6:44103509-44103531 CATCTGGGATGGGGAGCCACTGG + Intergenic
1007884807 6:45214987-45215009 TTCCTGGGAGTAGGAGCCACGGG - Intronic
1013632443 6:111998367-111998389 CTACTGGGAGGAGGAAGCACAGG - Intergenic
1014800421 6:125771133-125771155 CGTCTGGGAGGTGTACCCAACGG + Intergenic
1018267352 6:162039532-162039554 CTTCTGGGCAGAGGTCCCATGGG - Intronic
1018296409 6:162349957-162349979 CTTCTGGTAGGAGTTCCCATAGG - Intronic
1018629279 6:165808292-165808314 CTTCTGGGAGGAGGACCAGAGGG - Intronic
1018652550 6:166004209-166004231 CTTCTGGGAAGAGCACCCCCAGG - Intergenic
1019122050 6:169811562-169811584 CAGCTGGGTAGAGGACCCACAGG - Intergenic
1019882004 7:3869572-3869594 CTGCTGGGAAGAGGACGCAGCGG - Intronic
1020013392 7:4818147-4818169 CTCCTGGAAGAAGGCCCCACAGG - Intronic
1024296889 7:47851327-47851349 CATCTTGGAGGAGCTCCCACTGG + Intronic
1025007373 7:55365269-55365291 TGTCTGGGAGGAGGAGCCACAGG - Intergenic
1025023537 7:55498013-55498035 CTGCTGGGAGGAGGCTCCACAGG + Intronic
1025253916 7:57370291-57370313 CTTCTGGGAAGAGGACAAACAGG + Intergenic
1026875966 7:73879352-73879374 CTGGTGGCAGCAGGACCCACAGG - Intergenic
1030381834 7:108820632-108820654 CCTCTGGGAGGAGGACAGAAAGG + Intergenic
1032083291 7:128870511-128870533 AGTCTGAGAGGAGGACCCTCAGG - Intronic
1032986509 7:137343564-137343586 CTTCTGGACGGATGACTCACTGG + Exonic
1033155668 7:138954880-138954902 CATCTGGAAGGGGGACCCAGGGG + Intronic
1033589806 7:142799770-142799792 CTTCTAGCAGGAGGCCCCATGGG + Intergenic
1035554354 8:555057-555079 CTTCTGGGAGGGGGCCCTAGGGG - Intergenic
1035787144 8:2270441-2270463 GTTCAGGGATGAAGACCCACAGG - Intergenic
1035805663 8:2451275-2451297 GTTCAGGGATGAAGACCCACAGG + Intergenic
1037759737 8:21733962-21733984 CCTCTGGGAGGTGGATCCACAGG + Intronic
1037827257 8:22166706-22166728 CTCCTGGGAGGGTGGCCCACAGG + Intronic
1039258906 8:35749457-35749479 CTTCTGGGAGGAAGACCCTAGGG - Intronic
1040462149 8:47659554-47659576 CGCCTGGGAGGAGGGCCGACCGG - Intronic
1041920671 8:63179726-63179748 CATCTGGGAGGTGTACCCAGCGG - Intronic
1045062600 8:98422589-98422611 ATTCTGGGAGGAGCAGGCACAGG + Intronic
1049309252 8:141924673-141924695 CATCTGGGATAAGGACTCACAGG - Intergenic
1050417012 9:5428560-5428582 ATTCTGGGACGAGGAGCCAAAGG + Intronic
1050585977 9:7111972-7111994 TTCCTGGGAGCAAGACCCACAGG + Intergenic
1055496547 9:76860892-76860914 CTTCTGGGAGGAAGACACCCTGG - Intronic
1056838317 9:89976195-89976217 CTTCTGGGGAGAGGTCACACAGG - Intergenic
1057014832 9:91642442-91642464 CTTCTGGGAGGGGGGCTCAGAGG - Intronic
1059341423 9:113599643-113599665 CTTCTGCTGGGAGGAGCCACTGG + Intergenic
1059389541 9:113990166-113990188 CTTCTGGGAGGAGGTGGCACTGG - Intronic
1060932062 9:127495453-127495475 CCTCTGGGAGGAGGTCCCCAGGG - Intronic
1060969992 9:127732390-127732412 CTTCTGGGTGTAGGACTCAGGGG + Intronic
1061714289 9:132509315-132509337 CTTTTGGGAGGTGGAGGCACTGG + Intronic
1061847130 9:133394142-133394164 CTTCTGAGAAGAGGACCTGCAGG + Intronic
1062039883 9:134399580-134399602 CTCCTGGGAGGAGGACAGGCAGG - Intronic
1062283090 9:135760539-135760561 CTTCTGGGAGACAGACCCCCAGG + Intronic
1188037760 X:25337995-25338017 CTTGTGGGAGGGGCAGCCACTGG - Intergenic
1195102723 X:101571191-101571213 CTGCTGGGAGGATGAGGCACTGG - Intergenic
1196340459 X:114589425-114589447 CTACTGTGAGTTGGACCCACAGG + Intronic
1197871800 X:131068560-131068582 GTACTGGGAGGAGGAGCCTCCGG - Intronic
1198533743 X:137567582-137567604 CTACTGGGAGGAGTGCCCCCGGG + Exonic
1198863215 X:141092601-141092623 GTTGTGGGAGGGGGACCCAGGGG - Intergenic
1198899475 X:141494786-141494808 GTTGTGGGAGGGGGACCCAGGGG + Intergenic